Literature DB >> 23573243

Novel DNA variants and mutation frequencies of hMLH1 and hMSH2 genes in colorectal cancer in the Northeast China population.

Fulan Hu1, Dandan Li, Yibaina Wang, Xiaoping Yao, Wencui Zhang, Jing Liang, Chunqing Lin, Jiaojiao Ren, Lin Zhu, Zhiwei Wu, Shuying Li, Ye Li, Xiaojuan Zhao, Binbin Cui, Xinshu Dong, Suli Tian, Yashuang Zhao.   

Abstract

Research on hMLH1 and hMSH2 mutations tend to focus on Lynch syndrome (LS) and LS-like colorectal cancer (CRC). No studies to date have assessed the role of hMLH1 and hMSH2 genes in mass sporadic CRC (without preselection by MSI or early age of onset). We aimed to identify novel hMLH1 and hMSH2 DNA variants, to determine the mutation frequencies and sites in both sporadic and LS CRC and their relationships with clinicopathological characteristics of CRC in Northeast of China. 452 sporadic and 21 LS CRC patients were screened for germline and somatic mutations in hMLH1 and hMSH2 genes with PCR-SSCP sequencing. We identified 11 hMLH1 and seven hMSH2 DNA variants in our study cohort. Six of them were novel: four in hMLH1 gene (IVS8-16 A>T, c.644 GAT>GTT, c.1529 CAG>CGG and c.1831 ATT>TTT) and two in hMSH2 gene (-39 C>T, insertion AACAACA at c.1127 and deletion AAG at c.1129). In sporadic CRC, germline and somatic mutation frequencies of hMLH1/hMSH2 gene were 15.59% and 17.54%, respectively (p = 0.52). Germline mutations present in hMLH1 and hMSH2 genes were 5.28% and 10.78%, respectively (p<0.01). Somatic mutations in hMLH1 and hMSH2 genes were 6.73% and 11.70%, respectively (p = 0.02). In LS CRC, both germline and somatic mutation frequencies of hMLH1/hMSH2 gene were 28.57%. The most prevalent germline mutation site in hMSH2 gene was c.1168 CTT>TTT (3.90%), a polymorphism. Somatic mutation frequency of hMLH1/hMSH2 gene was significantly different in proximal, distal colon and rectal cancer (p = 0.03). Our findings elucidate the mutation spectrum and frequency of hMLH1 and hMSH2 genes in sporadic and LS CRC, and their relationships with clinicopathological characteristics of CRC.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 23573243      PMCID: PMC3616036          DOI: 10.1371/journal.pone.0060233

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Colorectal cancer (CRC) is one of the most common malignancies globally, and ranks the fifth of all cancers in China. World Health Organization estimates that 220,000 new CRC cases occurred in China in 2008 (GLOBOCAN, 2008). The incidence of CRC has increased by 5.73% on a yearly basis between 1992 to 2005 (13.06 to 23.54/10,0000) in Nangang District, Harbin, China [1]. One of the genetic pathways in the development of CRC is the failure of DNA mismatch repair (MMR) system [2], which contributes to the maintenance of genomic stability by recognizing and removing insertion/deletion mutations that occur during DNA replication [3]. The two main mismatch repair genes are hMLH1 and hMSH2, which map to chromosomes 3p21.3–23 [4] and 2p21–22 [5], respectively. Since the first report of hMLH1 and hMSH2 gene mutations in Lynch syndrome (LS) CRC [4], [5], studies on hMLH1 and hMSH2 gene mutations have been published. However, the majority of the published papers focused on LS or LS-like CRC. In total, 30 small-sample size (n = 5–61, except for one of 315 patients) studies have been published that screened germline mutations in hMLH1 and hMSH2 genes in sporadic CRC. Pathological mutations of hMLH1 and hMSH2 genes were more likely to be present in younger patients [6], and in those with microsatellite instability (MSI). In our analysis of these 30 studies, MSI or early-age onset (under the age of 40, 45, 50 or 55 years) was used to preselect patients for hMLH1 and hMSH2 gene mutations in sporadic CRC. However, no study aimed to detect mutation frequencies of hMLH1 and hMSH2 genes in mass sporadic CRC without MSI or age preselection. In China, four studies (n = 26–58) screened germline or somatic mutations of hMLH1 and hMSH2 genes in sporadic CRC with preselection by MSI [7], [8], [9], [10]. Whether high frequencies of hMLH1 and hMSH2 gene mutations occur in sporadic CRC in China has not been elucidated. Moreover, strong evidence suggests that rare mutations of severe effect are responsible for a substantial portion of complex human cancer [11]. We therefore conducted this study to identify novel hMLH1 and hMSH2 DNA variants, to determine both the mutation frequencies and sites in both sporadic and LS CRC, and to estimate the relationships between germline and somatic mutations of hMLH1/hMSH2 gene and clinicopathological characteristics of CRC in Northeast China.

Materials and Methods

Subjects

After obtaining informed consent from study subjects, and approval from Institutional Research Board of Harbin Medical University, we identified CRC patients who underwent surgery at the Cancer Hospital and the Second Affiliated Hospital of Harbin Medical University, without preselection and based on pathologic diagnosis alone. Patients with neuroendocrine carcinoma, malignant melanoma, non-Hodgkin’s lymphoma, gastrointestinal stromal tumors, and metastatic colorectal carcinoma were excluded from the analysis. From June 1, 2004 to May 15, 2005, and May 15, 2007 to January 1, 2008, 473 primary CRC patients (452 sporadic CRC; 21 LS CRC) were recruited. 457 blood samples and 356 tumor tissues were collected for molecular genetic analysis.

DNA Extraction

DNA was successfully extracted from all 457 blood samples (436 sporadic CRC and 21 LS CRC) and 356 tumor tissues (342 sporadic and 14 LS) using the classical phenol-chloroform procedure [12]. In the collection of blood and tissue samples and DNA extraction, we could not obtain the tumor tissue DNA of 117 CRC patients (110 sporadic and 7 LS) due to that the tumor tissues were only big enough for pathology diagnosis or that we did not extract DNA successfully. Therefore, we only have their blood DNA. In the other 16 sporadic CRC patients, we obtained paired blood and tissue samples. However, in the DNA extraction, we did not extract DNA successfully from blood sample. Finally, 340 CRC patients (326 sporadic and 14 LS) have paired blood and tissue DNA.

Screening for Germline and Somatic Mutations of hMLH1 and hMSH2 Genes

PCR–SSCP sequencing analysis

The primers for 20 pairs of all 19 exons in the hMLH1 gene and 17 pairs of all 16 exons in the hMSH2 gene (Table 1), including exon-intron boundaries, were synthesized for genomic PCR. PCR amplifications were performed using the following protocol for 35 cycles: denaturation for 30 s at 95°C, annealing for 30 s at 54°C to 64°C, extension for 30 s at 72°C, followed by a final extension for 5 min at 72°C (ABI 9700). PCR products were identified by 1% agarose electrophoresis (Biowest Agarose, Gene Company Ltd).
Table 1

Primers for hMLH1 and hMSH2 genes.

Forwardoligonucleotide (5′–3′)Reverseoligonucleotide (5′–3′)Annealingtemperature(°C)Productsize(bp)
hMLH1
Exon 1 AGGCACTTCCGTTGAGCATC GTAGCCCTTAAGTGAGCCCG 60205
Exon 2 GTTTGATTTGCCAGTTTAGATG GTGCCCAGCAAATAATAGGTA 60265
Exon 3 CTCATCTTTTTGGTATCTAACAG TCTTTAGCTTACCTCACCTCG 62134
Exon 4 CTTTGGTGAGGTGACAGTGG GACAGGATTACTCTGAGACC 62222
Exon 5 ATTAGAGCAAGTTACTCAGATG TATTACCCTGAAAACTTAGAAGC 62173
Exon 6 GCTTTTGCCAGGACATCTTGG CAGAGACCCACTCCCAGATT 64199
Exon 7&8 AGGTATTCAGTACACAATGCAG TTATATAGGTTATCGACATACC 60303
Exon 9 CAGGAGGACCTCAAATGGACC GTTGATGAAGAGTAAGAAGATGC 62261
Exon 10 ACCTTTCTTCCTGGGGATGTGAT GTTCCTTGTGAGTCTTGGTTGAG 64278
Exon 11 GATCCTGAGGTTTTGACCACTG TGGATGAGAAGCGCCCTGACCT 62300
Exon 12A TACAGACTTTGCTACCAGGACT CTCTGTGACAATGGCCTGGG 64209
Exon 12B CTCTGTGACAATGGCCTGGG CAGAGGGCAAGTCAGGCAGAG 66303
Exon 13 GTTGCTTGCTCCTCCAAAATGC CTTGGCAGTTGAGGCCCTATG 64292
Exon 14 TTCTTTGCTTACTTGGTGTC TGGACCATTGTTGTAGTAGC 58272
Exon 15 GGGTAAGAGATTTTGTTAGACTG TACCGATAACCTGAGAACACC 60247
Exon 16 TCCTTCATGTTCTTGCTTCT GCTGTCACACCTCATCAAT 58201
Exon 17 GCCTGGGAAAGCACTGGAGA ACCGAAATGCTTAGTATCTGCT 64211
Exon 18 GTAGTCTGTGATCTCCGTT ATTGTATGAGGTCCTGTCC 56245
Exon 19A CAAACAGGGAGGCTTATGAC CGGAATACAGAGAAAGAAGAAC 64256
Exon 19B GCTTGCTAACCTGCCTGAT CAATCCACTGTGTATAAAGG 58208
hMSH2
Exon 1 CGGGAAACAGCTTAGTGGGT GGCCCCATGTACTTGATCAC 64272
Exon 2 TCTCGGGTATGTCTTTATCAGC CCTTATATGCCAAATACCAATC 60253
Exon 3 AGGCTTCTCCTGGCAATCTCT TTTCCCCATGTCTCCAGCAGT 66274
Exon 4 CTTATTCCTTTTCTCATAGTAG TCCATGTACCTGATTCTCC 60202
Exon 5 ATCCAGTGGTATAGAAATC CCTTTATAAGCTTCTTCAGT 56289
Exon 6 TGTTTTTCATGGCGTAGTAAGG TACCTCTCCTCTATTCTGTTCT 62209
Exon 7 TCAGATTGAATTTAGTGGAAGC TTCATGTTTTTCCAGAGCCTG 55203
Exon 8 GATGCTTGTTTATCTCAGTC CTGTCCACAAAGGTGCTAC 58313
Exon 9 CTGAATAACTTATGGATAGC TCCAACCTCCAATGACCCA 60279
Exon 10 TGGTAGTAGGTATTTATGG CATCATGTTAGAGCATTTAG 58263
Exon 11 TGTTTCATAGGATACTTTGG CCAGGTGACATTCAGAACATT 60235
Exon 12 CAGGCTATGTAGAACCAATGC CCACAAAGCCCAAAAACCAG 64278
Exon 13 TAGGCCCCAATATGGGAGGT AAGCAGTTTCCAACATTTCAGC 60198
Exon 14 ATTATGTGCTTCAGGTCTGC GTACATACCTTTCTTCACCTGAT 52270
Exon 15 ATGCTGTCCCCTCACGCTTC AGCACTTCTTTGCTGCTGGTTC 61198
Exon 16A TCAGGAGTTCCTGTCCAAGG TTACCTTCATTCCATTACTGGG 57181
Exon 16B TCCCAGTAATGGAATGAAGGT CACTGCGAAGAACTACAATGC 64211
PCR products were denatured at 98°C for 8 min and placed on ice. Electrophoresis was performed on 8% to 15% nondenaturing polyacrylamide gels. After electrophoresis, gels were stained with silver (Refined Chemical Plant, Shanghai, China). 15% of the samples were replicated in detecting mutations of every amplified PCR fragment in the PCR-SSCP analysis, with the concordance rate ranging from 99.1% to 100% for various amplified PCR fragments. PCR products showing abnormal mobility under SSCP analysis were sent to sequence using ABI3730XL. Sequencing results were analyzed for gene mutations with Chromas 2.22 software (Technelysium Pty. Ltd., QLD, Australia).

Assessment of Mutation Pathogenicity

For previously reported mutations, results of function verification were used to determine pathogenicity. If no function verification was reported, function prediction by any two of the PolyPhen/SIFT/MAPP-MMR results was used to determine their pathogenicity. For the novel DNA variants, the pathogenicity of base substitution in exons were predicted by PolyPhen program [13] and MAPP-MMR [14]. Base insertion, deletion and substitution in promoter, introns or 3′UTR were assessed by criteria to determine potential pathogenicity [15]. We also detected the novel DNA variants in 100 healthy controls to determine potential pathogenicity.

Statistical Analysis

Category and continuous variables were tested by the chi-square test and t test, respectively. All the statistical analyses were performed by SAS 9.1 (SAS Institute, Cary, NC, USA).

Results

Mutations

Mutations in hMLH1 gene

We identified 11 DNA variants in hMLH1 gene. IVS8-16 A>T, c.1831 ATT>TTT and c.1845_1847 deletion GAA were somatic DNA variants, other eight DNA variants were both germline and somatic variants. Four (IVS8-16 A>T, c.704 GAT>GTT, c.1529 CAG>CGG, c.1831 ATT>TTT) were novel DNA variants identified in sporadic CRC patients (Figure 1 and Table 2). All the four novel DNA variants were not detected in 100 healthy controls. c.1529 CAG>CGG was predicted to have no pathogeneity, the pathogeneity of other three novel DNA variants were uncertain. Seven mutations (−28 A>G, c.927 CCC>CCT, IVS13+14 G>A, IVS14-19 A>G, c.1742 CCG>CTG, c.1845_1847 deletion GAA and c.*35_*37 deletion CTT) were previously reported in the InSiGHT database [10], [16], [17], [18], [19], [20], [21]. c.1742 CCG>CTG and c.1845_1847 deletion GAA were reported to be pathologic mutations [21], [22].
Figure 1

Four novel DNA variants in hMLH1 gene.

Table 2

DNA variants found in hMLH1 and hMSH2 genes.

Mutation/locationNucleotide changeAmino acid changeMutation typePolyphen MAPP-MMR†† PathogeneityCharacteristics of patients carried novel DNA variant
Novel DNA variants
hMLH1/Intron 8IVS8-16 A>TUncertain51 years, ulcerated adenocarcinoma, moderately differentiation, Dukes B, tumor size: 6*4.5*1 cm3
hMLH1/Exon 9c.704 GAT>GTTp.Asp235ValMissense0.0526.710Uncertain56 years, protrude type adenocarcinoma, moderately differentiation, Dukes B, tumor size: 5*5*3 cm3
hMLH1/Exon 13c.1529 CAG>CGGp.Gln510ArgMissense0.0021.380No71 years, ulcerated and infiltrating adenocarcinoma, poorly differentiation, Dukes B, tumor size: 7*8*9 cm3
hMLH1/Exon 16c.1831 ATT>TTTp.Ile611PheMissense0.1252.680Uncertain51 years, ulcerated infiltrating adenocarcinoma, moderately differentiation, Dukes C, tumor size: 5*5*6 cm3
hMSH2/5′UTR−39 C>TUncertain
hMSH2/Exon 7* c.1127 ins AACAACA, c.1129 del AAGOut of frame insertion in codon376, In-framedeletion in codon377FrameshiftUncertainprotrude type myxo-adenocarcinoma, poorly-moderately differentiation, Dukes C, tumor size: 4*4*5 cm3
Previously reported mutations
hMLH1/5′UTR−28 A>GUnknown [45], [46]
hMLH1/Exon 11c.927 CCC>CCT p.Pro309ProSynonymousUnknown [19]
hMLH1/Intron 13IVS13+14 G>AUnknown [45]
hMLH1/Intron 14IVS14-19 A>GUnknown [47], [48]
hMLH1/Exon 16c.1742 CCG>CTGp.Pro581LeuMissenseReported pathogenicity[14], [21]
hMLH1/Exon 16c.1845_1847 del GAAIn-frame deletion in codon615_616No changeReported pathogenicity[10], [49]
hMLH1/3′ UTR *35_*37 del CTTUnknown [18], [50]
hMSH2/Exon 1c.23 ACG>ATGp.Thr8MetMissenseNo [14], [51]
hMSH2/Exon 3c.471 GGC>GGA p.Gly157GlySynonymousNo [27]
hMSH2/Exon 3c.505 ATA>GTAp.Ile169ValMissenseUnknown [14], [45]
hMSH2/Exon 7c.1168 CTT>TTTp.Leu390PheMissenseUnknown [8], [14]
hMSH2/Exon 12c.1886 CAA>CGAp.Gln629ArgMissenseNo [8], [45]

DNA variant found in the relapse tumor of a LS CRC patient.

The variants were detected in more than one patient, so we did not describe the characteristics of these patients.

If PolyPhen score >2.0 then the AA substitution is predicted to affect protein function.

If MAPP-MMR score >4.55 then the AA substitution is predicted to affect protein function.

DNA variant found in the relapse tumor of a LS CRC patient. The variants were detected in more than one patient, so we did not describe the characteristics of these patients. If PolyPhen score >2.0 then the AA substitution is predicted to affect protein function. If MAPP-MMR score >4.55 then the AA substitution is predicted to affect protein function. We also identified two polymorphisms. c.655 ATC>GTC was reported to be a common polymorphism in Caucasians [23], [24], [25], while c.1151 GTT>GAT was reported to be more common in Asian population [26]. Therefore, we did not categorize them as mutations in our study.

Mutations in hMSH2 gene

We identified seven hMSH2 DNA variants. Insertion AACAACA at c.1127 and deletion AAG at c.1129 was somatic DNA variants, other six DNA variants were both germline and somatic variants. Two DNA variants (−39 C>T, insertion AACAACA at c.1127 and deletion AAG at c.1129) were newly detected in this study (Figure 2 and Table 2). In screening the two novel DNA variants in 100 healthy controls, no variants were detected. The pathogenicity of the two DNA variants was uncertain. Five other mutations (c.23 ACG>ATG, c.471 GGC>GGA, c.505 ATA>GTA, c.1168 CTT>TTT and c.1886 CAA>CGA) were previously reported in the InSiGHT database [14], [27].
Figure 2

Two novel DNA variants in hMSH2 gene.

Two male patients carried somatic mutations in both hMLH1 and hMSH2 genes. Another male patient carried the c.1831 ATT>TTT mutation of the hMLH1 gene and the c.23 ACG>ATG mutation of the hMSH2 gene in both tumor tissues and blood.

Mutation Frequencies

Mutation frequencies in sporadic CRC patients

Among 436 sporadic CRC patients with available blood DNA, germline mutation frequencies of hMLH1 and hMSH2 genes were 5.28% (23/436) and 10.78% (47/436), respectively (p<0.01) (Table 3). Excluding the synonymous mutations (c.927 CCC>CCT in hMLH1 and c.471 GGC>GGA in hMSH2), the mutation frequencies in hMLH1 and hMSH2 genes were 4.59% (20/436) and 8.72% (38/436), respectively (p = 0.01). If the patient who carried two germline mutations was only counted once (one patient harbored both −39 C>T and c.23 ACG>ATG mutations in hMSH2 and the IVS13+14 G>A mutation of hMLH1; the other patient carried both c.1831 ATT>TTT mutation in hMLH1 and c.23 ACG>ATG in hMSH2); then 15.59% (68/436) patients exhibited germline mutations in hMLH1/hMSH2 gene. Pathologic mutation frequencies of hMLH1 and hMSH2 genes were 0.23% (1/436) and 0%, respectively.
Table 3

Mutation frequencies of hMLH1 and hMSH2 genes.

Mutation/locationSomatic mutation frequencyGermline mutation frequency
Sporadic CRCLS CRCSporadic CRCLS CRC
hMLH1
hMLH1/5′UTR07.14% (1/14)04.76% (1/21)
hMLH1/Intron 80.29% (1/342)
hMLH1/Exon 90.29% (1/342)00.23% (1/436)0
hMLH1/Exon 110.88% (3/342)00.69% (3/436)0
hMLH1/Intron 131.46% (5/342)01.38% (6/436)0
hMLH1/Intron 142.63% (9/342)02.52% (11/436)0
hMLH1/Exon 160.88% (3/342)00.23% (1/436)0
hMLH1/3′UTR0.29% (1/342)00.23% (1/436)0
Subtotal6.73% (23/342)7.14% (1/14)5.28% (23/436)4.76% (1/21)
hMSH2
hMSH2/5′UTR†† 0.58% (2/342)00.46% (2/436)0
hMSH2/Exon 12.63% (9/342)01.38% (6/436)0
hMSH2/Exon 31.75% (9/342)7.14% (1/14)2.06% (11/436)4.76% (1/21)
hMSH2/Exon 74.39% (15/342)7.14% (1/14)3.90% (17/436)14.29% (3/21)
hMSH2/Exon 121.46% (5/342)7.14% (1/14)2.52% (11/436)4.76% (1/21)
Subtotal11.70% (40/342)21.43% (3/14)10.78% (47/436)23.81% (5/21)
Total17.54% (60/342) 28.57% (4/14)15.59% (68/436) 28.57% (6/21)

The mutation was also found in another blood sample of LS relapsed CRC patient.

One patient carried both –39 C>T and c.23 ACG>ATG.

Three patients carried somatic mutations in both hMLH1 and hMSH2 genes; one patient carried germline mutations in both hMLH1 and hMSH2 genes.

The mutation was also found in another blood sample of LS relapsed CRC patient. One patient carried both –39 C>T and c.23 ACG>ATG. Three patients carried somatic mutations in both hMLH1 and hMSH2 genes; one patient carried germline mutations in both hMLH1 and hMSH2 genes. Among 342 sporadic CRC patients with available DNA in tumor tissues, the somatic mutation frequencies in hMLH1 and hMSH2 genes were 6.73% (23/342) and 11.70% (40/342), respectively (p = 0.02) (Table 3). Excluding synonymous mutations (c.927 CCC>CCT in hMLH1 and c.471 GGC>GGA in hMSH2), mutation frequencies of hMLH1 and hMSH2 genes were 5.85% (20/342) and 9.94% (34/342), respectively (p = 0.03). If mutations were counted by patients instead of the actual number of mutations (three patients carried somatic mutations of both hMLH1 and hMSH2 genes), then 17.54% (60/342) patients exhibited somatic mutations of hMLH1/hMSH2 gene. Pathological mutation frequencies of hMLH1 and hMSH2 genes were 0.58% (2/342) and 0%, respectively. Germline mutation frequency was not significantly different from that of somatic mutation frequency in hMLH1 and hMSH2 genes, respectively (p = 0.49 and p = 0.69, respectively).

Mutation frequencies in LS CRC patients

Among 21 blood DNA samples of LS CRC patients, one (4.76%) patient carried a germline mutation of hMLH1 and five (23.81%) patients carried germline mutations in hMSH2. Overall, six (28.57%) patients exhibited germline mutations of the hMLH1/hMSH2 gene. Tumor tissues were only available in 14 LS CRC patients, one (7.14%) patient carried a somatic mutation in hMLH1 and three (21.43%) patients carried a somatic mutation in hMSH2. In total, four (28.57%) patients exhibited somatic mutations in hMLH1/hMSH2 gene. No pathologic mutations were detected in LS CRC patients.

The Mutation Distribution in Different Exons

The highest germline mutation prevalence of hMSH2 in sporadic CRC was detected in exon 7 (3.90%), followed by exon 12 (2.52%), exon 1 (1.38%), and exon 3 (0.46%). Mutations in these four exons accounted for 76.6% of the total mutations in hMSH2. As far as the hMLH1, mutation frequencies were generally lower than in hMSH2; the highest mutation prevalences were in exon 16, exon 9, exon 13, and exon 19 (0.23%) (Table 3).

The Relationships between Germline and Somatic Mutations of hMLH1/hMSH2 Gene and Clinicopathological Characteristics of CRC

Somatic mutation frequency of hMLH1/hMSH2 gene was 22.7% (15/66) in proximal colon cancer, 17.7% (11/62) in distal colon cancer and 10.5% (22/209) in rectal cancer (p = 0.03). Whereas, germline mutation frequency of hMLH1/hMSH2 gene was not significantly different in proximal colon cancer (17.3%, 14/81), distal colon cancer (17.8%, 13/73) and rectal cancer (10.1%, 28/276) (p = 0.09). (Table 4 and 5).
Table 4

The relationships between germline mutation of hMLH1/hMSH2 gene and clinicopathological features of the 436 sporadic CRC patients.

No. of patients 436 (%)Germline mutated 56 (%)Wild type 380 (%) P value
Age(yr) at CRC diagnosis 0.59
Mean58.7211.3058.5511.5458.7211.27
0.98
<4027 (6.0)3 (5.4)23 (6.1)
40–60187 (43.0)24 (42.9)163 (43.0)
≥60222 (51.0)29 (51.8)193 (50.9)
Gender 0.21
Male262 (60.2)38 (67.9)224 (59.1)
Female173 (39.8)18 (32.1)155 (40.9)
BMI 0.13
< = 21107 (25.5)15 (27.8)92 (25.2)
>21 and< = 25182 (43.4)17 (31.5)165 (45.2)
>25130 (31.1)22 (40.7)108 (29.6)
Location 0.09
Proximal colon cancer81 (18.8)14 (25.5)67 (17.9)
Distal colon cancer73 (17.0)13 (23.6)60 (16.0)
Rectal cancer276 (64.2)28 (50.9)248 (66.1)
Dukes stage 0.72
146 (10.6)7 (12.5)39 (10.3)
2190 (43.8)23 (41.1)167 (44.2)
3161 (37.1)23 (41.1)138 (36.5)
437 (8.5)3 (5.4)34 (9.0)
0.90
1+2236 (54.4)30 (53.6)205 (54.5)
3+4198 (45.6)26 (46.4)172 (45.5)
Histotypes 0.52
Adenocarcinoma332 (76.3)46 (82.1)286 (75.5)
Mucinous adenocarcinoma78 (17.9)8 (14.3)70 (18.5)
Others25 (5.7)2 (3.6)23 (6.1)
Pathological types 0.83
Protrude type273 (66.4)33 (63.5)240 (66.9)
Ulceration type30 (7.3)4 (7.7)26 (7.2)
Ulceration+Infiltrating type94 (22.9)14 (26.9)80 (22.3)
Infiltrating type14 (3.4)1 (1.9)13 (3.6)
Differentiated degree 0.33
Poor74 (17.9)6 (18.9)68 (18.9)
Moderate335 (81.1)46 (86.8)289 (80.3)
Well4 (1.0)1 (1.9)3 (0.8)
Tumor size 0.38
< = 50186 (47.9)21 (41.2)165 (49.0)
50< and < = 200141 (36.3)23 (45.1)118 (35.0)
>20061 (15.7)7 (13.7)54 (16.0)
Table 5

The relationships between somatic mutation of hMLH1/hMSH2 gene and clinicopathological features of the 342 sporadic CRC patients.

No. of patients 342 (%)Germline mutated 50 (%)Wild type 380 (%) P value
Age(yr) at CRC diagnosis 0.22
Mean58.7911.2658.8612.0858.7511.15
0.98
<4020 (5.9)3 (6.0)17 (5.8)
40–60148 (43.4)21 (42.0)127 (43.6)
≥60173 (50.7)26 (52.0)147 (50.5)
Gender 0.22
Male205 (60.1)34 (68.0)171 (58.8)
Female136 (39.9)16 (32.0)120 (41.2)
BMI 0.63
< = 2186 (25.8)14 (29.2)72 (25.3)
>21 and< = 25146 (43.8)18 (37.5)128 (44.9)
>25101 (30.3)16 (33.3)85 (29.8)
Location 0.03
Proximal colon cancer66 (19.6)15 (31.2)51 (17.6)
Distal colon cancer62 (18.4)11 (22.9)51 (17.6)
Rectal cancer209 (62.0)22 (45.8)187 (64.7)
Dukes stage 0.94
133 (9.7)4 (8.0)29 (10.0)
2154 (45.4)22 (44.0)132 (45.7)
3131 (38.6)21 (42.0)110 (38.1)
421 (6.2)3 (6.0)18 (6.2)
0.63
1+2187 (55.2)26 (52.0)161 (55.7)
3+4152 (44.8)24 (48.0)128 (44.3)
Histotypes 0.97
Adenocarcinoma262 (76.8)39 (78.0)223 (76.6)
Mucinous adenocarcinoma66 (19.4)9 (18.0)57 (19.6)
Others13 (3.8)2 (4.0)11 (3.8)
Pathological types 0.93
Protrude type216 (67.3)31 (66.0)185 (67.5)
Ulceration type21 (6.5)4 (8.5)17 (6.2)
Ulceration+Infiltrating type75 (23.4)11 (23.4)64 (23.4)
Infiltrating type9 (2.8)1 (2.1)8 (2.9)
Differentiated degree 0.74
Poor54 (16.6)7 (15.2)47 (16.8)
Moderate268 (82.5)39 (84.8)229 (82.1)
Well3 (0.9)0 (0.0)3 (1.1)
Tumor size 0.10
< = 50132 (43.7)15 (32.6)117 (45.7)
50< and < = 200121 (40.1)25 (54.3)96 (37.5)
>20049 (16.2)6 (13.0)43 (16.8)
Germline and somatic mutation frequency of hMLH1/hMSH2 gene was not significantly different in other clinicopathological characteristics (age, gender, BMI, Dukes stage, Histotypes, Pathological types, Differentiated degree and tumor size) of CRC. Because of less LS CRC patients, we did not analyze the relationships between germline and somatic hMLH1/hMSH2 gene mutations and clinicopathological characteristics of LS CRC.

Discussion

Under the supposed model of common disease-rare variant [28], [29], we screened the rare variants of hMLH1 and hMSH2 genes in sporadic and LS CRC. We identified 18 types of DNA Variants in our study. Six were novel DNA variants and 12 have been previously reported. Of the six novel DNA variants, four were in hMLH1 and two in hMSH2. Two of the four novel hMLH1 DNA variants, p.Asp235 Val (c.644 GAT>GTT) and p.Gln510Arg (c.1529 CAG>CGG), both lead to amino acid polarity changes, which may affect the structure of the hMSH2 binding domain and hPMS2/hPMS1 binding domain of the hMLH1 gene respectively and cause the dysfunction of DNA MMR system. Another DNA variance, p.Ile611Phe (c.1831 ATT>TTT), lead to no amino acid polarity changes in the hPMS2/hPMS1 binding domain of the hMLH1 gene product, may have no effect on the function of DNA MMR system [30]. IVS8-16 A>T is predicted to have no effect on splicing in exon 9. One of the two novel hMSH2 DNA variants, −39 C>T, was a variance in 5′UTR, which may affect mRNA Transcription. The other variance, c.1127 ins AACAACA and c.1129 del AAG, was a frameshift mutation, which may affect the hMSH6 binding domain and hMutL homolog interaction of the hMSH2 gene product and cause the dysfunction in the DNA MMR system [30]. Although the failure of DNA MMR system is one of the genetic pathways in the development of CRC [2]. According to the criteria of mutation pathogeneity assessment, one novel DNA variant, c.1529 CAG>CGG, was predicted to have no pathogeneity, the pathogeneity of other five novel DNA variants were uncertain. Therefore, we cannot elucidate the role of these novel DNA variants of hMLH1 and hMSH2 genes in the occurrence and development of CRC. c.1742 CCG>CTG of hMLH1 and c.1886 CAA>CGA of hMSH2 were founder mutations in the Asian population [31]. Three other mutations of hMSH2, c.23 ACG>ATG, c.505 ATA>GTA and c.1168 CTT>TTT, were of higher prevalence in Asians (2.44%, 1.74%, and 6.97%, respectively) compared with Caucasians (0.05%, 0.05%, and 0.53%, respectively) [31]. It may explain the racial difference of CRC patients. In addition, it may be more efficient to detect these mutations in Asian populations. Since we detected a higher prevalence of c.1168 CTT>TTT of hMSH2 in both LS (14.29%, 3/21) and sporadic (3.90%, 17/436) CRC, we screened for the mutation in healthy controls. The mutation frequency in healthy controls was 4.16% (21/505), which was not significantly different comparing with CRC (p = 0.84). This particular mutation was also reported as a polymorphism in Korea by Kim et al, who did not detect a significant difference between cases and controls [26]. Significant association was only observed between somatic hMLH1/hMSH2 gene mutations and tumor location of sporadic CRC (p = 0.03). The somatic mutation frequency of hMLH1/hMSH2 gene was highest in rectal cancer, the following was in proximal colon cancer, and the lowest was in distal colon cancer. The non-pathogeneity or uncertain pathogeneity may explain the non-significant association between hMLH1/hMSH2 gene mutations and other clinicopathological characteristics of sporadic CRC. In our previous meta-analysis based on the germline mutations of hMLH1 and hMSH2 genes (paper accepted, 10.1371/journal.pone.0051240), the pooled pathologic mutation frequency of hMLH1 was 8.72% (95%CI: 6.12%–12.29%) in sporadic CRC. It was 10.28% (95% CI: 4.28–22.70%) in American studies, 7.47% (95% CI: 4.06–13.34%) in European studies, and 3.21% (95% CI: 0.88–11.03%) in Asian studies (p = 0.65). In our cohort, it was only 0.23%. The pooled pathologic mutation frequency of hMSH2 was 7.28% (95% CI: 5.12%–10.26%) in sporadic CRC. It was 5.89% (95% CI: 2.08–15.61%) in American studies, 7.58% (95% CI: 4.05–13.76%) in European studies, and 3.64% (95% CI: 1.96–6.65%) in Asian studies (p = 0.85). However, no pathologic mutation of hMSH2 was detected in our study. Eight [7], [9], [32], [33], [34], [35], [36], [37] and nine studies [7], [9], [32], [33], [34], [35], [36], [37], [38] in Asia detected somatic mutations of hMLH1 and hMSH2 genes in sporadic CRC. The pooled prevalence of pathologic mutations was 11.86% (95% CI: 7.62–18.01%) and 7.90% (95% CI: 4.72–12.94%) respectively upon meta-analysis, which is higher than that in our study (0.58% and 0%). All the published studies detected germline or somatic mutations in sporadic CRC with preselection (MSI, early-onset age, or TGF-β RII mutation) [36], which could explain the higher mutation frequency in the published individual studies and meta-analyses of previously published studies. In addition, the small sample size in those published studies may also contribute to the inconsistent results. Only one study in Asia detected somatic mutations of hMLH1 and hMSH2 genes in 31 sporadic CRC patients without preselection [37]. The largest study detecting germline mutations was of 315 European BG-CRC patients under the age of 55; the mutation frequency of hMSH2 was found to be 0.32% (1/325, uncertain pathogenicity), whereas no mutation in hMLH1 was detected [39]. In our previous meta-analysis, the pooled germline mutation frequencies of hMLH1 and hMSH2 genes were 28.55% (95% CI: 26.04%–31.19%) and 19.41% (95% CI: 15.88%–23.51%) in Amsterdam-criteria positive LS CRC. In Amsterdam-criteria negative LS CRC, these pooled mutation frequencies were 16.70% (95% CI: 14.53–19.13%) and 11.13% (95% CI: 9.49–13.42%) for hMLH1 and hMSH2 genes, respectively. In our study, no germline mutation in hMLH1 exons was found, similar to a study in Japan [40]. The germline mutation frequency of hMSH2 was 9.52% (2/21) (excluding the polymorphic mutation c.1168 CTT>TTT), which was relatively lower than that in the meta-analysis (11.13%, 95% CI: 9.49–13.42%). Five Asian studies detected the somatic mutation of hMLH1 or hMSH2 in LS CRC [7], [41], [42], [43], [44]. The pooled somatic mutation frequencies in hMLH1 and hMSH2 genes were 9.57% (95% CI: 1.36–44.73%) and 25.65% (95% CI: 10.30–50.89%), respectively upon meta-analysis. In our study, the somatic mutation frequency of hMSH2 in LS CRC was 14.29% (2/14) (excluding the polymorphic mutation, c.1168 CTT>TTT). However, no somatic mutations in hMLH1 exons were found in LS CRC, similar to the two Japanese studies [41], [43]. The somatic mutation frequency of hMSH2 in LS CRC varied from 5.88% to 58.33% in the five Asian published studies. A small sample size may explain the variances of mutation frequency in LS CRC. In conclusion, we identified six novel DNA variants (four in hMLH1 and two in hMSH2). In sporadic CRC, germline and somatic mutation frequencies of hMLH1/hMSH2 gene were 15.59% and 17.54%, respectively. The prevalence of germline mutations was 5.28% in hMLH1 and 10.78% in hMSH2. The somatic mutation frequencies in hMLH1 and hMSH2 genes were 6.43% and 11.70%, respectively. In LS CRC, both germline and somatic mutation frequencies of hMLH1/hMSH2 gene were 28.57%. The most prevalent germline mutation site in hMSH2 gene was c.1168 CTT>TTT (3.90%), a polymorphism. Somatic mutation frequency of hMLH1/hMSH2 gene was significantly different in proximal colon cancer, distal colon cancer and rectal cancer. Our findings could help to elucidate the DNA variant spectrum and frequency of the hMLH1 and hMSH2 genes in CRC patients, especially sporadic CRC patients in China, and their relationships with clinicopathological characteristics of sporadic CRC. Functional studies to determine how these novel DNA variants affect protein function are required.
  50 in total

1.  Racial differences in MLH1 and MSH2 mutation: an analysis of yellow race and white race based on the InSiGHT database.

Authors:  Wenqian Wei; Lei Liu; Jian Chen; Ke Jin; Fan Jiang; Fangqi Liu; Rong Fan; Zhe Cheng; Meng Shen; Chenyi Xue; Sanjun Cai; Ye Xu; Peng Nan
Journal:  J Bioinform Comput Biol       Date:  2010-12       Impact factor: 1.122

2.  Germline, somatic and epigenetic events underlying mismatch repair deficiency in colorectal and HNPCC-related cancers.

Authors:  Siu Tsan Yuen; Tsun Leung Chan; Judy W C Ho; Annie S Y Chan; Lap Ping Chung; Polly W Y Lam; Chun Wah Tse; Andrew H Wyllie; Suet Yi Leung
Journal:  Oncogene       Date:  2002-10-24       Impact factor: 9.867

3.  Identification of germline MLH1 alterations in familial prostate cancer.

Authors:  H Fredriksson; T Ikonen; V Autio; M P Matikainen; H J Helin; T L J Tammela; P A Koivisto; J Schleutker
Journal:  Eur J Cancer       Date:  2006-09-11       Impact factor: 9.162

4.  Predominant germ-line mutation of the hMSH2 gene in Japanese hereditary non-polyposis colorectal cancer kindreds.

Authors:  Y Q Bai; Y Akiyama; H Nagasaki; S L Lu; T Arai; T Morisaki; M Kitamura; A Muto; M Nagashima; T Nomizu; T Iwama; H Itoh; S Baba; T Iwai; Y Yuasa
Journal:  Int J Cancer       Date:  1999-08-12       Impact factor: 7.396

5.  Mutational analysis of MLH1 and MSH2 in 25 prospectively-acquired RER+ endometrial cancers.

Authors:  L D Kowalski; D G Mutch; T J Herzog; J S Rader; P J Goodfellow
Journal:  Genes Chromosomes Cancer       Date:  1997-03       Impact factor: 5.006

6.  Human non-synonymous SNPs: server and survey.

Authors:  Vasily Ramensky; Peer Bork; Shamil Sunyaev
Journal:  Nucleic Acids Res       Date:  2002-09-01       Impact factor: 16.971

7.  Recurring MLH1 deleterious mutations in unrelated Chinese Lynch syndrome families in Singapore.

Authors:  Hui-Ling Yap; Wei-Shieng Chieng; Jasmine Rui-Chen Lim; Robert Seng-Cheong Lim; Ross Soo; Jiayi Guo; Soo-Chin Lee
Journal:  Fam Cancer       Date:  2008-08-23       Impact factor: 2.375

8.  Genetic changes and histopathological types in colorectal tumors from patients with familial adenomatous polyposis.

Authors:  M Miyaki; M Seki; M Okamoto; A Yamanaka; Y Maeda; K Tanaka; R Kikuchi; T Iwama; T Ikeuchi; A Tonomura
Journal:  Cancer Res       Date:  1990-11-15       Impact factor: 12.701

9.  Oncogenic pathway of sporadic colorectal cancer with novel germline missense mutations in the hMSH2 gene.

Authors:  Kanae Yamada; Xiaoling Zhong; Shinsaku Kanazawa; Junichi Koike; Kazunori Tsujita; Hiromichi Hemmi
Journal:  Oncol Rep       Date:  2003 Jul-Aug       Impact factor: 3.906

10.  The association between genetic variants in hMLH1 and hMSH2 and the development of sporadic colorectal cancer in the Danish population.

Authors:  Lise Lotte Christensen; Bo E Madsen; Friedrik P Wikman; Carsten Wiuf; Karen Koed; Anne Tjønneland; Anja Olsen; Ann-Christine Syvänen; Claus L Andersen; Torben F Orntoft
Journal:  BMC Med Genet       Date:  2008-06-11       Impact factor: 2.103

View more
  9 in total

1.  Prognostic significance of hMLH1/hMSH2 gene mutations and hMLH1 promoter methylation in sporadic colorectal cancer.

Authors:  Yibaina Wang; Dandan Li; Xia Li; Chong Teng; Lin Zhu; Binbin Cui; Yashuang Zhao; Fulan Hu
Journal:  Med Oncol       Date:  2014-06-11       Impact factor: 3.064

2.  Clinical characterization and mutation spectrum in Caribbean Hispanic families with Lynch syndrome.

Authors:  Marcia Cruz-Correa; Yaritza Diaz-Algorri; Julyann Pérez-Mayoral; Wasilah Suleiman-Suleiman; Maria del Mar Gonzalez-Pons; Carlos Bertrán; Nicolás Casellas; Natalia Rodríguez; Sherly Pardo; Keyla Rivera; Rafael Mosquera; Segundo Rodriguez-Quilichini
Journal:  Fam Cancer       Date:  2015-09       Impact factor: 2.375

3.  Potential Functional Variants in DNA Repair Genes Are Associated with Efficacy and Toxicity of Radiotherapy in Patients with Non-Small-Cell Lung Cancer.

Authors:  Zhiguang Yang; Zhaoyu Liu
Journal:  J Oncol       Date:  2020-06-24       Impact factor: 4.375

4.  A pathway-centric survey of somatic mutations in Chinese patients with colorectal carcinomas.

Authors:  Chao Ling; Lin Wang; Zheng Wang; Luming Xu; Lifang Sun; Hui Yang; Wei-Dong Li; Kai Wang
Journal:  PLoS One       Date:  2015-01-24       Impact factor: 3.240

5.  Gly322Asp and Asn127Ser single nucleotide polymorphisms (SNPs) of hMSH2 mismatch repair gene and the risk of triple-negative breast cancer in Polish women.

Authors:  Beata Smolarz; Marianna Makowska; Dariusz Samulak; Magdalena M Michalska; Hanna Romanowicz
Journal:  Fam Cancer       Date:  2015-03       Impact factor: 2.375

6.  Polymorphism of DNA repair genes in breast cancer.

Authors:  Beata Smolarz; Magdalena M Michalska; Dariusz Samulak; Hanna Romanowicz; Luiza Wójcik
Journal:  Oncotarget       Date:  2019-01-11

7.  Polydatin, a natural precursor of resveratrol, induces cell cycle arrest and differentiation of human colorectal Caco-2 cell.

Authors:  Salvatore De Maria; Ilaria Scognamiglio; Angela Lombardi; Nicola Amodio; Michele Caraglia; Maria Cartenì; Gianpietro Ravagnan; Paola Stiuso
Journal:  J Transl Med       Date:  2013-10-20       Impact factor: 5.531

8.  Detection of three closely located single nucleotide polymorphisms in the EAAT2 promoter: comparison of single-strand conformational polymorphism (SSCP), pyrosequencing and Sanger sequencing.

Authors:  Shavanthi Rajatileka; Karen Luyt; Maggie Williams; David Harding; David Odd; Elek Molnár; Anikó Váradi
Journal:  BMC Genet       Date:  2014-07-05       Impact factor: 2.797

9.  Prevalence and spectrum of MLH1, MSH2, and MSH6 pathogenic germline variants in Pakistani colorectal cancer patients.

Authors:  Muhammad Usman Rashid; Humaira Naeemi; Noor Muhammad; Asif Loya; Jan Lubiński; Anna Jakubowska; Muhammed Aasim Yusuf
Journal:  Hered Cancer Clin Pract       Date:  2019-10-23       Impact factor: 2.857

  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.