| Literature DB >> 23620743 |
Martin Stofanko1, Higgor Gonçalves-Dornelas, Pricila Silva Cunha, Heloísa B Pena, Angela M Vianna-Morgante, Sérgio Danilo Junho Pena.
Abstract
Because of economic limitations, the cost-effective diagnosis of patients affected with rare microdeletion or microduplication syndromes is a challenge in developing countries. Here we report a sensitive, rapid, and affordable detection method that we have called Microdeletion/Microduplication Quantitative Fluorescent PCR (MQF-PCR). Our procedure is based on the finding of genomic regions with high homology to segments of the critical microdeletion/microduplication region. PCR amplification of both using the same primer pair, establishes competitive kinetics and relative quantification of amplicons, as happens in microsatellite-based Quantitative Fluorescence PCR. We used patients with two common microdeletion syndromes, the Williams-Beuren syndrome (7q11.23 microdeletion) and the 22q11.2 microdeletion syndromes and discovered that MQF-PCR could detect both with 100% sensitivity and 100% specificity. Additionally, we demonstrated that the same principle could be reliably used for detection of microduplication syndromes, by using patients with the Lubs (MECP2 duplication) syndrome and the 17q11.2 microduplication involving the NF1 gene. We propose that MQF-PCR is a useful procedure for laboratory confirmation of the clinical diagnosis of microdeletion/microduplication syndromes, ideally suited for use in developing countries, but having general applicability as well.Entities:
Mesh:
Substances:
Year: 2013 PMID: 23620743 PMCID: PMC3631209 DOI: 10.1371/journal.pone.0061328
Source DB: PubMed Journal: PLoS One ISSN: 1932-6203 Impact factor: 3.240
MQF-PCR results for patients with microdeletion and microduplication syndromes.
| Syndrome | Patient | Z (PZ)-statisticsscore |
| Williams-Beuren | 194 | −4.57 |
| 385 | −5.04 | |
| 603 | −5.33 | |
| 604 | −5.29 | |
| 3105 | −5.10 | |
| 4183 | −4.68 | |
| 4282 | −5.13 | |
| 7350 | −3.11 | |
| 8184 | −5.47 | |
| 9234 | −5.38 | |
| 10498 | −4.76 | |
| 11275 | −4.78 | |
| 11469 | −5.05 | |
| 12681 | −5.55 | |
| Velocardiofacial | 8432 | (−2.87) |
| 8441 | (−3.93) | |
| 9146 | (−1.37) | |
| 10097 | (−2.45) | |
| 10127 | (−1.93) | |
| 10332 | (−2.17) | |
| 10460 | (−3.03) | |
| 11153 | (−3.03) | |
| Lubs ( | 15982A | 6.56 |
| 15982B | 4.12 | |
| 17863A | 9.40 | |
| 17863B | 7.65 | |
| 17q11.2 microduplication |
| 11.51 |
|
| 11.27 | |
|
| 10.89 |
MQF-PCR primers used in detection of microdeletion and microduplication syndromes.
| Syndrome | Primer name | Sequences (5′->3′) | Fragment sizes | Genomic locations (GRCh37) |
| Williams-Beuren | WBS-MQF-F | TGGGAGGGCCATTTTGTCAC | chr.7: 218 bp | chr7: 73,536,635–73,536,831 |
| WBS-MQF-R | TTATTGTTCTGCRTCTGGG | chr.18: 214 bp | chr18: 675,837–676,031 | |
| Velocardiofacial | VCF-MQF-F | GTATTTGGAAGWGTTTCTGTATAGA | chr.22: 99 bp | chr22: 19,618,131–19,618,209 |
| VCF-MQF-R | GAGAACTGGGTTTACCTGAC | chr.3: 104 bp | chr3: 88,205,817–88,205,900 | |
| Lubs ( | LUBS-MQF-F | TGAAACCTGACTTGCTTCT | chr.X: 197 bp | chrX: 153,276,119–153,276,295 |
| LUBS-MQF-R | GCACTGATTGTGGCAGAG | chr.5: 198 bp | chr5: 32,649,017–32,649,192 | |
| 17q11.2 microduplication | NF1-MQF-F | TGTTACCTGGTGTCTAGAGC | chr.17: 159 bp | chr17: 29,468,898–29,469,033 |
| NF1-MQF-R | GCCCCTTAGACCATAATG | chr.13: 153 bp | chr13: 19,673,801–19,673,931 |
Universal M13-40 extension (5′-GTTTTCCCAGTCACGAC-3′) was added to the 5′ end of the primer to allow for cost-efficient fluorescent labelling of amplicons [31].
A PIG-tail extension (5′-GTTTCTT-3′) was added to the 5′ end of the primer to promote full adenylation of the 3′ end of the forward strand [32].
Figure 1Schematic overview of MQF-PCR primer selection for Williams-Beuren and Velocardiofacial syndromes critical regions (not drawn to scale).
A) Williams-Beuren critical region at 7q11.23 contains centromeric (white arrow), middle (grey arrow), and telomeric (black arrow) blocks of low copy repeats. The minimal critical region in this study represents the region that is flanked by the inner block of low copy repeats. Sequence similarity search identified a region that can be amplified using the LIMK1-MQF primers (bold) and has significant similarity to homologous region at 18p11.32. B) Multiple sequence alignment of the LIMK1-MQF region with its homologous region on chromosome 18. A deletion of 2 bp (dashed box) differentiates the two fragments amplified using the same primer pair. C) Velocardiofacial critical region at 22q11.2 is delimited by 4 blocks of low copy repeats. The minimal critical region in this study represents the region that is flanked by two blocks of low copy repeats most proximal to the centromere (black boxes). Sequence similarity search identified a region within the critical region that can be amplified using the VCF-MQF primers (bold) with significant similarity to a homologous region at 3p11.1. D) Multiple sequence alignment of the VCF-MQF region with its homologous region on chromosome 3. A deletion of 5 bp (dashed box) differentiates the two fragments amplified using the same primer pair. Microsatellite markers (italicized) and Real-Time PCR primers used in molecular diagnosis of patients are shown in both panels.
Figure 2Evaluation of MQF-PCR in detection of Williams-Beuren and Velocardiofacial syndromes.
A–D) Representative electropherograms showing the peak areas corresponding to the syndrome-related chromosomes (black) that are reduced by about 50% in comparison with the peaks representing the control chromosomes (white) between controls and affected individuals. Electropherogram depicting change in peak area between chromosome 7 and its control chromosome in normal (A) and individual with WBS syndrome (B). Electropherogram depicting change of the peak area between chromosome 22 and its control chromosome in normal (C) and individual with VCF syndrome (D). E–F) Interactive dot diagrams of ROC curve analysis of Z scores in WBS (E), and PZ scores in VCF syndrome (F). Both diagnostic primers achieved 100% diagnostic sensitivity and 100% diagnostic specificity. The number of cases analyzed and the detection threshold values for both syndromes are given.
Figure 3Detection of the Lubs (MECP2 duplication) and 17q11.2 microduplication syndromes.
Representative electropherograms showing changes in the peak area ratios between a control sample (A) and a patient (B) in diagnosis of the Lubs syndrome. The peak area corresponding to the duplicated region on chromosome Xq28 (black) has significantly increased in size compared to its control region on chromosome 5p13.3 (white). Electropherogram depicting change of the peak area between chromosome 17 and its control chromosome in normal (C) and individual with microduplication of 17q11.2 (D) The peak area corresponding to the duplicated region on chromosome 17 (black) has significantly increased in size compared to its control region on chromosome 13q12.11 (white). E–F) Interactive dot diagrams of ROC curve analysis of Z scores in Lubs (E), and 17q11.2 microduplication syndrome (F). Both diagnostic primers achieved 100% diagnostic sensitivity and 100% diagnostic specificity. The number of cases analyzed and the detection threshold values for both syndromes are given.