Literature DB >> 23617778

Screening of differentially expressed genes in the growth plate of broiler chickens with tibial dyschondroplasia by microarray analysis.

Wen-xia Tian1, Jia-kui Li, Ping Qin, Rui Wang, Guan-bao Ning, Jian-gang Qiao, Hong-quan Li, Ding-ren Bi, Si-yi Pan, Ding-zong Guo.   

Abstract

BACKGROUND: Tibial dyschondroplasia (TD) is a common skeletal disorder in broiler chickens. It is characterized by the presence of a non-vascularized and unmineralized cartilage in the growth plate. Previous studies have investigated differential expression of genes related to cartilage development during latter stages of TD. The aim of our study was to identify differentially expressed genes (DEGs) in the growth plate of broiler chickens, which were associated with early stage TD. We induced TD using tetramethylthiuram disulfide (thiram) for 1, 2, and 6 days and determined DEGs with chicken Affymetrix GeneChip assays. The identified DEGs were verified by quantitative polymerase chain reaction (qPCR) assays.
RESULTS: We identified 1630 DEGs, with 82, 1385, and 429 exhibiting at least 2.0-fold changes (P < 0.05) at days 1, 2, and 6, respectively. These DEGs participate in a variety of biological processes, including cytokine production, oxidation reduction, and cell surface receptor linked signal transduction on day 1; lipid biosynthesis, regulation of growth, cell cycle, positive and negative gene regulation, transcription and transcription regulation, and anti-apoptosis on day 2; and regulation of cell proliferation, transcription, dephosphorylation, catabolism, proteolysis, and immune responses on day 6. The identified DEGs were associated with the following pathways: neuroactive ligand-receptor interaction on day 1; synthesis and degradation of ketone bodies, terpenoid backbone biosynthesis, ether lipid metabolism, JAK-STAT, GnRH signaling pathway, ubiquitin mediated proteolysis, TGF-β signaling, focal adhesion, and Wnt signaling on day 2; and arachidonic acid metabolism, mitogen-activated protein kinase (MAPK) signaling, JAK-STAT, insulin signaling, and glycolysis on day 6. We validated seven DEGs by qPCR.
CONCLUSIONS: Our findings demonstrate previously unrecognized changes in gene transcription associated with early stage TD. The DEGs we identified by microarray analysis will be used in future studies to clarify the molecular pathogenic mechanisms of TD. From these findings, potential pathways involved in early stage TD warrant further investigation.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 23617778      PMCID: PMC3648502          DOI: 10.1186/1471-2164-14-276

Source DB:  PubMed          Journal:  BMC Genomics        ISSN: 1471-2164            Impact factor:   3.969


Background

Tibial dyschondroplasia (TD) is a common skeletal disorder in broiler chickens characterized by the presence of non-vascularized and unmineralized cartilage in the growth plate. Tetramethylthiuram disulfide (thiram) exerts its cytotoxic effects through membrane damage, mitochondrial injury, inhibition of glutathione metabolism, cell death, and inhibition of angiogenesis. Rath et al. [1] showed that thiram-induced TD is not produced through an increase in chondrocyte multiplication in the transition zone, nor by altering the expression of genes causing the arrest of chondrocytes in a pre-hypertrophic state. It acts by creating metabolic dysfunction that leads to the destruction of blood capillaries in the transition zone chondrocytes. Our previous studies showed that thiram could promote chondrocyte proliferation in the growth plate of chickens, and disturbs the regulation of endochondral calcification and development of normal cartilage. This results in prehypertrophic cell accumulation, angionecrosis, abnormal extracellular matrix synthesis, deferred endochondral calcification, and bone resorption (Figure 1) [2].
Figure 1

Histologic characteristics of tibia growth plate development in broiler chickens at day 4 during the experimental period. C, control; T, thiram-fed; A, articulus zone; P, proliferative zone; PH, pre-hypertrophic zone; H, hypertrophic zone; Ca, calcification zone. Thiram promoted chondrocyte proliferation, resulting in necrosis of a large number of cells, and compressed blood vessels that led to necrosis of blood vessels. The scale bar indicates 200 μm.

Histologic characteristics of tibia growth plate development in broiler chickens at day 4 during the experimental period. C, control; T, thiram-fed; A, articulus zone; P, proliferative zone; PH, pre-hypertrophic zone; H, hypertrophic zone; Ca, calcification zone. Thiram promoted chondrocyte proliferation, resulting in necrosis of a large number of cells, and compressed blood vessels that led to necrosis of blood vessels. The scale bar indicates 200 μm. Previous studies have investigated the differential expression of genes related to cartilage development during late stage TD using various techniques, such as immunohistochemistry, western blotting, in situ hybridization, semi-quantitative polymerase chain reaction (PCR), real-time quantitative PCR (qPCR), and proteomic analyses. These studies revealed abnormal expression of a variety of factors during TD, including extracellular matrix molecules (collagen, osteopontin, osteonectin), growth factors, and hormones [vascular endothelial growth factor (VEGF) and its receptor, hypoxia inducible factor-1 (HIF-1)]. Additionally, matrix metalloproteinases (MMPs), carbonic anhydrase II (CA2), and heat shock proteins (HSPs) were also shown to be affected [3-11]. Recently we generated cDNA libraries for 96-h thiram-induced broiler chicken TD using a suppression subtractive hybridization (SSH) technique, and identified 10 differentially expressed genes (DEGs). Five of these DEGs were found to be upregulated in chicken TD: matrilin-3 (matn3); chondromodulin-I (chm-1); NADH dehydrogenase (nadhdh); cytochrome C oxidase subunit III (coxIII); and enolase 1 (eno1). Differential expression of these genes may affect cartilage matrix cross-linking, angiogenesis, energy metabolism, and growth regulation [12]. The average cycle of chondrocyte proliferation to terminal differentiation is approximately 21 h; with thiram-induced cytotoxicity accompanied by rapid and significant oxidation, lipid peroxidation, and cell death. Thus, it is likely that the changes that occur during the early stages of TD initiate alterations that are found during late stage TD. The use of DNA microarray techniques has made it possible for large-scale analysis of gene function and regulation to be conducted. DNA microarrays have been used to study skeletal development in humans and rodents [13-15]. In this study, we screened temporal changes in DEGs during early stages of TD in broiler chickens using an Affymetrix GeneChip, and verified expression patterns at different phases by qPCR. Genetic analyses were used to complement morphological changes and better understand the pathogenic mechanisms of TD.

Results

Pathological features of thiram-induced TD

Pathologic characteristics of broiler chicken tibia growth plate induced by thiram at day 1 were ascertained (Figure 2). Macroscopic examination revealed that the growth plates of chickens administered thiram were thickened compared with the control group (Figure 2a). Histological characteristics of the growth plates of these chickens were observed by microscopy, and revealed that chondrocytes at the thickened proliferative and pre-hypertrophic zones were sparse. Pre-hypertrophic and hypertrophic chondrocytes exhibited pyknosis. Additionally, the number of empty cartilage capsules was increased and the number of blood vessels decreased, with angionecrosis observed at the pre-hypertrophic zone (Figure 2b). Transmission electron microscopy was used to examine apoptotic cells that contained pyknotic nuclei. These cells exhibited dilated cisternae of the endoplasmic reticulum (ER) that were enlarged and formed a continuous network, with a concentrated cytoplasm (Figure 2c).
Figure 2

Pathological characteristics of tibia growth plates due to thiram at day 1. C, control group; T, thiram-fed group. a. Compared with the control group, the growth plate of thiram-treated chickens was thicker. b. Histological characteristics of the growth plate of chickens fed thiram. The scale bar indicates 200 μm. A, Articulus zone; P, proliferative zone; PH, pre-hypertrophic zone; H, hypertrophic zone. Chondrocytes at the thickened proliferative and prehypertrophic zones were sparse. Pre-hypertrophic and hypertrophic chondrocytes exhibited pyknosis. The number of empty cartilage capsules was increased, while the number of blood vessels was reduced, with angionecrosis seen at the pre-hypertrophic zone. c. Possible apoptotic cells are shown with pyknotic nuclei, enlarged dilated cisternae of the ER that formed a continuous network, and concentrated cytoplasm. The scale bar indicates 1 μm.

Pathological characteristics of tibia growth plates due to thiram at day 1. C, control group; T, thiram-fed group. a. Compared with the control group, the growth plate of thiram-treated chickens was thicker. b. Histological characteristics of the growth plate of chickens fed thiram. The scale bar indicates 200 μm. A, Articulus zone; P, proliferative zone; PH, pre-hypertrophic zone; H, hypertrophic zone. Chondrocytes at the thickened proliferative and prehypertrophic zones were sparse. Pre-hypertrophic and hypertrophic chondrocytes exhibited pyknosis. The number of empty cartilage capsules was increased, while the number of blood vessels was reduced, with angionecrosis seen at the pre-hypertrophic zone. c. Possible apoptotic cells are shown with pyknotic nuclei, enlarged dilated cisternae of the ER that formed a continuous network, and concentrated cytoplasm. The scale bar indicates 1 μm.

Isolation and assessment of total RNA

Total RNA was isolated from the growth plates of control and thiram-treated chickens on days 1, 2 or 6 post-feeding. Total RNA quality was determined sufficient for subsequent analyses when RNA integrity was 2 (distinct bands corresponding 28S and 18S rRNA at a ratio of 2:1), total RNA concentration was between 2–4 μg/μL, the A260/280 ratio was around 2.1, and the A260/230 ratio of a sample was near 2.2.

DEGs at different stages of TD

Our one-way ANOVA revealed 1630 DEGs with a minimum 2.0-fold change (p < 0.05) in expression level. There were 82, 1385, and 429 DEGs identified on days 1, 2, and 6, respectively (Additional file 1). On day 1, 61 DEGs were upregulated and the remaining 21 downregulated. On day 2, 641 DEGs were upregulated and 744 downregulated, while on day 6, 324 DEGs were upregulated and 105 downregulated. Only 29 DEGs were commonly observed at all three time points; 18 DEGs were observed for both days 1 and 2; 13 DEGs were observed on days 1 and 6; and 177 DEGs were commonly observed for days 2 and 6 (Figure 3). And there were 39, 1086, and 279 DEGs (2.0-fold change, p < 0.05) identified on days 1, 2, and 6 by two-way ANOVA (Additional file 2).
Figure 3

Analysis of the 1630 transcripts identified on days 1, 2 and 6 using Venn diagrams. 1C, 2C, and 6C indicates days 1, 2 and 6 for the control group, respectively, while 1T, 2T, and 6T denotes days 1, 2, and 6 for the thiram-fed group, respectively. There were 82, 1385, and 429 DEGs identified on days 1, 2, and 6, respectively. Only 29 DEGs were observed at all three time points. Thirteen DEGs were observed on both days 1 and 6; 18 DEGs were observed on both days 1 and 2; 177 DEGs were observed on both days 2 and 6.

Analysis of the 1630 transcripts identified on days 1, 2 and 6 using Venn diagrams. 1C, 2C, and 6C indicates days 1, 2 and 6 for the control group, respectively, while 1T, 2T, and 6T denotes days 1, 2, and 6 for the thiram-fed group, respectively. There were 82, 1385, and 429 DEGs identified on days 1, 2, and 6, respectively. Only 29 DEGs were observed at all three time points. Thirteen DEGs were observed on both days 1 and 6; 18 DEGs were observed on both days 1 and 2; 177 DEGs were observed on both days 2 and 6.

Reliability of microarray screening

Microarray screening assays revealed 18 hybridization maps. All maps showed a regular dot array with excellent signal saturation and homogeneous background. Quality control reports also indicated a stable background around 30, and a noise level of 1.14%. At the experimental setting (α1 = 0.04, α2 = 0.06, τ = 0.015), the marginal signal intensity (M) was approximately 2.2%, thereby confirming the reliability of the microarrays. To further validate the microarrays, seven up-regulated genes (1.3–73.5-fold) were selected for qPCR analysis. Of these genes, heat shock protein 25 (hsp25), and lysyl oxidase (lox) expression were significantly upregulated (p < 0.05) at days 1, 2 and 6. However, kinectin 1 (ktn1), inhibitor of DNA binding 1 (id-1), secreted frizzled-related protein 4 (sfrp4), cadherin 1 (cdh1), and enolase 2 (eno2) showed significant (p < 0.05) differential expression at two time points. Despite consistent trends of differential expression, the qPCR results did not agree with the microarray data with respect to the range in fold-change (FC) range (Table 1).
Table 1

Validation of microarray data by qPCR

Gene
Gene description
Microarray FC
qPCR FC
  d 1d 2d 6d1d2d6
lox
lysyl oxidase
+3.9
+71.8
+9.6
+4.4
+212.9
+13.8
hsp25
heat shock protein 25
+2.1
+43.3
+25.1
+3.4
+298.0
+30.5
id1
inhibitor of DNA binding 1
+1.6 a
+2.9
+2.3
+1.1 a
+1.8
+1.2 a
ktn1
kinectin 1
+1.5 a
+4.7
+3.6
+1.9 a
+17.1
+5.7
sfrp4
secreted frizzled-related protein 4
+2.8
+73.5
+11.6
+2.0 a
+52.2
+11.2
cdh1
cadherin 1
+1.3 a
+31.4
+10.9
+2.4 a
+45.4
+3.1
eno2enolase 2+2.3+10.5+4.0+5.1+6.2+1.1 a

+ Represents upregulated. a Represents p > 0.05; d1, d2, and d6 denote the three time points of analysis.

Validation of microarray data by qPCR + Represents upregulated. a Represents p > 0.05; d1, d2, and d6 denote the three time points of analysis.

Cluster analyses of DEGs

Principal component analysis (PCA) revealed a similarity of 37.7% at the three time points examined. There was a relatively minor difference in DEGs observed between control and thiram-fed chickens at day 1. However, the differences in DEGs between the two groups were significantly different at days 2 and 6 (Figure 4). A clear expression pattern emerged after hierarchical clustering analyses of the 1630 transcripts (p < 0.05, FC ≥ 2.0) on days 1, 2, and 6. Hierarchical cluster analysis also showed that chickens in the control group on days 1, 2, and 6 formed a cluster with similar gene expression patterns. Gene expression patterns of thiram-fed chickens on days 1 and 6 were more similar to those observed in control animals. The gene expression patterns in thiram-fed chickens at day 2 formed a separate cluster with similar gene expression patterns (Figure 5).
Figure 4

PCA analysis. PCA mapping indicated 37.7% similarity at the three time points. The insignificant difference between 1T and 1C indicated that the number of DEGs was small at day 1, with a much greater difference observed at days 2 and 6.

Figure 5

Hierarchical clustering analysis of differentially expressed genes during TD. Hierarchical clustering analyses of the 1630 transcripts (p < 0.05, FC ≥ 2.0) on days 1, 2, and 6. Red, gray, and blue represent high, average, and absent expression levels of genes, respectively. Each row represents one chicken, and each column refers to a gene. 1C, 2C, and 6C indicates days 1, 2 and 6 for the control group respectively, while 1T, 2T, and 6T denotes days 1, 2, and 6 for the thiram-fed group, respectively.

PCA analysis. PCA mapping indicated 37.7% similarity at the three time points. The insignificant difference between 1T and 1C indicated that the number of DEGs was small at day 1, with a much greater difference observed at days 2 and 6. Hierarchical clustering analysis of differentially expressed genes during TD. Hierarchical clustering analyses of the 1630 transcripts (p < 0.05, FC ≥ 2.0) on days 1, 2, and 6. Red, gray, and blue represent high, average, and absent expression levels of genes, respectively. Each row represents one chicken, and each column refers to a gene. 1C, 2C, and 6C indicates days 1, 2 and 6 for the control group respectively, while 1T, 2T, and 6T denotes days 1, 2, and 6 for the thiram-fed group, respectively.

DEGs gene ontology (GO) analyses

Annotation of identified DEGs was carried out using the Database for Annotation, Visualization and Integrated Discovery (DAVID) at the three time points examined. These DEGs were found to participate in a variety of biological processes, such as cytokine production (p < 0.05), cell adhesion, intracellular signaling cascades, cell surface receptor linked signal transduction, oxidation reduction and phosphate metabolic processes on day 1 (Figure 6). On day 2 DEGs were associated with transcription regulation, sterol metabolic processes, lipid biosynthetic processes, growth regulation, steroid metabolism, regulation of cell morphogenesis, the mitotic cell cycle, fatty acid metabolism, cellular amino acid derivative metabolism, anti-apoptosis, the cell cycle, positive and negative gene regulation (p < 0.05) (Figure 7). On day 6, DEGs were associated with positive regulation of the developmental process, transcription, immune responses, bone mineralization and positive regulation of cell differentiation (p < 0.01), proteolysis, protein amino acid dephosphorylation, negative regulation of signal transduction, regulation of cell proliferation, negative regulation of cell communication, and catabolic processes (p < 0.05) (Figure 8).
Figure 6

Biological process Gene Ontology (GO) analysis of 82 DEGs on day 1.

Figure 7

Biological process Gene Ontology (GO) analysis of 1385 DEGs on day 2.

Figure 8

Biological process Gene Ontology (GO) analysis of 429 DEGs on day 6.

Biological process Gene Ontology (GO) analysis of 82 DEGs on day 1. Biological process Gene Ontology (GO) analysis of 1385 DEGs on day 2. Biological process Gene Ontology (GO) analysis of 429 DEGs on day 6.

Potential metabolic pathways related to TD

A number of metabolic pathways were possibly related to TD development between days 1 and 6. Pathways associated with DEGs were: neuroactive ligand-receptor interaction (p < 0.05); the phosphatidylinositol signaling system; calcium signaling pathways; and the MAPK signaling pathway on day 1. Synthesis and degradation of ketone bodies, ether lipid metabolism, terpenoid backbone biosynthesis, JAK-STAT, and steroid biosynthesis (p < 0.05), GnRH signaling pathway, ubiquitin mediated proteolysis, TGF-β signaling, MAPK signaling, VEGF signaling, focal adhesion, Wnt signaling, and regulation of the actin cytoskeleton were all pathways associated with DEGs identified on day 2. Arachidonic acid metabolism (p < 0.01), the MAPK signaling pathway (p < 0.05), JAK-STAT, glycolysis, Adipocytokine signaling pathway, insulin signaling, cytokine-cytokine receptor interaction, TGF-β signaling, focal adhesion and regulation of the actin cytoskeleton were associated with DEGs on day 6. Of these DEGs, the expression level of secreted frizzled-related protein 4 (sfrp4) was upregulated 2.8-, 73.5-, and 11.6-fold on days 1, 2, and 6, respectively. The expression level of cadherin 1 (cdh1) was upregulated 31.4- and 10.9-fold on days 2 and 6, respectively. Similarly, expression of enolase 2 (eno2) was upregulated 2.3-, 10.5-, and 4.0-fold on days 1, 2, and 6, respectively.

Discussion

Previous studies of TD have focused on the late stages; however, in this study we have reported the pathological changes of thiram-induced TD at earlier stages. Our findings show that the growth plate in chickens given thiram was thickened, with a decreased number of chondrocytes at the thickened proliferative and pre-hypertrophic zone. The pre-hypertrophic and hypertrophic chondrocytes exhibited pyknosis. We also observed an increased number of empty cartilage capsules and a decreased number of blood vessels, in addition to angionecrosis at the pre-hypertrophic zone. Transmission electron microscopy analysis of apoptotic cells revealed pyknotic nuclei, and dilated cisternae of the ER that were enlarged and formed a network structure; also, the cytoplasm was concentrated. Biological process annotation revealed that the DEGs at day 1 following feeding with the thiram diet were associated with cytokine production that primarily involved the neuroactive ligand-receptor interaction pathway. The downregulated genes included chemokine (C-C motif) receptor 6 (ccr6), prostaglandin E receptor 4 (subtype EP4) (ptger4), arginine vasopressin receptor 2 (avpr2), and proprotein convertase subtilisin/kexin type 5 (pcsk5), while 5-hydroxytryptamine (serotonin) receptor 7 (htr7), and opiate receptor-like 1(oprl1) were upregulated. Genes screened on day 2 revealed the involvement of important biological processes such as sterol metabolism, lipid biosynthesis, steroid metabolism, and terpenoid backbone biosynthesis in particular. Terpenoid, also called isoprenoid, plays an important role during cell growth. Ether lipids, also called plasmalogens or 1-O-alkyl lipids, are ubiquitous and sometimes form major parts of cell membranes in mammals. Differences between the catabolism of ether glycerophospholipids by specific phospholipases might be involved in the generation of lipid second messenger systems, which are important in signal transduction. Ether lipids can also act directly in cell signaling, as the platelet-activating factor is an ether lipid signaling molecule that is involved in leukocyte function in mammalian immune systems. Another possible function of plasmalogen ether lipids are as antioxidants to protect against oxidative stress, therefore these lipids might play a role in serum lipoprotein metabolism. This antioxidant activity comes from the enol ether double bond that is targeted by a variety of reactive oxygen species [16]. Sterols are natural active compounds that form major parts of the cell membranes and are precursors of hormones, vitamin D and sterol compound. Thus, downregulation in the expression of synthases is likely to contribute to the progression of TD. Analysis of gene expression on day 6 revealed that the biological processes affected were associated with positive regulation of developmental processes involved in arachidonic acid metabolism and the MAPK signaling pathway. Arachidonic acid is the direct precursor of active compounds such as prostaglandin E2, prostaglandin I2 and leukotrienes C4 (LTC4). These play important roles in the regulation of lipoprotein metabolism, cell development, blood vessel elasticity and white blood cell function. From these GO annotations at all time points, we deduced that the cytotoxic effects of thiram resulted in membrane damage, loss of enzymatic activities, and loss of protein receptor function, especially cysteine-rich proteins. This is likely to influence signal transduction, thereby leading to cell apoptosis and inhibition of pathological angiogenesis. Our analyses also suggest that thiram-induced TD at the early stages is primarily associated with multiple metabolic pathways, focal adhesion, Jak-STAT, adipocytokine signaling pathway, GnRH signaling pathway, oxidative phosphorylation, glycolysis, Wnt, TGF-β, VEGF, and insulin signaling pathways. Metabolic pathways associated with DEGs at days 2 and 6 were identical. Impaired mitochondrial energy metabolism occurred during the initial stages of TD, with glycolysis subsequently induced at later stages of TD. The focal adhesion and JAK-STAT signaling pathways account for most DEGs, where focal adhesion and JAK-STAT may promote chondrocyte proliferation, development, anti-apoptosis, cell survival, and cell motility through Wnt or MAPK signaling pathways. During early stages of TD, many genes were found to have altered expression, due to the cytotoxic effects of thiram, therefore the proliferation of growth plate chondrocytes and metabolism were altered. Horvat-Gordon et al. [17] studied gene expression in chondrocytes isolated from the proliferative and hypertrophic zones of the avian growth plate using microarrays. They identified a number of genes associated with chondrocyte hypertrophy. Our preliminary analyses of the seven verified DEGs revealed that lysyl oxidase (lox), which was upregulated, participates in crosslinking of extracellular collagen via oxidative deamination of lysine or hydroxylysine [18,19]. LOX also plays important roles in cell adhesion/proliferation/migration, the intracellular signal response, and malignant processes. Moreover, LOX reenters cells and aggregates around the nuclei after oxidative changes [20]. The LOX propeptide (LOX-PP) inhibits smooth muscle cell signaling and proliferation, thereby providing a feedback mechanism to inhibit pathological angiogenesis [21]. Heat shock protein 25 (Hsp25) acts as a molecular chaperone to stabilize proteins [22-24], maintain membrane integrity, protect nucleic acids, and stabilize the cytoskeleton [25]. Hsp25 is a marker of differentiated odontoblasts [26-29] and also participates in the MAPK signaling pathway [30]. Additionally, the roles of Hsp25 in osteoblast signaling have also been widely studied [31-34]. The ID-1 protein is a member of the ID protein family that has been implicated in the regulation of cellular differentiation, cell cycle progression, senescence, and apoptosis. Moreover, ID-1 also activates VEGF by enhancing the stability and activity of hypoxia-inducible factor-1a [35,36]. Kinectin 1 (KTN1) is a receptor protein in the reticular membrane. KTN1 mainly participates in intracellular vesicle transport and can also regulate protein synthesis in eukaryotic cells by anchoring the elongation factor-1 complex onto the ER [37]. Tamamura et al. [38] suggested that Wnt/β-catenin signaling regulates chondrocyte phenotype, maturation, and function during cartilage development. Such regulation is critical for growth plate formation, cartilage boundary definition, and endochondral ossification. Over-expression of SFRP4 may inhibit the proliferation of osteoblasts by antagonizing Wnt signaling [39]. SFRP4 may also cause CDH1 over-expression and thus affect cell adhesion and impair angiogenesis [40]. In addition, hypoxic conditions disrupt metabolism and ultimately results in ENO2 and ENO1 over-expression [12].

Conclusion

We identified global gene expression changes during early stages of thiram-induced TD. Downregulation of prostaglandin E receptor 4 (subtype EP4) (ptger4) and arginine vasopressin receptor 2 (avpr2) on day 1 directly influenced signal transduction and blood vessel elasticity. On day 2, downregulation of a variety of synthases altered the production of lipid compounds that are precursors of hormones, vitamin D, PTGD, and PTGE, all of which likely have an important role in angiogenesis, regulation of transcription and cell proliferation, and bone development. Taken together, the findings from this study contribute potential insights into therapies for TD, and also provide fundamental information regarding the pathological mechnisms involved during the early stages of TD.

Methods

TD induction and tissue collection

Broiler chickens (7 days old) were randomly divided into two groups. After fasting overnight, animals were fed a regular diet (control group) or a diet containing 100 mg/kg thiram for 48 h (thiram-fed group) to induce TD, as previously described [12]. Eight birds from each group were sacrificed by cervical dislocation under ether anesthesia on days 1, 2, and 6 after commencement of the experiment. The cartilage growth plates from individual birds were harvested, immediately frozen in liquid nitrogen, and stored at −70°C. All procedures were performed according to protocols approved by the Biological Studies Animal Care and Use Committee of Hubei Province, China.

Gross and microscopic TD lesions

On days 1, 2 and 6, tibiae were observed and recorded, and then immediately removed from two groups of chicks. Samples were fixed overnight in 4% paraformaldehyde or 2.5% glutaraldehyde in phosphate-buffered saline (PBS) at 4°C. Serial histological sections (4-μm thickness) were prepared after samples had been fully decalcified in 10% ethylenediaminetetraacetic acid (EDTA) decalcifying fluid, dehydrated, embedded in paraffin wax, and then stained with hematoxylin and eosin. Sections were examined by light microscopy. For transmission electron microscopy, pre-fixed samples were post-fixed in 2% OsO4, dehydrated, and embedded in epoxy resin. Ultrathin sections were stained with uranyl acetate and lead citrate, and observed with a HITACHI H-7650 transmission electron microscope at 80 kV and a Gatan 832 CCD camera.

RNA extraction

Individual cartilage growth plates collected from each group of birds were homogenized in TRIzol reagent to extract total RNA according to an improved method. RNA integrity and concentration were evaluated using denaturing formaldehyde gel electrophoresis and a Nanodrop 2000 analyzer (Thermo Scientific), respectively.

Microarray hybridization and signal processing

Total RNA samples from18 chickens (three individual chickens from each group on days 1, 2 and 6) were sent to GeneTech Biotech for hybridization to chicken Affymetrix GeneChips (Affymetrix). Briefly, total RNA (500 ng) was purified using a QIAGEN miRNeasy kit. The GeneChip IVT Labeling Kit (Affymetrix) was used for synthesis of biotin-labeled cRNA. Labeled cRNA (15 μg) was hybridized to the GeneChip Chicken Genome Array at 45°C for 16 h. GeneChips were washed and stained with a GeneChip Fluidics Station 450 (Affymetrix) using a standard protocol, and probe arrays were scanned using a Scanner 7G. Quality control (QC) data were obtained using Expression Console software. Principal component analysis (PCA) and histogram cluster analysis were conducted with Partek GS 6.4. Identification of DEGs was also conducted using Partek GS 6.4 through by one way ANOVA and two way ANOVA. The p-value cutoff for DEGs was set at 0.05. The adjusted p-value was computed by the false discovery rate (FDR) using Partek GS 6.4, and FDR of approximately 5% was set as a threshold. DEGs were subjected to hierarchical clustering using Cluster (version 3.0) and visualized with TreeView (version 1.6; Stanford University). The identified DEGs were analyzed for GO and biological pathways using DAVID (http://david.abcc.ncifcrf.gov).

Verification of identified DEGs by qPCR

Total RNA samples used for qPCR verification had also been used in the microarray analyses. Transcripts from each sample were amplified in triplicate and detected using a SYBR Green PCR Master Mix (Applied Biosystems). All primers used (Table 2) were synthesized by Genery Biotechnology. The RPS16 gene was used as the internal control for normalization, while the reference gene β-actin was used to verify the differences in expression levels. Data from qPCR assays were analyzed with Sequence Detector software (version 1.3.1; Applied Biosystems) and were performed by a variance analysis (ANOVA). A P-value less than 0.05 was considered significant.
Table 2

Primers used for qPCR analysis

GeneGene descriptionsPrimers sequence (5′-3′)Target size (bp)Tm (°C)
lox
lysyl oxidase
Forward: TACGTGCAGAGGATGTCCATGT
114
60
Reverse: TCTCAGGAGCACTCGGTTGTC
hsp25
heat shock protein 25
Forward: AGGAGTGTGCCCATCCAGGT
109
60
Reverse: GATGCAGACCGTTGTTCCGT
id1
inhibitor of DNA binding 1
Forward: GGGGTCATTGCCGACATT A
115
60
Reverse: AGGGGGGACTCAGGAATGTA
ktn1
kinectin 1
Forward: CGGTGAATCTTAACCAGGATGTAG
134
60
Reverse: TGCTATCCTCAGATCAGCGATT
sfrp4
secreted frizzled-related protein 4
Forward: GCTGAATCTATCTGCTGTTGGG
136
60
Reverse: CTAACACTGTAAGCATATTTCTGGC
cdh1
cadherin 1
Forward:TGAGAAGCAGATACTGAGCATTGTG
122
60
Reverse: GCTCATCTTGGCCCCTTATCTC
eno2
enolase 2
Forward: GTGTGCGTGTGTGTAGGTGTATGT
113
60
Reverse: AGTGCTCAGAACGGAAGGAAGA
rps16
ribosomal protein S16
Forward: ACAAACTGCTTGAACCTGTCCTC
127
60
  Reverse: GCTTTGGAAATAGCTTGACGG  
Primers used for qPCR analysis

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

WX carried out the molecular genetic studies, sequence alignment, designed the study, performed the statistical analyses, and drafted the manuscript. P, R and JG extracted the total RNA. DR, SY, and DZ conceived the study, participated in its design and coordination, and helped draft the manuscript. JK, GB and HQ provided helpful discussion and advice. All authors read and approved the final manuscript.

Additional file 1

We identified 1630 transcripts as being differentially expressed in the growth plate on days 1, 2 and 6 with one way ANOVA. The 1C, 2C, and 6C designations refer to the control group on days 1, 2, and 6, respectively. The 1T, 2T, and 6T designations refer to the thiram-fed group on days 1, 2 and 6, respectively. We have listed 82 transcripts in sheet 1T vs. 1C, 1385 transcripts in sheet 2T vs. 2C, and 429 transcripts in sheet 6T vs. 6C. A FC (gene expression level following administration of the thiram-containing diet compared with the control) greater than 2.0 represents upregulation, while an FC less than or equal to 2.0 represents downregulation. Ajusted p value was computed by the false discovery rate (FDR) of approximately 5% using Partek GS 6.4. Click here for file

Additional file 2

We identified 1222 transcripts as being differentially expressed in the growth plate on days 1, 2 and 6 with two way ANOVA. The 1C, 2C, and 6C designations refer to the control group on days 1, 2, and 6, respectively. The 1T, 2T, and 6T designations refer to the thiram-fed group on days 1, 2 and 6, respectively. We have listed 39 transcripts in sheet 1T vs. 1C, 1086 transcripts in sheet 2T vs. 2C, and 279 transcripts in sheet 6T vs. 6C. A FC (gene expression level following administration of the thiram-containing diet compared with the control) greater than 2.0 represents upregulation, while an FC less than or equal to 2.0 represents downregulation. Ajusted p value was computed by the false discovery rate (FDR) of approximately 5% using Partek GS 6.4. Click here for file
  39 in total

1.  Toll-like receptor triggering of a vitamin D-mediated human antimicrobial response.

Authors:  Philip T Liu; Steffen Stenger; Huiying Li; Linda Wenzel; Belinda H Tan; Stephan R Krutzik; Maria Teresa Ochoa; Jürgen Schauber; Kent Wu; Christoph Meinken; Diane L Kamen; Manfred Wagner; Robert Bals; Andreas Steinmeyer; Ulrich Zügel; Richard L Gallo; David Eisenberg; Martin Hewison; Bruce W Hollis; John S Adams; Barry R Bloom; Robert L Modlin
Journal:  Science       Date:  2006-02-23       Impact factor: 47.728

2.  The relationship between the termination of cell proliferation and expression of heat-shock protein-25 in the rat developing tooth germ.

Authors:  Naohiro Nakasone; Hiromasa Yoshie; Hayato Ohshima
Journal:  Eur J Oral Sci       Date:  2006-08       Impact factor: 2.612

3.  An immunohistochemical study of the expression of heat-shock protein-25 and cell proliferation in the dental pulp and enamel organ during odontogenesis in rat molars.

Authors:  Naohiro Nakasone; Hiromasa Yoshie; Hayato Ohshima
Journal:  Arch Oral Biol       Date:  2005-11-02       Impact factor: 2.633

4.  Microarray analyses of gene expression during chondrocyte differentiation identifies novel regulators of hypertrophy.

Authors:  Claudine G James; C Thomas G Appleton; Veronica Ulici; T Michael Underhill; Frank Beier
Journal:  Mol Biol Cell       Date:  2005-08-31       Impact factor: 4.138

5.  Heat shock protein 25 plays multiple roles during mouse skin development.

Authors:  Olivier Duverger; Michel Morange
Journal:  Cell Stress Chaperones       Date:  2005       Impact factor: 3.667

6.  Pulpal responses to cavity preparation in aged rat molars.

Authors:  Eriko Kawagishi; Kuniko Nakakura-Ohshima; Shuichi Nomura; Hayato Ohshima
Journal:  Cell Tissue Res       Date:  2006-06-10       Impact factor: 5.249

7.  Kinectin-dependent assembly of translation elongation factor-1 complex on endoplasmic reticulum regulates protein synthesis.

Authors:  Lee-Lee Ong; Pao-Chun Lin; Xin Zhang; Ser-Mien Chia; Hanry Yu
Journal:  J Biol Chem       Date:  2006-09-01       Impact factor: 5.157

Review 8.  Lysyl oxidase: an oxidative enzyme and effector of cell function.

Authors:  H A Lucero; H M Kagan
Journal:  Cell Mol Life Sci       Date:  2006-10       Impact factor: 9.261

9.  Secreted frizzled-related protein 4 is a negative regulator of peak BMD in SAMP6 mice.

Authors:  Rika Nakanishi; Motoyuki Shimizu; Masayuki Mori; Haruhiko Akiyama; Shuzo Okudaira; Bungo Otsuki; Maiko Hashimoto; Keiichi Higuchi; Masanori Hosokawa; Tadao Tsuboyama; Takashi Nakamura
Journal:  J Bone Miner Res       Date:  2006-11       Impact factor: 6.741

10.  Phosphatidylinositol 3-kinase/Akt plays a role in sphingosine 1-phosphate-stimulated HSP27 induction in osteoblasts.

Authors:  Shinji Takai; Haruhiko Tokuda; Rie Matsushima-Nishiwaki; Yoshiteru Hanai; Kanefusa Kato; Osamu Kozawa
Journal:  J Cell Biochem       Date:  2006-08-01       Impact factor: 4.429

View more
  13 in total

1.  Icariin Ameliorate Thiram-Induced Tibial Dyschondroplasia via Regulation of WNT4 and VEGF Expression in Broiler Chickens.

Authors:  Hui Zhang; Khalid Mehmood; Kun Li; Mujeeb U Rehman; Xiong Jiang; Shucheng Huang; Lei Wang; Lihong Zhang; Xiaole Tong; Fazul Nabi; Wangyuan Yao; Muhammad K Iqbal; Muhammad Shahzad; Jiakui Li
Journal:  Front Pharmacol       Date:  2018-02-23       Impact factor: 5.810

2.  Icariin: a Potential Compound for the Recovery of Tibial Dyschondroplasia Affected Chicken Via Up-Regulating BMP-2 Expression.

Authors:  Mujahid Iqbal; Hui Zhang; Khalid Mehmood; Aoyun Li; Xiong Jiang; Yaping Wang; Jialu Zhang; Muhammad Kashif Iqbal; Mujeeb Ur Rehman; Wangyuan Yao; Shijin Yang; Jiakui Li
Journal:  Biol Proced Online       Date:  2018-07-01       Impact factor: 3.244

3.  Plastrum Testudinis Extract Mitigates Thiram Toxicity in Broilers via Regulating PI3K/AKT Signaling.

Authors:  Hammad Qamar; Muhammad Waqas; Aoyun Li; Mudassar Iqbal; Khalid Mehmood; Jiakui Li
Journal:  Biomolecules       Date:  2019-11-26

4.  Effect of Icariin on Tibial Dyschondroplasia Incidence and Tibial Characteristics by Regulating P2RX7 in Chickens.

Authors:  Hui Zhang; Khalid Mehmood; Xiong Jiang; Wangyuan Yao; Mujahid Iqbal; Kun Li; Xiaole Tong; Lei Wang; Meng Wang; Lihong Zhang; Fazul Nabi; Mujeeb Ur Rehman; Jiakui Li
Journal:  Biomed Res Int       Date:  2018-03-20       Impact factor: 3.411

5.  Effect of tetramethylpyrazine on tibial dyschondroplasia incidence, tibial angiogenesis, performance and characteristics via HIF-1α/VEGF signaling pathway in chickens.

Authors:  Khalid Mehmood; Hui Zhang; Kun Li; Lei Wang; Mujeeb Ur Rehman; Fazul Nabi; Muhammad Kashif Iqbal; Houqiang Luo; Muhammad Shahzad; Jiakui Li
Journal:  Sci Rep       Date:  2018-02-06       Impact factor: 4.379

6.  Effect of Total Flavonoids of Rhizoma drynariae on Tibial Dyschondroplasia by Regulating BMP-2 and Runx2 Expression in Chickens.

Authors:  Wangyuan Yao; Hui Zhang; Xiong Jiang; Khalid Mehmood; Mujahid Iqbal; Aoyun Li; Jialu Zhang; Yaping Wang; Muhammad Waqas; Yaoqin Shen; Jiakui Li
Journal:  Front Pharmacol       Date:  2018-11-02       Impact factor: 5.810

7.  Genome-Wide Analysis of circular RNAs and validation of hsa_circ_0006719 as a potential novel diagnostic biomarker in congenital scoliosis patients.

Authors:  Gang Liu; Jianxiong Shen; Chong Chen; Yang Jiao; Zheng Li; Haining Tan; Youxi Lin; Tianhua Rong
Journal:  J Cell Mol Med       Date:  2020-05-12       Impact factor: 5.310

8.  Transcriptome-based screening of intracellular pathways and angiogenesis related genes at different stages of thiram induced tibial lesions in broiler chickens.

Authors:  Ali Raza Jahejo; Ding Zhang; Sheng Niu; Raza Ali Mangi; Afrasyab Khan; Muhammad Farhan Qadir; Ajab Khan; Huan-Chun Chen; Wen-Xia Tian
Journal:  BMC Genomics       Date:  2020-01-15       Impact factor: 3.969

Review 9.  Treatment of tibial dyschondroplasia with traditional Chinese medicines: "Lesson and future directions".

Authors:  Hui Zhang; Yajing Wang; Khalid Mehmood; Yung-Fu Chang; Zhaoxin Tang; Ying Li
Journal:  Poult Sci       Date:  2020-09-08       Impact factor: 3.352

10.  Dietary supplementation with glycosaminoglycans reduces locomotor problems in broiler chickens.

Authors:  Julyana M S Martins; Lindolfo D Dos Santos Neto; Raiana A Noleto-Mendonça; Genilson B de Carvalho; Sarah Sgavioli; Fabyola Barros de Carvalho; Nadja S M Leandro; Marcos B Café
Journal:  Poult Sci       Date:  2020-10-06       Impact factor: 3.352

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.