Literature DB >> 23626734

The mitochondrial genome of Elodia flavipalpis Aldrich (Diptera: Tachinidae) and the evolutionary timescale of Tachinid flies.

Zhe Zhao1, Tian-Juan Su, Douglas Chesters, Shi-di Wang, Simon Y W Ho, Chao-Dong Zhu, Xiao-Lin Chen, Chun-Tian Zhang.   

Abstract

Tachinid flies are natural enemies of many lepidopteran and coleopteran pests of forests, crops, and fruit trees. In order to address the lack of genetic data in this economically important group, we sequenced the complete mitochondrial genome of the Palaearctic tachinid fly Elodia flavipalpis Aldrich, 1933. Usually found in Northern China and Japan, this species is one of the primary natural enemies of the leaf-roller moths (Tortricidae), which are major pests of various fruit trees. The 14,932-bp mitochondrial genome was typical of Diptera, with 13 protein-coding genes, 22 tRNA genes, and 2 rRNA genes. However, its control region is only 105 bp in length, which is the shortest found so far in flies. In order to estimate dipteran evolutionary relationships, we conducted a phylogenetic analysis of 58 mitochondrial genomes from 23 families. Maximum-likelihood and Bayesian methods supported the monophyly of both Tachinidae and superfamily Oestroidea. Within the subsection Calyptratae, Muscidae was inferred as the sister group to Oestroidea. Within Oestroidea, Calliphoridae and Sarcophagidae formed a sister clade to Oestridae and Tachinidae. Using a Bayesian relaxed clock calibrated with fossil data, we estimated that Tachinidae originated in the middle Eocene.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 23626734      PMCID: PMC3634017          DOI: 10.1371/journal.pone.0061814

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Since the first insect mitochondrial genome (mitogenome) sequence was reported by Clary and Wolstenholme in 1985 [1], Diptera has remained the primary model system for mitogenomic research. This has included such diverse topics as species identification [2], [3], molecular evolution and phylogenetic inference [4]–[7], population structure and phylogeography [8]–[12], and genome structure and rearrangement [13]–[19]. Because of its small size and relative ease of sequencing, the number of mitogenome sequences has grown rapidly. As of January 2013, there are 64 complete or near-complete dipteran mitogenome sequences in GenBank, accounting for about 17.5% of the 365 insect mitogenomes that have been sequenced. In addition to the model organism Drosophila, most studies of Diptera have focused on taxa of medical and economic importance, such as the anopheline mosquitoes (Culicidae), which are vectors of malaria [20], [21]; the fruit flies Ceratitis capitata and Bactrocera spp. (Tephritidae), which are serious agricultural pests [11], [22]; the blowflies (Calliphoridae) and oestrid flies (Oestridae), which can cause myiasis [23], [24]; and leaf-miners (Agromyzidae), which are vegetable and horticultural pests [16], [25]. Tachinid flies have a worldwide distribution and comprise nearly 10,000 described species [29]. Despite Tachinidae being the second-largest dipteran family, the mitogenomes of only two species have been sequenced completely: Exorista sorbillans (Exoristinae, Exoristini) and Rutilia goerlingiana (Dexiinae; Rutiliini) [26], [27], [28]. They are natural enemies of many lepidopteran and coleopteran pests of forests, agricultural crops, and fruit trees, and thus are of economic importance. The Palaearctic tachinid fly, Elodia flavipalpis Aldrich, 1933 (Exoristinae, Goniini), is usually found in Northern China and Japan and is in the same subfamily, Exoristinae, as Ex. sorbillans [30], [31]. It is one of the primary natural enemies of the leaf-roller moths (Tortricidae), which are major pests of various fruit trees [32], [33]. The monophyly of Tachinidae is broadly supported by phylogenetic studies, but questions remain about its place in the superfamily Oestroidea, particularly the relationship between Tachinidae and several large families of Oestroidea [27], [28], [34]–[36]. There have been various studies of the divergence times of different groups of flies [7], [11], [12], [37], with a recent study placing the rapid radiation of Schizophora 65 mya in the Paleocene [28]. However, owing to the uncertain taxonomic position of Tachinidae in Oestroidea, the evolutionary timescale of tachinid flies has not been well studied. Here we describe the complete mitochondrial genome of El. flavipalpis. The mitogenome contributes to discussion on the evolutionary relationships and taxonomic positions of the Tachinidae, puts forward a bold hypothesis regarding the timescale in which the family originated, and will aid further molecular research of related taxa through the findings on primer selection for atypical regions and the optimization of PCR experiments.

Materials and Methods

Specimen Collection, DNA Extraction, and DNA Amplification

Adult individuals of Elodia flavipalpis Aldrich, 1933 were collected directly from the pupae of their host species, the leaf-roller moth Spilonota lechriaspis Meyrick (Tortricidae). Moth pupae were collected at an organic apple orchard in Beijing, China, and hatched in the laboratory. The specimens were preserved in 99.5% ethanol and stored at −20°C for preservation of nucleic acids. DNA extraction from a single specimen was performed using the DNeasy Tissue kit (QIAGEN) following the manufacturer’s instructions. The fragments were first amplified with the universal PCR primers from Simon et al. [38] and some dipteran-specific primers from Han [39] and Weigl et al. [24] (Table 1). Primer pairs for amplification of the mitochondrial control region were modified according to Lessinger et al. [40] and Oliveira et al. [41]. Species-specific primers were designed using Primer Premier 6.0 software [42], based on the initial fragments aligned with sequences from three closely related species, Ex. sorbillans, Calliphoridae spp., and Oestridae spp. (Table 2). PCR products covering the remaining regions of the mitogenome were amplified using universal and species-specific primers (Table 1). The entire genome of El. flavipalpis was amplified in 21 fragments. All of the primers were synthesized by Shanghai Sangon Bio-technology Co., Ltd (Beijing, China).
Table 1

Details of mitogenome sequencing protocols used in this study.

RegionPrimer pairs (F/R)Sequence (forward and reverse) 5′→3′ Size (bp) PCR conditions (annealing/extension)
ND2 TM-J-206a/N2-N-732a GCTAA-ATAAAGCTAACAGGTTCAT/GAAGTTTGGTTTAAACCTCC∼50049°C, 45 s/72°C, 1 min
ND2-CO1 N2-J-283d/C1-N-1740d CATGACTAGGAACTTGAATAGG/AGAACTAAAGCAGGAGGTAA∼150047°C, 45 s/68°C, 4 min
CO1 TY-J-1460a/C1-N-2191a TACAATTTATCGCCTAAA-CTTCAGCC/CCCGGTAAAATTAAAATATAAACTTC∼70049°C, 45 s/72°C, 1 min
CO1 C1-J-1751a/TL2-N-3014a GGATCACCTGATATAGCATTCCC/TCCAATGCACTAATCTGCCATATTA∼120052°C, 30 s/72°C, 1 min
CO1-CO3 Cl-J-2183a/C3-N-5460a CAACATTTATTTTGATTTTTTGG/TCAACAAAGTGTCAGTATCA∼320044.5°C, 45 s/68°C, 5 min
ATP8 C2-J-3530d/A6-N-4493d AAGTTGATGGAACTCCTGGA/GTAAGTCGAACTGCTAATGT∼95049°C, 45 s/72°C, 1 min, 50 s
CO3-ND3 C3-J-5005d/E-revb CTCCATCAGTTGAATTAGGTGCTA/AGTGATAAGCCTCTTTTTGGCTTC∼105049°C, 45 s/72°C, 1 min, 50 s
ND5 F-fwb/N5-N-7707d CATTTGATTTGCATTCAAAAAGTATTG/AGGATGAGATGGATTAGGAT∼180045°C, 45 s/68°C, 3 min
ND5-ND4 H-fwb/N4-N-8718a GAAACAGGAGTAGGAGCTGCTATAGC/GCTTATTCATCGGTTGCTCA∼120053°C, 45 s/72°C, 1 min, 50 s
ND4 I-fwb/N4-N-8924a CAATTCTATTAATTAAAGAAATTTCTCC/AAAGCTCATGTTGAAGCTCC∼55048°C, 45 s/72°C, 1 min, 50 s
ND4 N4-J-8614d/N4-N-9061d TGAGCAACAGAAGAATAAGC/ATCAACCAGAACGATTACAAG∼40047°C, 45 s/72°C, 1 min, 50 s
ND4-ND6 N4-J-8944a/I-revb GGAGCTTCAACATGAGCTTT/CTTATTTTTGATTTACAAGACCAATG∼85049°C, 45 s/72°C, 1 min, 20 s
ND4- CYTB N4-J-9511d/CB-N-11218d CTAAAATTGATAACCCTAAAGC/TCAGGTTGAATGTGAATTGG∼170045°C, 45 s/68°C, 3 min
CYTB-ND1 CB-J-10933a/N1-N-12051a TATGTACTACCATGAGGACAAATATC/GATTTTGCTGAAGGTGAATCAGA∼110050.5°C, 45 s/72°C, 1 min, 50 s
ND1- lrRNAN1-J-11891d/16S-N-12855d ATCCTCCTCTTCTATATTCAAT/GATTGCGACCTCGATGTT∼95048°C, 45 s/72°C, 1 min, 30 s
lrRNALR-J-12883c/LR-N-13398a CTCCGGTTTGAACTCAGATC/CGCCTGTTTATCAAAAACAT∼55047°C, 45 s/72°C, 2 min
lrRNA - srRNALR-J-12888d/SR -N-14373d ACGCTGTTATCCCTAAAGTA/AATCCACGATGAACCTTACT∼150045°C, 45 s/68°C, 3 min
srRNASR-J-14233a/SR-N-14756a AAGAGCGACGGGCGATGTGT/GACAAA-ATTCGT-GCCAGCAGT∼50050°C, 45 s/72°C, 1 min, 30 s
srRNASR-J-14612a/SR-N-14922a AGGGTATCTAATCCTAGTTT/AAGTTTTATT-TTGGCTTA∼30043°C, 45 s/72°C, 1 min
srRNA-ND2 SR-J-14646e/N2-N-757d GCTGGCACAAATTAAATC/GCTGCAAGTATTCAACTTAAATG∼115043°C, 1 min/68°C, 6 min
Control regionSR-J-14646e/N2-N-309f GCTGGCACAAATTAAATC/CTAAACCTATTCAAGTTCC∼65042°C, 1 min/68°C, 6 min

Note: CO1, CO2, CO3: cytochrome c oxidase subunit 1, 2, and 3 genes; CYTB: cytochrome b gene; ATP6, ATP8: ATP synthase subunit 6 and 8 genes; ND1, ND2, ND3, ND4, ND4L, ND5, ND6: NADH dehydrogenase subunit 1–6 and 4L genes. lrRNA, srRNA: large and small ribosomal RNA.

Primers from Simon et al. [27].

Primers from Weigl et al. [21].

Primers from Han [28].

Primers designed specially for this genome, using the nomenclature of Simon et al. [27].

Primers modified from Lessinger et al. [29]. f Primers modified from Oliveira et al. [30].

Table 2

Summary of mitogenome sequences from Diptera and an outgroup species from Lepidoptera.

SpeciesFamilyLength (bp)Accession NumberReference
Elodia flavipalpis Tachinidae14932NC_018118Present study
Exorista sorbillans Tachinidae14960NC_014704Shao et al., 2012
Dermatobia hominis Oestridae16360NC_006378Azeredo-Espin et al.,2004
Hypoderma lineatum Oestridae16354NC_013932Weigl et al., 2010
Chrysomya putoria Calliphoridae15837NC_002697Junqueira et al., 2004
Cochliomyia hominivorax Calliphoridae16022NC_002660Lessinger et al., 2000
Lucilia sericata Calliphoridae15939NC_009733Stevens et al., 2008
Sarcophaga impatiens Sarcophagidae15169NC_017605Nelson et al., 2012
Haematobia irritans Muscidae16078NC_007102Oliveira et al., 2008
Drosophila littoralis Drosophilidae16017NC_011596Sorokina et al., 2010
Drosophila sechellia Drosophilidae14950NC_005780Ballard, 2000 a
Drosophila simulans Drosophilidae14927NC_005781Ballard, 2000 a
Drosophila mauritiana Drosophilidae14964NC_005779Ballard, 2000 b
Drosophila melanogaster Drosophilidae19517NC_001709Lewis et al., 1995
Drosophila yakuba Drosophilidae16019NC_001322Clary & Woolstenholme, 1985
Drosophila pseudoobscura Drosophilidae14914NC_018348Torres et al., 2009
Liriomyza sativae Agromyzidae15551NC_015926Yang et al., 2011
Liriomyza trifolii Agromyzidae16141NC_014283Wang, 2010
Liriomyza bryoniae Agromyzidae16183NC_016713Yang et al. unpublished
Liriomyza huidobrensis Agromyzidae16236NC_016716Yang et al. unpublished
Fergusonina taylori Fergusoninidae16000NC_016865Nelson et al., 2011
Ceratitis capitata Tephritidae15980NC_000857Spanos et al. 2000
Bactrocera carambolae Tephritidae15915NC_009772Ye et al., 2010
Bactrocera dorsalis Tephritidae15915NC_008748Yu et al., 2007
Bactrocera minax Tephritidae16043NC_014402Zhang et al.,2010
Bactrocera oleae Tephritidae15815NC_005333Nardi et al.,2003
Bactrocera papayae Tephritidae15915NC_009770Ye et al., 2010
Bactrocera philippinensis Tephritidae15915NC_009771Ye et al.,2010
Bactrocera tryoni Tephritidae15925NC_014611Nardi et al.,2010
Bactrocera cucurbitae Tephritidae15825NC_016056Wu,P.-F. unpublished
Simosyrphus grandicornis Syrphidae16141NC_008754Cameron et al., 2007
Trichophthalma punctata Nemestrinidae16396NC_008755Cameron et al., 2007
Cydistomyia duplonotata Tabanidae16247NC_008756Cameron et al., 2007
Rhopalomyia pomum Cecidomyiidae14503NC_013063Beckenbach and Joy, 2009
Mayetiola destructor Cecidomyiidae14759NC_013066Beckenbach and Joy, 2009
Culicoides arakawae Ceratopogonidae18132NC_009809Matsumoto et al.,2009
Aedes aegypti Culicidae16655NC_010241Behura et al., 2011
Aedes albopictus a Culicidae16665NC_006817Ho, C.-M. et al. unpublished
Anopheles darlingi Culicidae15386NC_014275Moreno et al., 2010
Anopheles funestusb CulicidaeNC_008070Krzywinski et al., 2006
Anopheles gambiae Culicidae15363NC_002084Beard et al., 1993
Anopheles quadrimaculatus Culicidae15455NC_000875Mitchell et al., 1993
Anopheles albitarsis Culicidae15413HQ_335344Krzywinski et al., 2011
Anopheles deaneorum Culicidae15424HQ_335347Krzywinski et al., 2011
Anopheles janconnae Culicidae15425HQ_335348Krzywinski et al., 2011
Anopheles oryzalimnetes Culicidae15422HQ_335345Krzywinski et al., 2011
Culex pipiens Culicidae14856NC_015079Atyame et al., 2011
Culex quinquefasciatus Culicidae15587NC_014574Behura et al., 2011
Chironomus tepperi Chironomidae15652NC_016167Beckenbach, 2012
Trichocera bimacula Trichoceridae16140NC_016169Beckenbach, 2012
Paracladura trichoptera Trichoceridae16143NC_016173Beckenbach, 2012
Sylvicola fenestralis Anisopodidae16234NC_016176Beckenbach, 2012
Bittacomorphella fenderiana Ptychopteridae15609JN_861745Beckenbach, 2012
Ptychoptera sp. Ptychopteridae15214NC_016201Beckenbach, 2012
Protoplasa fitchii Tanyderidae16154NC_016202Beckenbach, 2012
Cramptonomyia spenceri Pachyneuridae16274NC_016203Beckenbach, 2012
Arachnocampa flava Keroplatidae16923NC_016204Beckenbach, 2012
Tipula abdominalis Tipulidae14566JN_861743Beckenbach, 2012
Spilonota lechriaspis Tortricidae (Lepidoptera)15368NC_014294Zhao et al., 2010

Note ‘−’ not available (unknown or incomplete data).

Note: CO1, CO2, CO3: cytochrome c oxidase subunit 1, 2, and 3 genes; CYTB: cytochrome b gene; ATP6, ATP8: ATP synthase subunit 6 and 8 genes; ND1, ND2, ND3, ND4, ND4L, ND5, ND6: NADH dehydrogenase subunit 1–6 and 4L genes. lrRNA, srRNA: large and small ribosomal RNA. Primers from Simon et al. [27]. Primers from Weigl et al. [21]. Primers from Han [28]. Primers designed specially for this genome, using the nomenclature of Simon et al. [27]. Primers modified from Lessinger et al. [29]. f Primers modified from Oliveira et al. [30]. Note ‘−’ not available (unknown or incomplete data). In order to reduce time required for sequencing and walking, we used both standard and nested PCR techniques. The PCR conditions for all of the fragments are shown in Table 1. The control region was amplified using a nested PCR approach. The “external” primers SR-J-14646 and N2-N-757 were used for the first step of the PCR (long target), followed by nested amplification (specific target) with the “internal” primers SR-J-14646 and N2-N-309. All of the fragments were amplified using TaKaRa LA Taq (Takara Co., Dalian, China), and performed on an Eppendorf Mastercycler gradient in 50 µl reaction volumes. The reaction volume consisted of 25.5 µl of sterilized distilled water, 5 µl of 10× LA PCR Buffer II (Takara), 5 µl of 25 mM MgCl2, 8 µl of dNTPs Mixture, 1.5 µl of each primer (10 µM), 3 µl of DNA template, and 0.5 µl (1.25 U) of TaKaRa LA Taq polymerase (Takara).

Sequence Assembly and Annotation

The PCR products were detected via electrophoresis in 1% agarose gel, purified using the 3S Spin PCR Product Purification Kit, and sequenced directly with the ABI-377 automatic DNA sequencer. All amplified products were sequenced directly using upstream and downstream primers from both directions. Sequencing was performed using ABI BigDye ver 3.1 dye-terminator sequencing technology and run on ABI PRISM 3730 × 1 capillary sequencers. Raw sequences were manually checked and assembled using the software BioEdit version 7.0.9.0 [43] and SeqMan (DNAStar, Steve ShearDown, 1998–2001 version reserved by DNASTAR Inc., Madison, Wisconsin, USA). Protein-coding and ribosomal RNA genes and gene boundaries were identified by BLAST search (http://www.ncbi.nlm.nih.gov/BLAST) and by comparison with sequences from other brachyceran species. The genomic positions and secondary structures of 20 of the 22 transfer RNAs (tRNAs) were identified by tRNAscan-SE software v.1.21 [44], with the remaining two (tRNAArg and tRNASer(AGN)) identified by visual inspection of genome sequence followed by inference using RNAstructure Ver.5.3 [45] (Table 3). Nucleotide composition was calculated using MEGA 4.1 [46]. Sequence data have been deposited in the NCBI database [GenBank: NC_018118].
Table 3

Organization of the mitogenome of Elodia flavipalpis Aldrich.

GeneStrandLocationa Length(bp)IGNb CodonStart/Anti StopAT%
tRNAIle +1–6565−3GAT77.0
tRNAGln 63–131696TTG86.2
tRNAMet +138–206690CAT71.0
ND2 +207–12171011−2ATTTAA83.4
tRNATrp +1216–128368−8TCA80.9
tRNACys 1276–1342672GCA74.6
tRNATyr 1344–1408656GTA80.0
CO1 +1415–29531539−5TCGTAA72.9
tRNALeu(UUR) +2949–3014664TAA77.3
CO2 +3019–37066880ATGT77.0
tRNALys +3707–377771−1CTT69.0
tRNAAsp +3777–3847710GTC87.4
ATP8 +3848–4012165−7ATTTAA86.8
ATP6 +4006–4683678−1ATGTAA78.4
CO3 +4683–54717896ATGTAA73.0
tRNAGly +5478–5542650TCC83.1
ND3 +5543–58963540ATTTAA82.2
tRNAAla +5897–5963670TGC79.1
tRNAArg +5966–60276211TCG72.6
tRNAAsn +6039–6103650GTT78.5
tRNASer(AGN) +6104–6171680GCT75.0
tRNAGlu +6172–62336218TTC92.0
tRNAPhe 6252–6316650GAA80.0
ND5 6317–8036172015ATTT80.9
tRNAHis 8052–8115641GTG84.4
ND4 8117–94551339−7ATGT81.4
ND4L 9449–97452972ATGTAA84.5
tRNAThr +9748–9812650TGT86.1
tRNAPro 9813–9877652TGG81.5
ND6 +9880–10404525−1ATTTAA86.7
CYTB +10404–115401137−2ATGTAG75.9
tRNASer(UCN) +11539–116056716TGA82.1
ND1 11622–125699481TTGTAA81.1
tRNALeu(CUN) 12571–12635650TAG81.6
lrRNA12636–139721337084.6
tRNAVal 13973–14044720TAC80.6
srRNA14045–14827783081.7
Control region14828–14932105092.4

Note:

Gene positions with parentheses indicate the genes encoded by major strand; plus (+) and minus (−) symbols represent major and minor strands, respectively.

IGN: Intergenic nucleotide, minus indicates overlapping between genes. tRNA: where X is the abbreviation of the corresponding amino acid.

Note: Gene positions with parentheses indicate the genes encoded by major strand; plus (+) and minus (−) symbols represent major and minor strands, respectively. IGN: Intergenic nucleotide, minus indicates overlapping between genes. tRNA: where X is the abbreviation of the corresponding amino acid.

Phylogenetic Analysis

We conducted a phylogenetic analysis using all of the mitogenomes of Diptera that were available as of August 2012 (58 species from 33 genera and 23 families), along with a lepidopteran outgroup species (Spilonota lechriaspis) (Table 2). To assess the impact of saturation at third codon positions, we constructed two mitochondrial sequence alignments. The first dataset consisted of all 13 protein-coding genes and the 2 ribosomal RNA genes. The second dataset was the same, except for the exclusion of the third codon sites from the protein-coding genes. Sequences of protein-coding genes were translated into amino acid sequences, aligned using ClustalX v2.0.9 [47], then back-translated. Ribosomal RNA genes were also aligned using ClustalX, and refined by eye to account for their secondary structures. The GTR+I+G model was selected by the Akaike information criterion for both datasets in MODELTEST v.3.7 [48]. Maximum likelihood (ML) and Bayesian methods were used for phylogenetic analysis. For the ML analyses, we used RAxML v7.0.4 [49] with 1000 bootstrap replicates. The Bayesian phylogenetic analysis was performed using MrBayes v3.1.2. [50], with posterior distributions estimated using Markov chain Monte Carlo (MCMC) sampling. We conducted two independent runs, each with one cold and three heated chains. Samples were drawn every 100 MCMC steps over a total of 2 million steps. The first 25% of steps were discarded as burn-in. Divergence times were estimated using the Bayesian phylogenetic method implemented in BEAST v.1.6.2 [51]. Rate variation among lineages was modelled using an uncorrelated lognormal relaxed clock [52], with the tree prior generated using a Yule speciation model. Based on previous research on divergence times in Diptera [7], [11], [12], [28], [37], we implemented fossil-based minimum ages for three clades and added one maximum age constraint. The origin of Diptera was assumed to be between 270 and 230 million years ago (mya) [28], [53]. We also specified minimum age constraints of 195 mya for Brachycera and 64 mya for Schizophora [53]–[55]. Posterior estimates of parameters were obtained by MCMC sampling. Samples were drawn every 1000 steps over a total of 10 million steps. Tracer v1.5 [56] was used to confirm that the effective sample size of each parameter exceeded 100. The maximum-clade-credibility tree was calculated using TreeAnnotator v1.6.2, with the node times scaled to match mean posterior estimates.

Results and Discussion

Genome Organization

The 14932 bp mitogenome of El. flavipalpis contained all 37 genes usually present in bilaterians: 13 protein-coding genes, 22 tRNA genes, and 2 rRNA genes (Figure 1, Table 3). The gene order corresponds to the typical pattern of brachyceran flies, such as Drosophila spp. [1], [22], [57]. Gene order is typically conserved in brachyceran flies, except for a few species in which additional tRNAs have been detected in the control region (Liriomyza trifolii, Chrysomya spp., and Cydistomyia duplonotata), and Dermatobia hominis, in which an additional tRNAVal is found on the minor strand. In contrast, there is an elevated number of tRNA rearrangements in nematoceran flies [13], [14], [20], [21].
Figure 1

Mitochondrial genome map of Elodia flavipalpis.

Numbers indicate non-coding nucleotides between genes (positive values) or gene overlap (negative values). Arrows indicate orientation on (+) strand (clockwise) or (−) strand (counterclockwise).

Mitochondrial genome map of Elodia flavipalpis.

Numbers indicate non-coding nucleotides between genes (positive values) or gene overlap (negative values). Arrows indicate orientation on (+) strand (clockwise) or (−) strand (counterclockwise). In total, there were 37 overlapping nucleotides between neighboring genes at 10 locations, with the length of overlapping sequence ranging from 1 to 7 bp. Excluding the control region, there were 90 intergenic nucleotides at 12 locations, in stretches ranging from 1 to 18 bp (Table 3). As with other insects, the nucleotide composition of the El. flavipalpis mitogenome was biased towards A and T. The overall A+T content was 79.97%, slightly higher than that of Ex. sorbillans (78.4%) and R. goerlingiana (77.7%), and is among the highest of the sequenced dipteran species (67.2%–85.2%; Table S1). A detailed comparison of nucleotide composition, AT-skew, and GC-skew between the two closely related species, El. flavipalpis, Ex. sorbillans and R. goerlingiana, is given in Table 4.
Table 4

Comparison of mitochondrial nucleotide composition in three tachinid flies.

RegionA+T %G+C %AT-skewGC-skew
El. fla Ex. sor R. goe El. fla Ex. sor R. goe El. fla Ex. sor R. goe El. fla Ex. sor R. goe
Whole mitogenome79.978.477.720.121.522.30.000.020.04−0.15−0.17−0.23
Protein-coding genes79.177.776.220.922.323.8−0.14−0.15−0.150.040.000.00
1st codon position71.270.470.128.829.629.9−0.19−0.18−0.070.120.090.22
2nd codon position79.178.067.020.922.033.0−0.19−0.20−0.08−0.17−0.16−0.16
3rd codon position87.184.791.212.915.38.8−0.07−0.07−0.040.190.07−0.16
tRNA genes79.876.877.220.223.222.80.030.020.02−0.11−0.11−0.12
lrRNA84.683.282.615.516.817.40.000.050.05−0.30−0.30−0.34
srRNA81.779.480.518.320.519.5−0.040.010.00−0.30−0.30−0.28
Control region92.498.192.67.71.97.40.11−0.050.110.741.00−0.71

Note: El. fla indicates Elodia flavipalpis, Ex. sor indicates Exorista sorbillans and R. goe indicates Rutilia goerlingiana. The A+T and G+C biases of protein-coding genes were calculated by AT-skew = [A−T]/[A+T] and GC-skew = [G−C]/[G+C], respectively.

Note: El. fla indicates Elodia flavipalpis, Ex. sor indicates Exorista sorbillans and R. goe indicates Rutilia goerlingiana. The A+T and G+C biases of protein-coding genes were calculated by AT-skew = [A−T]/[A+T] and GC-skew = [G−C]/[G+C], respectively.

Protein-coding Genes and Nucleotide Composition

Thirteen protein-coding genes were identified in the mitogenome of El. flavipalpis, with characteristics similar to those of other dipteran species (Table S1). The average A+T content across all protein-coding genes was 79.1%, similar to that of Ex. sorbillans (77.7%) and R. goerlingiana (76.2%). Table 4 shows the AT-skews and CG-skews of the three codon positions for El. flavipalpis, Ex. sorbillans and R. goerlingiana. In all three of these species, the A+T content of the third codon positions (87.1%, 84.7%, and 91.2%, for El. flavipalpis, Ex. sorbillans, and R. goerlingiana, respectively) was higher than those of the first (71.2%, 70.4%, and 70.1) and second codon positions (79.1%, 78.0%, and 67%). This result is in agreement with studies of other dipteran taxa (Table S1). AT-skew and GC-skew were used to analyse the biases in nucleotide composition. The A content was slightly lower than the T content at all three codon positions, but almost equal over the whole genome. Except for CO1 and ND1, all of the protein-coding genes have one of the common start codons for mitochondrial DNA, ATG, ATA, or ATT (Table 3). The start codon TCG (Serine) in CO1 is also found in Ex. sorbillans, R. goerlingiana, and other Oestroidea species (Table 2). CO1 commonly uses nonstandard start codons in many other flies [5], [16], [20], [58], [59]. Within Diptera, the start codon TTG (Leucine) in ND1 of El. flavipalpis is same as that in Dermatobia hominis (Oestroidea). Of the 13 protein-coding genes, CO2, ND4, and ND5 have incomplete stop codons and terminate with only a single thymine. Similar structural features have also been described for the mitogenomes of other dipteran taxa [4], [5]. In addition, CYTB terminates with a complete stop codon TAG, whereas TAA or only a single thymine is utilized in some other fly species.

Other Regions of the Mitogenome

The mitogenome of El. flavipalpis bears all of the 22 standard tRNAs found in metazoan mitogenomes (Figure 1, Table 3). The total length of the tRNA genes is 1463 bp, with individual genes ranging from 62 to 71 bp and with A+T contents from 71% (tRNAMet) to 92% (tRNAGlu). With the exception of tRNASer (AGN), all tRNAs possess the typical clover-leaf secondary structure (Figure 2). The DHU-arm of tRNASer (AGN) is entirely absent, as observed in other insects [20], [24], [33], [60]. In the secondary structures, the lengths of the amino acid acceptor arms (7 bp), anticodon arms (5 bp), and loops (7 bp) are relatively conserved, while the TψC loop (3–10 bp) is more variable. There are 21 mismatched base pairs in the tRNA genes, 14 of which are weak G–U matches (nine sites in DHU arms, three sites in amino acid acceptor arms, and two sites in anticodon arms). The other seven include U–U (5 bp), C–U (1 bp), and A–A (1 bp).
Figure 2

Putative secondary structures of tRNAs found in the mitochondrial genome of Elodia flavipalpis.

All tRNAs can be folded into the usual clover-leaf secondary structure.

Putative secondary structures of tRNAs found in the mitochondrial genome of Elodia flavipalpis.

All tRNAs can be folded into the usual clover-leaf secondary structure. The lengths of the lrRNA and srRNA genes are 1337 bp and 783 bp, respectively. Both are encoded on the minor strand and the ends of those genes were assumed to be at the boundaries of the flanking genes [61]. As in other dipteran species, the lrRNA gene is flanked by tRNALeu (CUN) and tRNAVal, while the srRNA gene is between tRNAVal and the control region. Their A+T contents were 84.6% for lrRNA and 81.7% for srRNA, which are within the range of other dipteran species (Table S1). The length of the control region of El. flavipalpis is identical to that of Ex. sorbillans (105 bp), the shortest among the sequenced dipteran mitogenomes. It has an A+T content of 92.38%, which is lower than that of Ex. sorbillans (98.1%) and R. goerlingiana (92.6%) but higher than those of most other dipteran species. Owing to its short length, there is no distinct duplicate fragment found in this region. It should be noted that all three of the sequenced tachinid mitogenomes bear a control region that is shorter than those of most known in flies [62], [63]. The phylogenies estimated using likelihood and Bayesian approaches were similar for both of the datasets that were analysed (Figures 3, 4, 5 and 6). Various higher-level relationships were consistent across the analyses. The monophyly of Brachycera, Cyclorrhapha, and Calyptratae were consistently supported (posterior probability = 1.00, ML bootstrap = 100), as was the monophyly of Schizophora (posterior probability = 1.00, ML bootstrap = 55, 66). The monophyly of superfamily Oestroidea has been widely accepted and has traditionally received good support from morphological characters [64]–[67]. Here we add support from the Bayesian analysis of mitochondrial DNA sequences that Oestroidea is a sister group of Muscidae (posterior probability = 1.00). However, our ML analyses of both datasets placed the family Muscidae within Oestroidea, although support was not high (bootstrap = 70, 60).
Figure 3

Bayesian tree of Diptera, inferred from a mitochondrial data set comprising 13 protein-coding genes and 2 ribosomal RNA genes.

The tree was rooted using the outgroup taxon Spilonota lechriaspis (Lepidoptera). Numbers denote posterior probabilities of nodes. The lengths of very long branches have been reduced to aid viewing. The symbol ‘//’ indicates a contracted branch, with the value above giving the length of contraction. Red lines indicate the differences among the four phylogenetic trees.

Figure 4

Maximum-likelihood tree of Diptera, inferred from a mitochondrial data set comprising 13 protein-coding genes and 2 ribosomal RNA genes.

The tree was rooted using the outgroup taxon Spilonota lechriaspis (Lepidoptera). Numbers denote bootstrap values in percentages. Red lines indicate the differences among the four phylogenetic trees.

Figure 5

Bayesian tree of Diptera, inferred from a mitochondrial data set comprising 13 protein-coding genes (without third codon sites) and 2 ribosomal RNA genes.

The tree was rooted using the outgroup taxon Spilonota lechriaspis (Lepidoptera). Numbers denote posterior probabilities of nodes. The lengths of very long branches have been reduced to aid viewing. The symbol ‘//’ indicates a contracted branch, with the value above giving the length of contraction. Red lines indicate the differences among the four phylogenetic trees.

Figure 6

Maximum-likelihood tree of Diptera, inferred from a mitochondrial data set comprising 13 protein-coding genes (without third codon sites) and 2 ribosomal RNA genes.

The tree was rooted using the outgroup taxon Spilonota lechriaspis (Lepidoptera). Numbers denote bootstrap values in percentages. Red lines indicate the differences among the four phylogenetic trees.

Bayesian tree of Diptera, inferred from a mitochondrial data set comprising 13 protein-coding genes and 2 ribosomal RNA genes.

The tree was rooted using the outgroup taxon Spilonota lechriaspis (Lepidoptera). Numbers denote posterior probabilities of nodes. The lengths of very long branches have been reduced to aid viewing. The symbol ‘//’ indicates a contracted branch, with the value above giving the length of contraction. Red lines indicate the differences among the four phylogenetic trees.

Maximum-likelihood tree of Diptera, inferred from a mitochondrial data set comprising 13 protein-coding genes and 2 ribosomal RNA genes.

The tree was rooted using the outgroup taxon Spilonota lechriaspis (Lepidoptera). Numbers denote bootstrap values in percentages. Red lines indicate the differences among the four phylogenetic trees.

Bayesian tree of Diptera, inferred from a mitochondrial data set comprising 13 protein-coding genes (without third codon sites) and 2 ribosomal RNA genes.

The tree was rooted using the outgroup taxon Spilonota lechriaspis (Lepidoptera). Numbers denote posterior probabilities of nodes. The lengths of very long branches have been reduced to aid viewing. The symbol ‘//’ indicates a contracted branch, with the value above giving the length of contraction. Red lines indicate the differences among the four phylogenetic trees.

Maximum-likelihood tree of Diptera, inferred from a mitochondrial data set comprising 13 protein-coding genes (without third codon sites) and 2 ribosomal RNA genes.

The tree was rooted using the outgroup taxon Spilonota lechriaspis (Lepidoptera). Numbers denote bootstrap values in percentages. Red lines indicate the differences among the four phylogenetic trees. In Oestroidea, all four families are monophyletic, and Calliphoridae+Sarcophagidae was inferred as a sister group to Oestridae+Tachinidae. This result is similar to that obtained in analyses of morphology [34] and of 18S and 16S ribosomal DNAs [35]. The tree topology is broadly similar to that inferred from whole mitogenomes by Nelson et al. [27], except that Oestridae and a subfamily of Calliphoridae (Polleninae) are nested within Tachinidae. However, Nelson et al. [27] focused on the relationships within Calliphoridae, while species from other families of Oestroidea were only used as an outgroup in the analysis. Our phylogenetic estimate differs from that obtained by Kutty et al. [36] in their analysis of four nuclear and four mitochondrial genes. They inferred the relationships (((Tachinidae, Oestridae), Calliphoridae), Sarcophagidae), with both Calliphoridae and Tachinidae paraphyletic (Oestridae is nested within Tachinidae, as are some calliphorid subfamilies). In contrast, Wiegmann et al. [28], considered Tachinidae to be more closely related to Calliphoridae, and as a sister taxon to Oestridae and Sarcophagidae. Owing to the morphological similarities shared by these four families, it is difficult to distinguish among these phylogenetic hypotheses using morphological data. The disparities among the molecular estimates are probably due to differences in the taxa sampled and the data being analysed. Kutty et al. [36] and Wiegmann et al. [28] used both nuclear and mitochondrial DNA sequences, but most were only partial sequences. Moreover, most of the Oestroidea species analysed by Wiegmann et al. [28] were represented by only two or three genes. Given that our analysis involved a larger and more complete data set, we believe that our results are more strongly supported. The primary difference among the four phylogenetic trees here is in the placement of the superfamily Opomyzoidae, which consists of the families Furgusoninidae and Agromyzidae. It is closer to Drosophoridae in the Bayesian analysis (posterior probability = 1.00), but its position is unstable in the ML analysis (bootstrap = 55, 27). A similar result was obtained by Wiegmann et al. [28]. Another difference is seen in the placement of Bibionomorpha (Nematocera), which is the closest group to Brachycera in both of the trees inferred without third codon positions, but is unstable in the tree inferred from all three gene positions. It is even non-monophyletic in the Bayesian analysis, hinting at the possible negative phylogenetic effects of including third codon sites. The placement of Cecidomyiidae is problematic, which is also indicated by the long branch leading to this group. The two Cecidomyiidae species have undergone substantial reduction in mitogenome size, which results in their apparent distinctiveness and causes problems for sequence alignment. With additional sampling in Cecidomyiidae, future studies will be better equipped to reconstruct the molecular evolution of these mitochondrial genomes.

Estimates of Divergence Times

We used a Bayesian relaxed clock to estimate the evolutionary timescale of Brachycera (Figure 7). Our analysis suggests that the last common ancestor of extant Brachycera existed in the early Jurassic (∼199 mya) (95% credibility interval: 195.9–206.7 mya). The schizophoran radiation took place during the late Cretaceous (∼84 mya), and the clade Calyptratae containing Oestroidea and Muscidae (nested in Acalyptrata) split in the early Eocene (∼60 mya) (95% credibility interval: 45.6–91.1 mya). These results are consistent with evidence from a number of amber specimens from Acalyptrata and Calyptratae [68]. Subsequently, Oestroidea divided into two groups in the middle Palaeocene (∼56 mya) (95% credibility interval (CI): 42.7–85.0 mya). The split of Tachinidae with Oestridae is estimated to have occurred in the early Eocene (∼48 mya) (95% CI: 37.8–77.9 mya), with this clade becoming the most speciose in Brachycera. Finally, the two tachinid flies El. flavipalpis and Ex. sorbillans are estimated to have separated in the early Oligocene (∼33 mya) (95% CI: 15.5–60.1 mya).
Figure 7

Evolutionary timescale for Diptera inferred from a mitochondrial data set comprising 13 protein-coding genes and 2 ribosomal RNA genes.

Numbers at nodes indicate mean estimated divergence times (in mya) and node bars indicate 95% credibility intervals. Red circles indicate the three nodes used for calibration. The yellow circle indicates the hypothesised origin of tachinid flies. In the geological time scale: Pala indicates Palaeocene; Eoce indicates Eocene; Oligo indicates Oligocene; Mioc indicates Miocene; P indicates Pliocene; Q indicates Quaternary.

Evolutionary timescale for Diptera inferred from a mitochondrial data set comprising 13 protein-coding genes and 2 ribosomal RNA genes.

Numbers at nodes indicate mean estimated divergence times (in mya) and node bars indicate 95% credibility intervals. Red circles indicate the three nodes used for calibration. The yellow circle indicates the hypothesised origin of tachinid flies. In the geological time scale: Pala indicates Palaeocene; Eoce indicates Eocene; Oligo indicates Oligocene; Mioc indicates Miocene; P indicates Pliocene; Q indicates Quaternary. Our estimates suggest that the most recent common ancestor of tachinid flies existed between 33 and 48 mya. The two tachinid samples used in this study are from the same subfamily Exoristinae, but are in separate tribes Goniini (El. flavipalpis) and Exoristini (Ex. sorbillans). Among the four subfamilies of Tachinidae, Exoristinae was probably the latest to emerge [69]–[71]. Therefore, the time of origin of tachinid flies should be in the earlier half of the time interval described above. We speculate that the most recent common ancestor of tachinid flies existed in the middle Eocene (∼42–48 mya). Tachinid flies have a worldwide distribution, but are mainly found in Palaearctic and Nearctic regions. For a globally distributed family with significant differences in distribution between northern and southern continents, the relevant split is between the supercontinents Laurasia and Gondwana in the mid-Mesozoic. Our estimates for the origin of Tachinidae is much more recent than this. However, given that most tachinid species are distributed throughout the Holarctic Region, we suggest that the evolutionary history of tachinid flies is probably tied to the split of Laurasia in the Eocene rather than that between Laurasia and Gondwana. We have shown that the availability of additional mitogenomes can make a valuable contribution to our understanding of the phylogeny and divergence times of Diptera. Our study serves as a useful primer for the evolution of tachinid flies, but the accuracy of divergence-time estimates can be improved by denser sampling of tachinid mitogenomes, a greater number of fossil calibrations, and combination with nuclear genes or morphological data. In addition, we suggest that the stable gene order among brachyceran species might be due to their comparatively short evolutionary timeframe. Nucleotide composition of all available mitogenome sequences from Diptera. (DOC) Click here for additional data file.
  48 in total

1.  MrBayes 3: Bayesian phylogenetic inference under mixed models.

Authors:  Fredrik Ronquist; John P Huelsenbeck
Journal:  Bioinformatics       Date:  2003-08-12       Impact factor: 6.937

2.  The complete mitochondrial genome of Spilonota lechriaspis Meyrick (Lepidoptera: Tortricidae).

Authors:  Jin-Liang Zhao; Yan-Yan Zhang; A-Rong Luo; Guo-Fang Jiang; Stephen L Cameron; Chao-Dong Zhu
Journal:  Mol Biol Rep       Date:  2010-11-24       Impact factor: 2.316

3.  Domestication of olive fly through a multi-regional host shift to cultivated olives: comparative dating using complete mitochondrial genomes.

Authors:  F Nardi; A Carapelli; J L Boore; G K Roderick; R Dallai; F Frati
Journal:  Mol Phylogenet Evol       Date:  2010-08-17       Impact factor: 4.286

4.  Improving access to the control region and tRNA gene clusters of dipteran mitochondrial DNA.

Authors:  M T Oliveira; A C Da Rosa; A M L Azeredo-Espin; A C Lessinger
Journal:  J Med Entomol       Date:  2006-05       Impact factor: 2.278

5.  RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models.

Authors:  Alexandros Stamatakis
Journal:  Bioinformatics       Date:  2006-08-23       Impact factor: 6.937

6.  Complete sequences of mitochondria genomes of Aedes aegypti and Culex quinquefasciatus and comparative analysis of mitochondrial DNA fragments inserted in the nuclear genomes.

Authors:  Susanta K Behura; Neil F Lobo; Brian Haas; Becky deBruyn; Diane D Lovin; Martin F Shumway; Daniela Puiu; Jeanne Romero-Severson; Vishvanath Nene; David W Severson
Journal:  Insect Biochem Mol Biol       Date:  2011-05-27       Impact factor: 4.714

7.  The complete nucleotide sequence of the mitochondrial genome of the oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae).

Authors:  D J Yu; L Xu; F Nardi; J G Li; R J Zhang
Journal:  Gene       Date:  2007-03-15       Impact factor: 3.688

8.  Episodic radiations in the fly tree of life.

Authors:  Brian M Wiegmann; Michelle D Trautwein; Isaac S Winkler; Norman B Barr; Jung-Wook Kim; Christine Lambkin; Matthew A Bertone; Brian K Cassel; Keith M Bayless; Alysha M Heimberg; Benjamin M Wheeler; Kevin J Peterson; Thomas Pape; Bradley J Sinclair; Jeffrey H Skevington; Vladimir Blagoderov; Jason Caravas; Sujatha Narayanan Kutty; Urs Schmidt-Ott; Gail E Kampmeier; F Christian Thompson; David A Grimaldi; Andrew T Beckenbach; Gregory W Courtney; Markus Friedrich; Rudolf Meier; David K Yeates
Journal:  Proc Natl Acad Sci U S A       Date:  2011-03-14       Impact factor: 11.205

9.  The mitochondrial genome of the common cattle grub, Hypoderma lineatum.

Authors:  S Weigl; G Testini; A Parisi; F Dantas-Torres; D Traversa; D D Colwell; D Otranto
Journal:  Med Vet Entomol       Date:  2010-05-17       Impact factor: 2.739

10.  Characterization of the complete mitochondrial genome of the giant silkworm moth, Eriogyna pyretorum (Lepidoptera: Saturniidae).

Authors:  Shao-Tong Jiang; Gui-Yun Hong; Miao Yu; Na Li; Ying Yang; Yan-Qun Liu; Zhao-Jun Wei
Journal:  Int J Biol Sci       Date:  2009-05-22       Impact factor: 6.580

View more
  29 in total

1.  The complete mitochondrial genome of Gasterophilus intestinalis, the first representative of the family Gasterophilidae.

Authors:  De-Zhen Gao; Guo-Hua Liu; Hui-Qun Song; Guang-Lei Wang; Chun-Ren Wang; Xing-Quan Zhu
Journal:  Parasitol Res       Date:  2016-03-18       Impact factor: 2.289

2.  Mitochondrial Genomes Provide New Phylogenetic and Evolutionary Insights into Psilidae (Diptera: Brachycera).

Authors:  Jiale Zhou; Ding Yang
Journal:  Insects       Date:  2022-06-01       Impact factor: 3.139

3.  Mitogenome-wise codon usage pattern from comparative analysis of the first mitogenome of Blepharipa sp. (Muga uzifly) with other Oestroid flies.

Authors:  Debajyoti Kabiraj; Hasnahana Chetia; Adhiraj Nath; Pragya Sharma; Ponnala Vimal Mosahari; Deepika Singh; Palash Dutta; Kartik Neog; Utpal Bora
Journal:  Sci Rep       Date:  2022-04-29       Impact factor: 4.996

4.  The first mitochondrial genome of the sepsid fly Nemopoda mamaevi Ozerov, 1997 (Diptera: Sciomyzoidea: Sepsidae), with mitochondrial genome phylogeny of cyclorrhapha.

Authors:  Xuankun Li; Shuangmei Ding; Stephen L Cameron; Zehui Kang; Yuyu Wang; Ding Yang
Journal:  PLoS One       Date:  2015-03-31       Impact factor: 3.240

5.  The Complete Mitochondrial Genome of Delia antiqua and Its Implications in Dipteran Phylogenetics.

Authors:  Nai-Xin Zhang; Guo Yu; Ting-Jing Li; Qi-Yi He; Yong Zhou; Feng-Ling Si; Shuang Ren; Bin Chen
Journal:  PLoS One       Date:  2015-10-01       Impact factor: 3.240

6.  Phylogenetic inference of calyptrates, with the first mitogenomes for Gasterophilinae (Diptera: Oestridae) and Paramacronychiinae (Diptera: Sarcophagidae).

Authors:  Dong Zhang; Liping Yan; Ming Zhang; Hongjun Chu; Jie Cao; Kai Li; Defu Hu; Thomas Pape
Journal:  Int J Biol Sci       Date:  2016-02-20       Impact factor: 6.580

7.  The Phylogeny and Evolutionary Timescale of Muscoidea (Diptera: Brachycera: Calyptratae) Inferred from Mitochondrial Genomes.

Authors:  Shuangmei Ding; Xuankun Li; Ning Wang; Stephen L Cameron; Meng Mao; Yuyu Wang; Yuqiang Xi; Ding Yang
Journal:  PLoS One       Date:  2015-07-30       Impact factor: 3.240

8.  Mitochondrial genomes of two phlebotomine sand flies, Phlebotomus chinensis and Phlebotomus papatasi (Diptera: Nematocera), the first representatives from the family Psychodidae.

Authors:  Fei Ye; Ting Liu; Stanley D King; Ping You
Journal:  Parasit Vectors       Date:  2015-09-17       Impact factor: 3.876

9.  Reassessment of Paleotachina Townsend and Electrotachina Townsend and their removal from the Tachinidae (Diptera).

Authors:  James E O'Hara; Christopher M Raper; Adrian C Pont; Daniel Whitmore
Journal:  Zookeys       Date:  2013-12-12       Impact factor: 1.546

10.  Papiliocoelotes gen. n., a new genus of Coelotinae (Araneae, Agelenidae) spiders from the Wuling Mountains, China.

Authors:  Zhe Zhao; Shuqiang Li
Journal:  Zookeys       Date:  2016-04-27       Impact factor: 1.546

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.