Literature DB >> 23626874

Generation of a Uracil Auxotroph Strain of the Probiotic Yeast Saccharomyces boulardii as a Host for the Recombinant Protein Production.

Hassan Hamedi1, Ali Misaghi, Mohammad Hossein Modarressi, Taghi Zahraei Salehi, Dorsa Khorasanizadeh, Vahid Khalaj.   

Abstract

BACKGROUND: Saccharomyces boulardii (S. boulardii) is the best known probiotic yeast. The genetic engineering of this probiotic strain requires the availability of appropriate mutants to accept various gene constructs carrying different selection markers. As the auxotrophy selection markers are under focus, we have generated a ura3 auxotroph mutant of S. boulardii for use in further genetic manipulations.
METHODS: Classical UV mutagenesis was used for the generation of auxotroph mutants. The mutants were selected in the presence of 5-FOA (5-Fluoroorotic acid), uracil and uridine. Uracil auxotrophy phenotype was confirmed by the ability of mutants to grow in the presence of uracil and the lack of growth in the absence of this compound. To test whether the uracil auxotrophy phenotype is due to the inactivation of URA3, the mutants were transformed with a plasmid carrying the gene. An in vitro assay was used for the analysis of acid and bile resistance capacity of these mutants.
RESULTS: Three mutants were found to be ura3 auxotroph as they were able to grow only in the presence of uracil. When the URA3 gene was added, these mutants were able to grow normally in the absence of uracil. Further in vitro analysis showed that the acid and bile resistance capacity of one of these mutants is intact and similar to the wild type.
CONCLUSION: A uracil auxotroph mutant of the probiotic yeast, S. boulardii, was generated and characterized. This auxotroph strain may have potential applications in the production and delivery of the recombinant pharmacuetics into the intestinal lumen.

Entities:  

Keywords:  Probiotic; Recombinant proteins; Uracil; Yeasts

Year:  2013        PMID: 23626874      PMCID: PMC3572704     

Source DB:  PubMed          Journal:  Avicenna J Med Biotechnol        ISSN: 2008-2835


Introduction

As the knowedge of probiotics expands, more possiblities arise for the engineering of the new probiotic strains. Recombinant probiotics are being considered as efficient bio-systems for the delievery of active molecules to the intestinal mucosa (1). S. boulardii is a well known probiotic yeast which is used alone or in combination with probiotic bacteria to support digestive system (2–6). S. boulardii is often marketed in a lyophilized form and is called S. boulardii lyo. The availibility of well-established genetic engineering methods in yeast has facilitated the possible genetic manipulation of this probiotic yeast. In genetic manipulation procedures, the selection of recombinant strains is usually performed by employing a suitable selection marker on a plasmid carrying the gene construct. Antibiotic resistance markers are widely used, but are considered as a major concern in probiotic applications. Hence, it is necessary to remove the antibiotic resistant gene from the host prior to commercial application (7). In this sense, the auxtrophic markers may be a better substitute as they are indigenous (8). Although these selection markers are commonly used in practice, but they require appropriate host strains which are auxotrophic for the specific nutrients corresponding to the inactivated gene (9). One example of these markers is the URA3 gene that encodes orotidine 5-monophosphate decarboxylase (OMPD Case), an enzyme involved in the de novo synthesis of pyrimidine ribonucleotides (10). The inactivation of URA3 results in uracil auxotrophy and 5-fluoroorotic acid resistance phenotype (11). In the present study, a uracil auxotroph mutant of S. boulardii was generated through UV mutagenesis. The auxotroph mutant was complemented by the URA3 gene. The ura3 mutant strain of S. boulardii can be used in future engineering of this important probiotic yeast.

Materials and Methods

Strains, media and plasmids

The yeast and bacterial strains used in the present study are listed in Table 1. pGEM–T Easy cloning system (Promega) was used for the cloning of PCR products. Plasmid pYES2 (Invitrogen) containing Saccharomyces cerevisiae (S. cerevisiae) URA3 gene was used as a control in transformation experiments.
Table 1

Strains used in this study

Strain of S. cerevisiae GenotypeSource
S. cerevisiae Σ1278b Wild-type (Matα)Our laboratory
S. boulardii Wild type (subspecies lyo)DiarSafe, (Wren Laboratories Ltd)
S. boulardii M1 ura3 - This study
S. boulardii M2 ura3 - This study
S. boulardii M3 ura3 - This study
Strain of E. coli
E. coli Top10 F′{lacIq Tn10 (TetR)} mcrA Δ(mrr-hsdRMS-mcrBC) Φ80lacZΔM15 ΔlacX74 recA1 araD139 Δ(ara-leu)7697 galU galK rpsL endA1 nupGInvitrogen
Strains used in this study Yeasts strains were grown and kept in YPD medium (1% yeast extract, 2% polypeptone and 2% dextrose). Yeast Nitrogen Base with ammonium sulphate and without amino acids (YNB medium; Sigma-Aldrich) was prepared at a concentration of 0.67% and was supplemented with 2% glucose, 10 mM uridine and uracil, and 0.1% 5-FOA (Sigma) to use in screening of auxotrophs.

DNA manipulations

Genomic DNA from both S. cerevisiae Σ1278b and S. boulardii was prepared as described before (12). All PCRs were performed as 30 cycles of 95°C for 1 min, 58°C for 30 s and 72°C for 1 min. The S. cerevisiae actin fragment (500 bp) was amplified using primers ACT1_F (CCCAATTGAACACGGTATTG) and ACT1_R (GCAGCGGTTTGCATTTCTTG) as a control in PCR reactions (Table 2).
Table 2

Primers used in this study

Primer nameSequence
ACT1_F (sense) 5‘CCCAATTGAACACGGTATTG3‘
ACT1_R (antisense) 5‘ GCAGCGGTTTGCATTTCTTG3‘
URA3_F (sense) 5‘ GTTAATGTGGCTGTGGTTTC 3‘
URA3_R (antisense) 5‘GTTACTTGGTTCTGGCGAGG3‘
Primers used in this study

UV light mutagenesis and isolation of uracil auxotrophs

A single colony from S. boulardii parental strain was grown for 20 hr in YPD broth. Cells were collected and washed with PBS and subjected to UV mutagenesis. 20 ml of cell suspension (1×107 viable yeasts ml in PBS) was gently agitated by a magnetic flea in a glass petri dish (with the lid removed) 15 cm below a UV lamp (Philips, TUV 15W/ G15). A dose response experiment was carried out by removing 0.5 ml samples at 10 s intervals over a 100 s period. Irradiated cell suspensions were stored in foil-wrapped tubes at 4°C overnight to avoid photoreactivation. Dilutions of cell suspension from various exposure times were made and plated onto YPD agar (3 replicates per dilution). All plates were incubated in the dark at 30°C. Colonies were counted initially after two days and finally after four days of incubation. A kill curve was plotted to estimate the exposure time to UV light to kill 90% of cells. This was then used for the subsequent mutagenesis procedures and the UV irradiated cells were kept at 4°C in a foil-wrapped tube. To isolate ura3 auxotroph mutants, approximately 107 mutagenized cells were spread onto 5-FOA plates containing uracil and uridine, and then were incubated at 30°C up to one week. The recovered colonies were isolated and plated on YNB medium with or without uracil supplement. Uracil auxotroph mutants were detected by their ability to grow only in the presence of this chemical.

Construction of URA3 cassette

The S. cerevisiae URA3 sequence (URA3/YEL021W, yeast genome database) was used as a template to design the URA3 specific primers. The forward primer, URA3_F (5′-G TTAATGTGGCTGTGGTT TC-3′), and the reverse primer, URA3_R (5′-GTTACTTGG TTC TGGCGAGG-3′) (Table 2), were designed to amplify an approximately 1.2 kb URA3 fragment containing the entire coding sequence with 5‘ and 3‘ flanking regions. Growth ability of wild type strains and ura3 mutants in the presence of acid and bile −no growth; + growth delay>4 hr; ++no delay in growth. M1, M2 and M3:the ura3 mutant of S. boulardii Survival after 4-hr incubation at pH=2.5 PCR on genomic DNA of S. boulardii was carried out using these primers. The resulting PCR fragment was cloned into pGEM-Teasy vector. The final vector was called pGEM-ura3 and used in transformation of the auxotroph strains.

Transformation of S. boulardii auxotroph strains

S. boulardii auxotrophic yeasts (ura3-) were transformed with the plasmid pGEM-ura3 using a standard electroporation method (13). As a positive control, a commercial episomal vector, pYES2 (Invitrogen), was used in transformation experiments. Following the transformation, cells were plated on YNB agar medium lacking uracil and uridine supplements.

Bile and acid resistance assay

Resistance tests were performed as described by van der Aa Kühle (14). In brief, all strains were refreshed in MYGP medium (Malt extract 1%, Yeast extract 1%, Peptone 2%, Dextrose 2%) for 24 hr at 30°C. Assays were performed in a 200 µl volume in 96-microwell plates. The wells were inoculated in triplicates with 106 yeast cells and the cells were allowed to grow for 48 hr at 30°C in YNB medium containing acid (pH = 2.5) or 0.3% (w/v) Oxgall (Difco). For the auxotroph mutants the medium was supplemented with uracil (10 mM). Viability tests were performed after 4 hr of incubation by plating of 100 µl of cell suspensions onto MYGP agar for 3 days at 30°C.

Results

UV survival curve

UV irradiation of cell suspension from S. boulardii was performed and the percentage of survival against time was plotted to estimate the UV exposure time required to kill 90% of cells (Figure 1). An exposure time of 23 s was chosen for mutagenesis.
Figure 1

Survival rate of S.boulardii following UV irradiation. Cell counts were performed in triplicates

Survival rate of S.boulardii following UV irradiation. Cell counts were performed in triplicates

Isolation of URA3 mutants

Mutagenized yeasts were screened for ura3 phenotype on 5-FOA/UU plates. Approximately 350 FOA resistant colonies were isolated and further screened for uracil auxotrophy (Figure 2). Eight colonies out of 350 were able to grow in YNB-uracil medium but not in YNB. Three mutants, S. boulardii M1, M2 and M3, which had similar growth properties compared to the wild type, were chosen for further studies. These mutants were tested for mutation reversion by plating of 106, 107 and 108 viable cells on YNB agar and counting the number of possible revertants up to 5 days. No revertant was appeared during these incubation periods, indicating that a stable mutation has occurred in the target gene.
Figure 2

FOA resistant colonies on YNB plates. Approximately 107 mutagenized cells (10% survival) were plated on YNB-FOA -UU plates. The resistant colonies appeared after 5-7 days

FOA resistant colonies on YNB plates. Approximately 107 mutagenized cells (10% survival) were plated on YNB-FOA -UU plates. The resistant colonies appeared after 5-7 days

Complementation of ura3- mutants of S. boulardii

The URA3 gene from S. boulardii was successfully amplified as a 1.2 kb fragment using designed specific primers (Figure 3). This was subsequently cloned into pGEM-Teasy vector. The final construct, pGEM-ura3, was confirmed by restriction analysis and sequencing. The size of URA3 construct was 4.3 kb and the digestion map using SacI/NcoI showed two expected fragments as ∼1 kb and 3.3 kb (Figure 4B).
Figure 3

Amplification of ura3 and actin fragments using genomic DNA of S. cerevisiae and S. boulardii. M: Size marker, 1: S. cerevisiae ura3 fragment (1.2 kb), 2: S. cerevisiae actin fragment (0.5 kb), 3: S. boulardii ura3 and 4: S. boulardii actin fragments

Figure 4

A) Schematic representation of pGEM-ura3 construct. The position of designed primers and restriction sites is shown. B) Restriction analysis of pGEM-ura3 vector. Lane 1: Fragments generated by NcoI/SacI digestion of the construct (∼1 kb and ∼3.3 kb). Lane 2: NcoI linearized plasmid

Amplification of ura3 and actin fragments using genomic DNA of S. cerevisiae and S. boulardii. M: Size marker, 1: S. cerevisiae ura3 fragment (1.2 kb), 2: S. cerevisiae actin fragment (0.5 kb), 3: S. boulardii ura3 and 4: S. boulardii actin fragments A) Schematic representation of pGEM-ura3 construct. The position of designed primers and restriction sites is shown. B) Restriction analysis of pGEM-ura3 vector. Lane 1: Fragments generated by NcoI/SacI digestion of the construct (∼1 kb and ∼3.3 kb). Lane 2: NcoI linearized plasmid The potential ura3 mutants of S. boulardii (M1, M2 and M3) were transformed with pGEM-ura3 vector. As a positive control, the same mutants were transformed with an episomal vector, pYES2, containing URA3 as a selectable marker (Figure 5A). Both transformations were efficient and resulted in several hundred transformants from each single reaction (1 µg of each plasmid per reaction).
Figure 5

A) Schematic representation of pYES2 vector. pYES2 contains the auxotrophic marker URA3, 2 µ origin and the ampicilin resistance marker. B) Restriction analysis of pYES2. Lane 1: undigested plasmid. Lane2: EcoRI/ClaI digested vector showed two expected bands of ∼2.5 and ∼3.2 kb. Lane 3: ClaI linearized plasmid (5.9 kb)

A) Schematic representation of pYES2 vector. pYES2 contains the auxotrophic marker URA3, 2 µ origin and the ampicilin resistance marker. B) Restriction analysis of pYES2. Lane 1: undigested plasmid. Lane2: EcoRI/ClaI digested vector showed two expected bands of ∼2.5 and ∼3.2 kb. Lane 3: ClaI linearized plasmid (5.9 kb) To confirm that the pYES2 construct is present in these ura3+transformants, plasmid DNA was extracted from one of these transformants and subjected to restriction analysis using EcoRI and ClaI Enzymes. The results confirmed that the isolated plasmid is intact and identical to original plasmid, pYES2 (Figure 5B).

Acid and bile resistance in auxotroph mutants

The ability of auxotroph mutants to resist pH = 2.5 and 0.3% oxgall was assessed. Table 3 shows the growth phenotype of three different mutants compared to the wild types. All tested strains showed different resistance against acid and bile. Among the mutants, only S. boulardii M2 showed a resistance pattern similar to the S. boulardii wild type.
Table 3

Growth ability of wild type strains and ura3 mutants in the presence of acid and bile

Yeast strainGrowtha
pH = 2.5c 0.3% Oxgall
S. boulardii wild type +++
S. boulardii M1b ++
S. boulardii M2 +++
S. boulardii M3 +
S. cerevisiae Σ1278b +

−no growth; + growth delay>4 hr; ++no delay in growth.

M1, M2 and M3:the ura3 mutant of S. boulardii

Survival after 4-hr incubation at pH=2.5

Discussion

The design, creation and genetic manipulation of probiotic strains exclusively as vaccine and drug delivery vehicles are promising and rapidly growing area of research (1, 15). The yeast S. boulardii can be considered as a candidate probiotic for future engineering. To facilitate the genetic manipulation of this yeast, we used the classical UV mutagenesis to produce uacil auxotroph mutants of S. boulardii as a host for recombinant protein production. The UV dose-response curve demonstrated a 90% killing rate after 23 s of UV irradiation. This result is in agreement with the time range reported by Hashimoto et al (20-40S) (7). Ura3- mutants were selected on 5-FOA plates. 5-FOA is toxic to yeast cells that can synthesize the ura3 gene product, and therefor makes them unable to grow on 5-FOA-containing media (11). In addition to act as a positive selection marker, the URA3 gene can also be used for the negative selection (counter selection). In this regard, the presence of URA3 confers sensitivity to FOA, while ura3 -negative cells are FOA resistant. This concept has been used in designing the ura-blaster gene constructs as a tool in multiple gene disruption experiments in S. cerevisiae (16). Hence, the generation of uracil auxotrophs of S. boulardii provides an opportunity for gene deletion studies in this organism. To complement the ura3- phenotype, the URA3 gene was amplified from the S. boulardii genome and cloned into pGEM-Teasy vector. The restriction analysis of the URA3 fragment from S. boulardii showed a pattern identical to its homologue in S. cerevisiae. This pattern was expected as the analysis of sequence data from different strains of S. boulardii had confirmed a high similarity between S. boulardii and S. cerevisiae in DNA level (17). Bile and acid resistance are the most important prerequisites for probiotics to stay alive in the digestive tract of their hosts. Among the three isolated ura3- mutants, only one (S. boulardi M2) showed acceptable resistance to acid and bile. Similarly, Sharaf et al. have used EMS mutagenesis and interspecific protoplast fusion to isolate improved probiotic yeasts. They isolated an adenine auxotroph mutant of S. boulardii with high tolerance to bile salt (18). Abosereh et al have also isolated highly resistant S. boulardii strains through protoplast fusion (19). The acid and bile resitance capability of mutants provide these strains with an advantage in vivo. Further in vivo studies are underway to evaluate other probiotic features of the mutant.

Conclusion

A uracil auxotroph mutant of the probiotic yeast, S. boulardii, was generated in this study. The mutant was complemented by URA3 carrying constructs, confirming the inactivation of this gene in the mutant. Bile and acid resistance of the mutant was the same as wild type strain. This mutant can be used as a probiotic host for the in vivo production and delivery of various recombinant products to the GI tract.
  14 in total

Review 1.  Twenty-five years of research on Saccharomyces boulardii trophic effects: updates and perspectives.

Authors:  Jean-Paul Buts
Journal:  Dig Dis Sci       Date:  2008-06-05       Impact factor: 3.199

2.  An improved yeast transformation method for the generation of very large human antibody libraries.

Authors:  Lorenzo Benatuil; Jennifer M Perez; Jonathan Belk; Chung-Ming Hsieh
Journal:  Protein Eng Des Sel       Date:  2010-02-03       Impact factor: 1.650

3.  Purification and properties of orotidine-5'-phosphate pyrophosphorylase and orotidine-5'-phosphate decarboxylase from baker's yeast.

Authors:  K Umezu; T Amaya; A Yoshimoto; K Tomita
Journal:  J Biochem       Date:  1971-08       Impact factor: 3.387

4.  A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains.

Authors:  E Alani; L Cao; N Kleckner
Journal:  Genetics       Date:  1987-08       Impact factor: 4.562

5.  Efficacy and safety of Saccharomyces boulardii in acute childhood diarrhea: a double blind randomised controlled trial.

Authors:  Musheer Riaz; Seema Alam; Abida Malik; S Manazir Ali
Journal:  Indian J Pediatr       Date:  2011-10-14       Impact factor: 1.967

6.  Isolation of auxotrophic mutants of diploid industrial yeast strains after UV mutagenesis.

Authors:  Shinji Hashimoto; Mayumi Ogura; Kazuo Aritomi; Hisashi Hoshida; Yoshinori Nishizawa; Rinji Akada
Journal:  Appl Environ Microbiol       Date:  2005-01       Impact factor: 4.792

7.  Review article: yeast as probiotics -- Saccharomyces boulardii.

Authors:  D Czerucka; T Piche; P Rampal
Journal:  Aliment Pharmacol Ther       Date:  2007-09-15       Impact factor: 8.171

8.  Effect of Lactobacillus strains and Saccharomyces boulardii on persistent diarrhea in children.

Authors:  David Gaón; Hugo García; Luis Winter; Nora Rodríguez; Ricardo Quintás; Silvia N González; Guillermo Oliver
Journal:  Medicina (B Aires)       Date:  2003       Impact factor: 0.653

9.  The taxonomic position of Saccharomyces boulardii as evaluated by sequence analysis of the D1/D2 domain of 26S rDNA, the ITS1-5.8S rDNA-ITS2 region and the mitochondrial cytochrome-c oxidase II gene.

Authors:  Alis van der Aa Kühle; Lene Jespersen
Journal:  Syst Appl Microbiol       Date:  2003-11       Impact factor: 4.022

Review 10.  Gut changes attributed to ageing: effects on intestinal microflora.

Authors:  Xavier Hébuterne
Journal:  Curr Opin Clin Nutr Metab Care       Date:  2003-01       Impact factor: 4.294

View more
  8 in total

1.  Novel insights in genetic transformation of the probiotic yeast Saccharomyces boulardii.

Authors:  Bruno Douradinha; Viviane C B Reis; Matthew B Rogers; Fernando A G Torres; Jared D Evans; Ernesto T A Marques
Journal:  Bioengineered       Date:  2013-09-05       Impact factor: 3.269

2.  Transformation of Probiotic Yeast and Their Recovery from Gastrointestinal Immune Tissues Following Oral Gavage in Mice.

Authors:  Lauren E Hudson; Taryn P Stewart; Milo B Fasken; Anita H Corbett; Tracey J Lamb
Journal:  J Vis Exp       Date:  2016-02-08       Impact factor: 1.355

3.  Metabolic Engineering of Probiotic Saccharomyces boulardii.

Authors:  Jing-Jing Liu; In Iok Kong; Guo-Chang Zhang; Lahiru N Jayakody; Heejin Kim; Peng-Fei Xia; Suryang Kwak; Bong Hyun Sung; Jung-Hoon Sohn; Hanna E Walukiewicz; Christopher V Rao; Yong-Su Jin
Journal:  Appl Environ Microbiol       Date:  2016-04-04       Impact factor: 4.792

4.  A probiotic yeast-based immunotherapy against Clostridioides difficile infection.

Authors:  Kevin Chen; Yixuan Zhu; Yongrong Zhang; Therwa Hamza; Hua Yu; Ashley Saint Fleur; James Galen; Zhiyong Yang; Hanping Feng
Journal:  Sci Transl Med       Date:  2020-10-28       Impact factor: 17.956

5.  Functional heterologous protein expression by genetically engineered probiotic yeast Saccharomyces boulardii.

Authors:  Lauren E Hudson; Milo B Fasken; Courtney D McDermott; Shonna M McBride; Emily G Kuiper; David B Guiliano; Anita H Corbett; Tracey J Lamb
Journal:  PLoS One       Date:  2014-11-12       Impact factor: 3.240

6.  Oral Administration of Recombinant Saccharomyces boulardii Expressing Ovalbumin-CPE Fusion Protein Induces Antibody Response in Mice.

Authors:  Ghasem Bagherpour; Hosnie Ghasemi; Bahare Zand; Najmeh Zarei; Farzin Roohvand; Esmat M Ardakani; Mohammad Azizi; Vahid Khalaj
Journal:  Front Microbiol       Date:  2018-04-13       Impact factor: 5.640

7.  Characterization of the Probiotic Yeast Saccharomyces boulardii in the Healthy Mucosal Immune System.

Authors:  Lauren E Hudson; Courtney D McDermott; Taryn P Stewart; William H Hudson; Daniel Rios; Milo B Fasken; Anita H Corbett; Tracey J Lamb
Journal:  PLoS One       Date:  2016-04-11       Impact factor: 3.240

8.  Value-added probiotic development by high-solid fermentation of sweet potato with Saccharomyces boulardii.

Authors:  Carmen Campbell; Ananda K Nanjundaswamy; Victor Njiti; Qun Xia; Franklin Chukwuma
Journal:  Food Sci Nutr       Date:  2016-12-09       Impact factor: 2.863

  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.