Literature DB >> 23595982

Evolution and expression of BMP genes in flies.

Karl R Wotton1, Anna Alcaine Colet, Johannes Jaeger, Eva Jimenez-Guri.   

Abstract

Bone morphogenetic proteins (BMPs) play key roles in development. In Drosophila melanogaster, there are three BMP-encoding genes: decapentaplegic (dpp), glass bottom boat (gbb) and screw (scw). dpp and gbb are found in all groups of insects. In contrast, the origin of scw via duplication of an ancestral gbb homologue is more recent, with new evidence placing it within the Diptera. Recent studies show that scw appeared basal to the Schizophora, since scw orthologues exist in aschizan cyclorrhaphan flies. In order to further localise the origin of scw, we have utilised new genomic resources for the nematoceran moth midge Clogmia albipunctata (Psychodidae). We identified the BMP subclass members dpp and gbb from an early embryonic transcriptome and show that their expression patterns in the blastoderm differ considerably from those seen in cyclorrhaphan flies. Further searches of the genome of C. albipunctata were unable to identify a scw-like gbb duplicate, but confirm the presence of dpp and gbb. Our phylogenetic analysis shows these to be clear orthologues of dpp and gbb from other non-cyclorrhaphan insects, with C. albipunctata gbb branching ancestrally to the cyclorrhaphan gbb/scw split. Furthermore, our analysis suggests that scw is absent from all Nematocera, including the Bibionomorpha. We conclude that the gbb/scw duplication occurred between the separation of the lineage leading to Brachycera and the origin of cyclorrhaphan flies 200-150 Ma ago.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 23595982      PMCID: PMC3744649          DOI: 10.1007/s00427-013-0445-9

Source DB:  PubMed          Journal:  Dev Genes Evol        ISSN: 0949-944X            Impact factor:   0.900


Introduction

Signalling molecules belonging to the transforming growth factor β (TGFβ) group perform key roles in morphological and physiological processes in all metazoan phyla. They have been variously referred to as a superfamily or family depending on the author (Newfeld et al. 1999; Van der Zee et al. 2008). Here, we follow a commonly accepted evolutionary definition of family as a set of genes derived from a single gene present in the common ancestor of the bilaterians. Under this classification, we consider the TGFβ grouping as a class formed of two subclasses: bone morphogenetic proteins (BMPs) and the activin/TGFβ subclass (Newfeld et al. 1999). In Drosophila melanogaster, there are two known families of BMP-encoding genes: decapentaplegic (dpp)—a member of the vertebrate BMP2/4 family—as well as glass bottom boat (gbb) and screw (scw)—members of the BMP5/6/7/8 family (Van der Zee et al. 2008). Dpp plays multiple roles in Drosophila development. One of them is its key role in dorso-ventral (DV) patterning during early embryogenesis (Irish and Gelbart 1987). Scw co-operates with Dpp in this process (Arora et al. 1994). Gbb has several roles at later embryonic stages, as well as in larval and pupal development (Doctor et al. 1992; reviewed in O'Connor et al. 2006). It is weakly expressed at early stages and is not involved in DV patterning. It has been proposed that this temporal distinction might separate otherwise functionally redundant proteins (Fritsch et al. 2010). Several studies have focused on the evolution of BMP-encoding genes in dipterans and other insects (Van der Zee et al. 2008; Fritsch et al. 2010; Lemke et al. 2011). While dpp (BMP2/4) is found in all groups studied so far, there are differences in the number and types of gbb-like genes (BMP5/6/7/8; see Fig. 1, for an overview of the species discussed in the text). The evidence suggests that gbb has undergone multiple duplications in the arthropod lineage, one of which gave rise to scw in the lineage leading to cyclorrhaphan Brachycera (including D. melanogaster; Fritsch et al. 2010). The mosquitoes Anopheles gambiae, Aedes aegypti and Culex pipiens (Culicomorpha) also have two closely related gbb genes, but these duplications appear to have occurred independently in the mosquito lineage (Fritsch et al. 2010). A similar situation applies to the flour beetle Tribolium castaneum (Coleoptera) with its two copies of gbb (gbb1 and gbb2), which show distinct expression patterns, but are more closely related to each other than to any other gbb (Van der Zee et al. 2008). Finally, the jewel wasp Nasonia vitripennis (Hymenoptera) also exhibits two gbb-related genes, again more closely related to each other than to any other gbb duplicates. Arthropod species outside the holometabolan insects—such as the water flea Daphnia pulex (Crustacea), the human louse Pediculus humanus (Phthiraptera) and the pea aphid Acyrthosiphon pisum (Hemiptera)—have only one copy of gbb (Fritsch et al. 2010). According to this evidence, arthropods exhibit an ‘ancestral’ gbb (or gbb1) with high sequence conservation across lineages, and a second gbb-like gene in some groups (gbb2 or scw), which arose by independent duplication events. It would be interesting to investigate whether the origin of the scw duplication can be located more precisely within the dipteran lineage.
Fig. 1

Schematic tree of organisms discussed in the text. The relationships of the class Insecta are shown including the orders Phthiraptera, Hemiptera, Hymenoptera, Coleoptera and Diptera. The Diptera are traditionally classified into two suborders, the monophyletic Brachycera and an assemblage of basally branching lineages, the Nematocera. The Nematocera include the infraorders Tipulomorpha (not shown), Culicomorpha, Psychodomorpha and Bibionomorpha. The Bibionomorpha are the likely sister group to the Brachycera and together they form the Neodiptera, whose sister group in turn is likely to be the Psychodomorpha. The Brachycera are classified into the infraorders Cyclorrhapha and the basally branching lineages of the non-cyclorrhaphan Brachycera. These include the more closely related infraorders of Asiloidea, Stratiomyomorpha and Tabanomorpha and the likely sister group of the Cyclorrhapha, the Empidoidea. The Cyclorrhapha are in turn divided into the Schizophora with the basally branching lineages of the Cyclorrhapha forming the paraphyletic assemblage of the Aschiza. Previous studies have confirmed the presence of gbb and scw in the Cyclorrhapha (bold lines) indicating the gbb/scw duplication occurred somewhere between the origin of this lineage and the splitting of the Psychodomorpha

Schematic tree of organisms discussed in the text. The relationships of the class Insecta are shown including the orders Phthiraptera, Hemiptera, Hymenoptera, Coleoptera and Diptera. The Diptera are traditionally classified into two suborders, the monophyletic Brachycera and an assemblage of basally branching lineages, the Nematocera. The Nematocera include the infraorders Tipulomorpha (not shown), Culicomorpha, Psychodomorpha and Bibionomorpha. The Bibionomorpha are the likely sister group to the Brachycera and together they form the Neodiptera, whose sister group in turn is likely to be the Psychodomorpha. The Brachycera are classified into the infraorders Cyclorrhapha and the basally branching lineages of the non-cyclorrhaphan Brachycera. These include the more closely related infraorders of Asiloidea, Stratiomyomorpha and Tabanomorpha and the likely sister group of the Cyclorrhapha, the Empidoidea. The Cyclorrhapha are in turn divided into the Schizophora with the basally branching lineages of the Cyclorrhapha forming the paraphyletic assemblage of the Aschiza. Previous studies have confirmed the presence of gbb and scw in the Cyclorrhapha (bold lines) indicating the gbb/scw duplication occurred somewhere between the origin of this lineage and the splitting of the Psychodomorpha Two recent studies have taken the first steps towards this aim. Aschizan cyclorrhaphan species, such as the hoverfly Episyrphus balteatus (Syrphidae), and the scuttle fly Megaselia abdita, have orthologs of dpp, gbb and scw, which show expression patterns similar to the ones in D. melanogaster (Lemke et al. 2011; Rafiqi et al. 2012). This allows us to place the duplication event giving rise to scw at the base of the cyclorrhaphan lineage. We wanted to further refine the time point of the gbb/scw duplication. No lineages outside the Cyclorrhapha have been shown to have a gbb duplicate identifiable as an orthologue of scw. Here, we describe the BMP gene complement of the moth midge Clogmia albipunctata (Psychodidae). Despite some recent controversy over the placement of Psychodidae (Wiegmann et al. 2011), they are likely to be a sister group of Neodiptera (Brachycera plus Bibionomorpha; Yeates and Wiegmann 1999; Jimenez-Guri et al. 2013). We have found one dpp and one gbb orthologue in C. albipunctata. Using phylogenetic analysis, we have been able to group C. albipunctata dpp and gbb with their orthologues in other lineages. We find that C. albipunctata dpp is a clear member of the dpp gene family, and C. albipunctata gbb branches ancestrally to the cyclorrhaphan gbb/scw split.

Materials and methods

Gene identification and cloning

We searched the early embryonic transcriptome of C. albipunctata (Jimenez-Guri et al. 2013; http://diptex.crg.es) by BLAST using dpp, gbb and scw sequences from D. melanogaster, M. abdita and E. balteatus (retrieved from GenBank). In addition, we searched a preliminary assembly of the C. albipunctata genome (our unpublished data) and the genome of the Hessian fly Mayetiola destructor (Cedidomyiidae, Bibionomorpha; see Fig. 1; genome version 1.0, Baylor College of Medicine Human Genome Sequencing Center: http://www.hgsc.bcm.tmc.edu/content/hessian-fly-genome-project) with these same sequences. PCR primers for C. albipunctata dpp and gbb were designed from transcriptome sequences (dpp-forward CAGTAGAAGGCGTCATAACC, dpp-reverse ACGGAAAAAGAGAGTGAAAAG; gbb-forward ATCTTTATGGCAAAAGGTCTG, gbb-reverse TTTTCGAGACAAAAGAAGAAC). Amplified sequences for C. albipunctata dpp and gbb have been deposited in GenBank (accession numbers KC810051 and KC810052). Fragments were cloned into the PCRII-TOPO vector (Invitrogen) and used to make DIG-labelled riboprobes for in situ hybridisation.

Whole mount in situ hybridisation

Wild-type C. albipunctata embryos were collected at blastoderm and post-gastrulation stages as described in García-Solache et al. (2010). Embryos were heat fixed using a protocol adapted from Rafiqi et al. (2011). In situ hybridisation was performed as described in Jimenez-Guri et al. (2013) and references therein.

Phylogenetic analysis

Protein sequences of D. melanogaster Dpp, Gbb and Scw were used to identify and collect homologous sequences using the BLAST algorithm available at NCBI (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The sequences were initially aligned using T-Coffee (Notredame et al. 2000). All subsequent steps (editing, re-alignment, substitution model prediction, phylogenetic analysis and tree visualisation) were carried out using the MEGA5 software (Tamura et al. 2011). Phylogenetic analyses were carried out using a maximum likelihood method and the JTT substitution model and MrBayes allowing model jumping (Huelsenbeck and Ronquist 2001; Ronquist and Huelsenbeck 2003). Online Resource 1 contains the amino acid alignment used for phylogenetic analysis in FASTA format.

Results and discussion

BMP subclass members in Clogmia include dpp and gbb, but not scw

The evidence described in the ‘Introduction’ section is consistent with the gbb/scw duplication occurring at the base of the Cyclorrhapha. However, it may have happened even earlier, at any time between the divergence of the culicomorph lineage and the emergence of the Cyclorrhapha (Fig. 1). In this study, we narrow the gap between mosquitoes and cyclorrhaphan flies by describing the BMP complement of the moth midge C. albipunctata (Psychodidae), a dipteran species whose lineage branches basally to the Brachycera, and thus Cyclorrhapha (Jimenez-Guri et al. 2013). We obtained putative BMP members from the transcriptome and genome of C. albipunctata and identified their relationships by reciprocal BLAST searches. We identified single putative orthologues of dpp and gbb/scw from an early embryonic transcriptome (Jimenez-Guri et al. 2013; Diptex database: http://diptex.crg.es, accession numbers comp946 and comp6316). Next, we searched a preliminary genome assembly for C. albipunctata (coverage >70×, scaffold N50 ∼242 kb; our unpublished data). We identified the same single copies of the putative dpp and gbb/scw orthologues. No additional gbb duplicate is present in the genome. At this point, we cannot rule out the possibility that C. albipunctata has lost a scw-like duplicate secondarily.

Phylogenetic reconstruction of BMP subclass members in flies

To test our initial classification of these sequences, and to investigate if gene loss played a role in BMP evolution, we carried out a phylogenetic analysis of the putative C. albipunctata dpp and gbb/scw sequences using maximum likelihood methods and Bayesian inference (see ‘Materials and methods’ section). Both approaches yield identical tree topologies (compare Fig. 2 with Online Resource 2). The alignment of the 192 residues used for this phylogenetic analysis can be found in Online Resource 1. Our analysis places C. albipunctata dpp and gbb/scw-like sequences into clades containing dpp and gbb from other lineages (Fig. 2). C. albipunctata dpp clusters with other dipteran dpp sequences, while C. albipunctata gbb branches outside of the cyclorrhaphan gbb/scw group but within the gbb sequences found in other arthropods. This strongly suggests an origin of scw after the psychodid lineage separated from the brachyceran lineage and argues against the possibility of secondary loss of scw in C. albipunctata. Moreover, gbb from the Hessian fly M. destructor (whose lineage, the Bibionomorpha, is the sister group to the Brachycera; see Fig. 1) also branches basally to the cyclorrhaphan gbb/scw group suggesting an origin of scw within the Brachycera.
Fig. 2

Phylogenetic analysis of C. albipunctata BMP sequences. The tree is rooted using anti-dorsalizing morphogenetic protein (admp) sequence from the chordate amphioxus (Branchiostoma). Previous analyses have suggested that admp belongs to a family within the BMPs outside of the BMP2/4 and BMP5678 families (Van der Zee et al. 2008). dpp sequences form one group with strong bootstrap support (98), with a second group consisting of gbb, and gbb duplicates, forming another strongly supported group (bootstrap, 100). Within the dpp group, C. albipunctata dpp branches with other dipteran sequences. The second C. albipunctata sequence branches basally to M. destructor gbb, and both branch basally to the cyclorrhaphan gbb/scw genes indicating that they did not take part in this duplication event

Phylogenetic analysis of C. albipunctata BMP sequences. The tree is rooted using anti-dorsalizing morphogenetic protein (admp) sequence from the chordate amphioxus (Branchiostoma). Previous analyses have suggested that admp belongs to a family within the BMPs outside of the BMP2/4 and BMP5678 families (Van der Zee et al. 2008). dpp sequences form one group with strong bootstrap support (98), with a second group consisting of gbb, and gbb duplicates, forming another strongly supported group (bootstrap, 100). Within the dpp group, C. albipunctata dpp branches with other dipteran sequences. The second C. albipunctata sequence branches basally to M. destructor gbb, and both branch basally to the cyclorrhaphan gbb/scw genes indicating that they did not take part in this duplication event

Expression patterns of dpp and gbb in C. albipunctata

We visualised the expression patterns of C. albipunctata dpp and gbb during early embryonic development using in situ hybridisation (Fig. 3). C. albipunctata dpp is initially expressed at the blastoderm stage (Fig. 3(a, a′)) and expression persists after gastrulation (Fig. 3(b, b′)). This temporal pattern is similar to that seen in other dipteran species (see St. Johnston and Gelbart 1987; Rafiqi et al. 2012). However, the early spatial expression pattern is very different: instead of a continuous dorsal domain as in D. melanogaster or M. abdita, or a discontinuous dorsal domain to the exclusion of the presumptive serosa as in A. gambiae (Goltsev et al. 2007), C. albipunctata dpp is expressed at the anterior and posterior end of the ventral blastoderm (Fig. 3a). This pattern is very surprising, since ventral dpp expression has not yet been reported in any protostome species. Its implications for DV patterning in C. albipunctata will be analysed and reported elsewhere. Later, in the elongating germ band embryo, C. albipunctata dpp expression pattern is equivalent to that of D. melanogaster or M. abdita (Fig. 3(b, b′)).
Fig. 3

In situ hybridisation of BMP transcripts from C. albipunctata. Expression patterns for C. albipunctata dpp (a, a′, b, b′) and gbb (c, c′, d, d′) genes at blastoderm (a, a′, c, c′) and extended germ band stages (b, b′, d, d′). Lateral (a, b, c, d) and ventral (a′, b′, c′, d′) views are shown. Anterior is to the left. See text for a detailed description of expression patterns

In situ hybridisation of BMP transcripts from C. albipunctata. Expression patterns for C. albipunctata dpp (a, a′, b, b′) and gbb (c, c′, d, d′) genes at blastoderm (a, a′, c, c′) and extended germ band stages (b, b′, d, d′). Lateral (a, b, c, d) and ventral (a′, b′, c′, d′) views are shown. Anterior is to the left. See text for a detailed description of expression patterns In the early blastoderm, C. albipunctata gbb is detected in a very broad central domain, which only excludes two small terminal regions at the poles of the embryo (Fig. 3(c, c′)). This pattern also differs from the expression seen in D. melanogaster, where gbb is not detected before gastrulation (Doctor et al. 1992), or M. abdita, where expression is detected only in the dorsal blastoderm, although it is also excluded from the pole regions (Rafiqi et al. 2012). Similar to the expression in M. abdita and D. melanogaster, we detect C. albipunctata gbb transcript at high levels in a complex, segmentally repeated pattern after gastrulation (Fig. 3(d, d′)). In conclusion, we identified only two members of the BMP subclass of genes in the psychodid moth midge C. albipunctata: one orthologue of dpp and one gene related to gbb. Their expression patterns at blastoderm stage differ significantly from those seen in Cyclorrapha, while expression during germ band extension is equivalent in both groups. No scw-like gbb duplicate could be identified from the early embryonic transcriptome, or the genome of C. albipunctata, and no such duplicate is present in the genome of the Hessian fly (Bibionomorpha) either. Therefore, our phylogenetic analysis suggests that the gbb/scw duplication occurred within the Brachycera. Further research in non-cyclorrhaphan Brachycera (Empidoidea, Asiloidea, Stratiomyomorpha and Tabanomorpha; Wiegmann et al. 2011; see also Fig. 1) will be required to localise the precise origin of scw within the basal branches of the Brachycera. Below is the link to the electronic supplementary material. Amino acid alignment used for phylogenetic analysis (FASTA format) (PDF 27 kb) Bayesian phylogenetic analysis of BMP sequences (PDF 5,563 kb)
  20 in total

1.  T-Coffee: A novel method for fast and accurate multiple sequence alignment.

Authors:  C Notredame; D G Higgins; J Heringa
Journal:  J Mol Biol       Date:  2000-09-08       Impact factor: 5.469

2.  Molecular evolution of a developmental pathway: phylogenetic analyses of transforming growth factor-beta family ligands, receptors and Smad signal transducers.

Authors:  S J Newfeld; R G Wisotzkey; S Kumar
Journal:  Genetics       Date:  1999-06       Impact factor: 4.562

3.  MrBayes 3: Bayesian phylogenetic inference under mixed models.

Authors:  Fredrik Ronquist; John P Huelsenbeck
Journal:  Bioinformatics       Date:  2003-08-12       Impact factor: 6.937

4.  Congruence and controversy: toward a higher-level phylogeny of Diptera.

Authors:  D K Yeates; B M Wiegmann
Journal:  Annu Rev Entomol       Date:  1999       Impact factor: 19.686

5.  Megaselia abdita: fixing and devitellinizing embryos.

Authors:  Ab Matteen Rafiqi; Steffen Lemke; Urs Schmidt-Ott
Journal:  Cold Spring Harb Protoc       Date:  2011-04-01

6.  Rapid evolution of a novel signalling mechanism by concerted duplication and divergence of a BMP ligand and its extracellular modulators.

Authors:  Cornelia Fritsch; Robert Lanfear; Robert P Ray
Journal:  Dev Genes Evol       Date:  2010-11-18       Impact factor: 0.900

7.  Episodic radiations in the fly tree of life.

Authors:  Brian M Wiegmann; Michelle D Trautwein; Isaac S Winkler; Norman B Barr; Jung-Wook Kim; Christine Lambkin; Matthew A Bertone; Brian K Cassel; Keith M Bayless; Alysha M Heimberg; Benjamin M Wheeler; Kevin J Peterson; Thomas Pape; Bradley J Sinclair; Jeffrey H Skevington; Vladimir Blagoderov; Jason Caravas; Sujatha Narayanan Kutty; Urs Schmidt-Ott; Gail E Kampmeier; F Christian Thompson; David A Grimaldi; Andrew T Beckenbach; Gregory W Courtney; Markus Friedrich; Rudolf Meier; David K Yeates
Journal:  Proc Natl Acad Sci U S A       Date:  2011-03-14       Impact factor: 11.205

8.  Evolution of the dorsal-ventral patterning network in the mosquito, Anopheles gambiae.

Authors:  Yury Goltsev; Naoyuki Fuse; Manfred Frasch; Robert P Zinzen; Gregory Lanzaro; Mike Levine
Journal:  Development       Date:  2007-05-23       Impact factor: 6.868

9.  TGFbeta signaling in Tribolium: vertebrate-like components in a beetle.

Authors:  Maurijn Van der Zee; Rodrigo Nunes da Fonseca; Siegfried Roth
Journal:  Dev Genes Evol       Date:  2008-04-08       Impact factor: 0.900

10.  The decapentaplegic gene is required for dorsal-ventral patterning of the Drosophila embryo.

Authors:  V F Irish; W M Gelbart
Journal:  Genes Dev       Date:  1987-10       Impact factor: 11.361

View more
  4 in total

1.  A staging scheme for the development of the moth midge Clogmia albipunctata.

Authors:  Eva Jiménez-Guri; Karl R Wotton; Brenda Gavilán; Johannes Jaeger
Journal:  PLoS One       Date:  2014-01-07       Impact factor: 3.240

2.  SuperFly: a comparative database for quantified spatio-temporal gene expression patterns in early dipteran embryos.

Authors:  Damjan Cicin-Sain; Antonio Hermoso Pulido; Anton Crombach; Karl R Wotton; Eva Jiménez-Guri; Jean-François Taly; Guglielmo Roma; Johannes Jaeger
Journal:  Nucleic Acids Res       Date:  2014-11-17       Impact factor: 16.971

3.  Components of the dorsal-ventral pathway also contribute to anterior-posterior patterning in honeybee embryos (Apis mellifera).

Authors:  Megan J Wilson; Nathan J Kenny; Peter K Dearden
Journal:  Evodevo       Date:  2014-03-12       Impact factor: 2.250

4.  Non-canonical dorsoventral patterning in the moth midge Clogmia albipunctata.

Authors:  Karl R Wotton; Anna Alcaine-Colet; Johannes Jaeger; Eva Jiménez-Guri
Journal:  Evodevo       Date:  2017-11-13       Impact factor: 2.250

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.