Literature DB >> 23564079

Bcl-2-dependent upregulation of autophagy by sequestosome 1/p62 in vitro.

Liang Zhou1, Hong-feng Wang, Hai-gang Ren, Dong Chen, Feng Gao, Qing-song Hu, Chen Fu, Ran-jie Xu, Zheng Ying, Guang-hui Wang.   

Abstract

AIM: To investigate whether sequestosome 1/p62 (p62), a key cargo adaptor protein involved in both the ubiquitin-proteasome system and the autophagy-lysosome system, could directly regulate autophagy in vitro.
METHODS: HEK 293 cells or HeLa cells were transfected with p62-expressing plasmids or siRNA targeting p62. The cells or the cell lysates were subsequently subjected to immunofluorescence assay, immunoprecipitation assay, or immunoblot analysis. In vitro pulldown assay was used to study the interaction of p62 with Bcl-2.
RESULTS: Overexpression of p62 significantly increased the basal level of autophagy in both HEK 293 cells and HeLa cells, whereas knockdown of p62 significantly decreased the basal level of autophagy. In vitro pulldown assay showed that p62 directly interacted with Bcl-2. It was observed in HeLa cells that p62 co-localized with Bcl-2. Furthermore, knockdown of p62 in HEK 293 cells significantly increased the amount of Beclin 1 that co-immunoprecipitated with Bcl-2.
CONCLUSION: p62 induces autophagy by disrupting the association between Bcl-2 and Beclin 1.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 23564079      PMCID: PMC3647217          DOI: 10.1038/aps.2013.12

Source DB:  PubMed          Journal:  Acta Pharmacol Sin        ISSN: 1671-4083            Impact factor:   6.150


Introduction

The ubiquitin-proteasome system and autophagy-lysosome system are the two major degradation systems for cell homeostasis[1]. Macroautophagy (hereafter referred to as autophagy) is primarily involved in the degradation of substrate proteins or organelles such as mitochondria[2]. The first step of autophagy is the formation of a double-membrane structure called the autophagosome (including initiation and vesicle nucleation), the second step is autophagosome expansion and closure, and the final step is autophagosome fusion with the lysosome. Ultimately, substrates are degraded in the lysosome[3,4,5]. Previous reports have suggested that autophagy is implicated in tumorigenesis, aging and many aging-associated diseases[6,7]. Suppression of autophagy in neuronal cells can cause neurodegeneration in mice[8,9]. Additionally, drugs that stimulate autophagy, such as rapamycin ester temsirolimus, can improve the motor performance of mice with spinocerebellar ataxia type 3[10]. Sequestosome 1/p62 (p62), a scaffold protein that possesses a PB1 (Phox and Bem1p-1) domain and a UBA (ubiquitin-associated) domain as well as TRAF6 and light chain 3 (LC3, Atg8 in yeast) binding sequences, is a key cargo adaptor protein involved in both the ubiquitin-proteasome system and the autophagy-lysosome system[11,12,13,14]. p62 interacts with ubiquitinated substrates and LC3, a well-known autophagy effector and marker protein, to mediate autophagic degradation of substrates[13,14]. p62 itself is an autophagy substrate that is involved in many diseases. It has been shown to have a protective role in cellular models of Huntington's disease and amyotrophic lateral sclerosis (ALS)[15,16]. Furthermore, p62 mutations are associated with ALS and Paget's disease of the bone[17,18,19,20]. Importantly, p62 plays multiple roles in tumorigenesis. In autophagy-deficient tumor cells, p62 accumulates, resulting in an alteration of the NF-κB pathway to promote tumorigenesis[21]. Moreover, multiple tumors developed in mice with a mosaic deletion of Atg5 or a liver-specific Atg7 deficiency[22], further suggesting an association between p62 and tumors. Accumulation of p62 also activates Nrf2 to transactivate anti-oxidative gene expression to promote cell survival[23]. Although p62 is a cargo adaptor protein involved in autophagy, and autophagy is closely associated with many diseases, it is still unclear whether p62 can directly regulate autophagy. In our study, we investigated the role of p62 in the regulation of autophagy. Our results show that p62 can enhance autophagy activity by disrupting the interactions between Bcl-2 and Beclin 1.

Materials and methods

Plasmid constructs

The construction of full-length plasmids with EGFP-Bcl-2 and Flag-Beclin 1 has been described previously[24,25]. Full-length human p62 was cloned using PCR products amplified from a human fetal brain cDNA library with the primers 5′- CCCAAGCTTACCATGGCGTCGCTCACCGTG-3′ and 5′- ACGCGTCGACTCACAACGGCGGGGGATGCTTTGA-3′ and subsequently inserted into the pEGFPN3 (Clontech) and p3xFLAG-myc-CMV™-24 vectors (Sigma) at Hind III and Sal I sites. pET-21a-p62 was created by subcloning p62 cDNA excised from the p62-EGFP plasmid into the pET-21a vector at EcoR I/Sal I sites. GST-Bcl-2 was created by subcloning Bcl-2 cDNA excised from the EGFP-Bcl-2 plasmid into the pGEX-5x-1 vector at EcoR I/Sal I sites.

Cell culture, plasmids and si-RNA transfection

Human embryonic kidney 293 (HEK293) cells and HeLa cells were cultured in Dulbecco's modified Eagle's medium (DMEM) (Gibco) containing 10% fetal bovine serum (FBS) (Gibco). For DNA and siRNA transfection, cells were transfected with plasmids or siRNAs using TurboFect (Fermentas) or RNAiMAX (Invitrogen), respectively. Human siRNA sequences were si-p62 sense #1: CATGTCCTACGTGAAGGATGATT, sense #2: GCATTGAAGTTGATATCGATTT; and si-Bcl-2 sense: GCATGCGGCCTCTGTTTGATT. The negative control (si-nc) was a non-targeting oligonucleotide. siRNA oligonucleotides were purchased from GenePharma (Shanghai, China).

Immunoblots and antibodies

Cell extracts were prepared in 1×RIPA lysis buffer (25 mmol/L Tris-HCl, pH 7.6, 150 mmol/L NaCl, 1% NP-40 and 1% sodium deoxycholate) with the PI (protease inhibitor cocktail) (Roche). The lysates were separated by 10%–15% SDS-PAGE and transferred onto a PVDF membrane (Millipore). Immunoblot analyses were performed using the following antibodies: mouse monoclonal antibodies against Flag, Flag-HRP (Sigma), GFP (Santa Cruz) or p62 (Santa Cruz); rabbit polyclonal antibodies against Bcl-2 (Epitomics), Beclin 1 (Abcam) or GFP[26]. The secondary antibodies used were sheep anti-mouse IgG-HRP and anti-rabbit IgG-HRP antibodies (Amersham Pharmacia Biotech). Proteins were visualized using an ECL detection kit (Amersham Pharmacia Biotech).

Immunoprecipitation

1×RIPA buffer was used to prepare cell lysates. RIPA-insoluble debris was removed after centrifugation at 12 000 r/min for 30 min at 4 °C. The supernatants were subjected to immunoprecipitation with rabbit polyclonal anti-GFP antibodies coupled to protein G Sepharose (Roche) overnight at 4 °C. The protein G Sepharose was washed with 1×RIPA buffer six times and then eluted with SDS sample buffer for immunoblot analysis.

In vitro pulldown assay

An aliquot containing approximately 20 μg of GST or GST-Bcl-2 expressed by E coli was incubated with 30 μL of glutathione agarose beads (Pharmacia) for 30 min at 4 °C. After being washed two times with ice-cold 1×PBS, the beads were incubated with approximately 40 μg of p62 expressed by E coli strain BL21 for 3 h at 4 °C. Finally, the beads were washed five times with the ice-cold 1×PBS. Bound proteins were eluted with SDS loading buffer for immunoblot analysis.

Fluorescent microscopy

HeLa cells were washed with 1×PBS and fixed with 4% paraformaldehyde for 10 min at room temperature and then treated with 0.25% Triton X-100 for 5 min. After blocking with 5% fetal bovine serum for 30 min, cells were incubated with anti-p62 (Enzo Life) and anti-Flag antibody (Sigma), then with Alexa Fluor 594 (red) and Alexa Fluor 350 (blue) conjugated secondary antibodies (Invitrogen) for 2 h. The cells were visualized using an IX71 inverted system microscope (Olympus).

Statistical analysis

Western blot densitometry analyses of immunoblots from three independent experiments were performed with Photoshop 7.0 software (Adobe). Final data analyses were performed with Origin 6.0 (Originlab).

Results

p62 can enhance basal autophagy

The conversion of LC3 type I (LC3-I) to LC3 type II (LC3-II) reflects autophagosome formation and autophagy activation[27,28]. To determine whether p62 is involved in autophagy regulation, we examined the levels of LC3-I/II after p62 was knocked down or overexpressed in HeLa cells. Surprisingly, LC3-II levels decreased when we knocked down p62 using si-p62 siRNA (Figure 1A) but increased when we overexpressed p62 in HeLa cells (Figure 1B). To further confirm the effects of p62 on LC3 conversion and to ascertain whether there was cell-type specificity, we knocked down and overexpressed p62 in HEK293 cells and also observed that p62 affected LC3 conversion (Figure 1C, 1D, and 1E). Taken together, these data suggest that p62 itself can activate autophagy in cell lines (Figure 1).
Figure 1

p62 activates autophagy. (A) Knockdown of p62 inhibited autophagy in HeLa cells. HeLa cells were transfected with si-nc (negative control siRNA) or si-p62 (combination of #1 and #2 si-p62) for 48 h, and then cell lysates were subjected to immunoblot analysis using LC3, tubulin and p62 antibodies. (B) Autophagy was activated after overexpression of Flag-p62 in HeLa cells. Flag or Flag-p62 was transfected into HeLa cells for 48 h. The cell lysates were then subjected to immunoblot analysis using LC3, tubulin, and Flag antibodies. (C) Knockdown of p62 decreased autophagy in HEK293 cells. HEK293 cells were transfected with si-nc (negative control siRNA) or si-p62 (combination of #1 and #2 si-p62) for 48 h, and then cell lysates were subjected to immunoblot analysis using LC3, tubulin and p62 antibodies. (D and E) Autophagy was activated when Flag-p62 and p62-EGFP were overexpressed in HEK293 cells. Flag, Flag-p62, EGFP, or p62-EGFP was transfected into HEK293 cells for 48 h. The cell lysates were then subjected to immunoblot analysis using LC3, tubulin, Flag and GFP antibodies. Mean±SEM. n=3. bp<0.05.

p62 activates autophagy in a Bcl-2 dependent manner

We have shown that p62 can activate autophagy (Figure 1). As Beclin 1/class III phosphatidylinositol 3-kinase (PI3K) complex is a key component for autophagosome nucleation[5,29], we examined whether p62 could affect the function of this component. When p62 was knocked down or overexpressed in HeLa cells, the protein levels of Beclin 1 remained unchanged (Figure 2A and 2B), indicating that p62 does not activate autophagy by influencing Beclin 1 levels. It was previously reported that Beclin 1 and Bcl-2 function together to regulate autophagy by interacting with each other[30,31]. We next investigated whether p62 regulates autophagy through Bcl-2. We overexpressed p62 in Bcl-2 knockdown cells. The effect of p62 on autophagy induction was abrogated by Bcl-2 knockdown (Figure 2C). These results suggest that p62 activates autophagy in a Bcl-2-dependent manner.
Figure 2

p62 activates autophagy in a Bcl-2 dependent manner. (A) HeLa cells were transfected with si-nc or si-p62 for 48 h, and then cell lysates were subjected to immunoblot analysis using Beclin 1, LC3, tubulin, and p62 antibodies. (B) Flag or Flag-p62 was transfected into HeLa cells for 48 h. The cell lysates were then subjected to immunoblot analysis using Beclin 1, LC3, tubulin, and Flag antibodies. (C) HeLa cells were transfected with si-nc or si-Bcl-2 for 24 h and then were transfected with Flag or Flag-p62 for another 48 h. Finally, the cell lysates were subjected to immunoblot analysis using LC3, tubulin, Bcl-2, and Flag antibodies. Mean±SEM. n=3. bp<0.05.

p62 interacts with and co-localizes with Bcl-2

To further explore how p62 activates autophagy through Bcl-2, we performed various biochemical and immunofluorescent assays. The in vitro pulldown assay showed that p62 directly interacted with Bcl-2 (Figure 3A). To confirm this interaction, we transfected Flag-p62 into HEK293 cells and performed co-immunoprecipitation experiments. p62 was co-immunoprecipitated when Bcl-2 was immunoprecipitated using anti-Bcl-2 antibodies (Figure 3B). Moreover, p62 co-localized with Bcl-2 in HeLa cells (Figure 3C), suggesting that p62 interacts with Bcl-2.
Figure 3

Direct association between p62 and Bcl-2. (A) p62 directly interacted with Bcl-2. GST or GST-tagged Bcl-2 bound to glutathione agarose beads was incubated with pET-21a-p62. After incubation, the beads were washed, and bound proteins were subjected to immunoblot analysis using GST or p62 antibodies. (B) Flag-p62 interacted with endogenous Bcl-2 in HEK293 cells. FLAG-tagged p62 was transfected into HEK293 cells. Cells were collected 48 h after transfection and subjected to immunoprecipitation analysis. The inputs and immunoprecipitates were then subjected to immunoblot analysis using antibodies against Bcl-2 and FLAG-HRP. (C) Flag-Bcl-2 co-localized with endogenous p62 in HeLa cells. HeLa cells were transfected with Flag-Bcl-2 for 48 h. Cells were then fixed and subjected to an immunofluorescent assay.

p62 regulates the interaction between Bcl-2 and Beclin 1

Because p62 can interact with Bcl-2, and Bcl-2 is a well-known inhibitor of autophagy that acts through interaction with Beclin 1, we next examined whether p62 affects the association between Bcl-2 and Beclin 1. In p62 knockdown cells, a greater amount of Beclin 1 co-immunoprecipitated with Bcl-2 (Figure 4), suggesting that p62 can block the association between Bcl-2 and Beclin 1.
Figure 4

p62 regulates the interaction between Bcl-2 and Beclin 1. HEK293 cells were first transfected with si-nc or si-p62 for 24 h and then transfected with Flag-Beclin 1 together with EGFP or EGFP-Bcl-2 for another 48 h. The cells were then collected and subjected to immunoprecipitation analysis. The inputs and immunoprecipitants were subjected to immunoblot analysis using antibodies against GFP, FLAG-HRP, or tubulin. Mean±SEM. n=3. bp<0.05.

Discussion

p62 is a cargo receptor that is involved in autophagy and other cellular pathways. It is generally believed that p62 is an adaptor protein for the autophagic degradation of aggregate-prone or misfolded proteins and organelles, and that p62 itself is a selective autophagy substrate targeted by the autophagy-lysosome degradation system through its interaction with LC3[13]. In this study, we demonstrated that p62 can directly induce autophagy in cultured cells (Figure 1). Beclin 1/class III PI3K complex plays an important role in autophagosome nucleation[29]. From our observations, p62 does not induce autophagy by directly affecting Beclin 1/class III PI3K pathway, because the protein levels of Beclin 1 did not change when we knocked down or overexpressed p62 (Figure 2A and 2B). However, p62 binds to Bcl-2 and affects the protein interaction between Bcl-2 and Beclin 1 (Figures 3 and 4), suggesting that p62 regulates autophagy through its direct association with Bcl-2. Given that the anti-apoptotic protein Bcl-2 can bind to Beclin 1 to disturb the Beclin 1-class III PI3K interaction and Beclin 1-associated class III PI3K activity[30,31], Bcl-2 and Beclin 1 cooperate together to regulate the vesicle nucleation step of the autophagy process. We found that autophagy was activated when Bcl-2 was knocked down (Figure 2C), which is consistent with other studies[30,31]. We further observed that p62 induces autophagy activation, which can be blocked by Bcl-2 knockdown (Figure 2C), suggesting that p62 induces autophagy in a Bcl-2-dependent manner. Because a better understanding of the physiological function of p62 may require the identification of p62 binding partners, in the current study we identified a novel p62 binding protein involved in Beclin 1/class III PI3K machinery. The question that remains is how p62 affects the interaction between Bcl-2 and Beclin 1. We speculate that there are three possibilities: (1) p62 interacts with Bcl-2 to influence Beclin 1/Bcl-2 complex formation; (2) because the association between Bcl-2 and Beclin 1 may require a specific conformation of Bcl-2, p62 may cause a conformational change in Bcl-2 after they interact and subsequently facilitate the dissociation of Bcl-2 from Beclin 1, which may promote Beclin 1-class III PI3K interaction and/or Beclin 1-associated class III PI3K activity; and (3) posttranslational modification such as ubiquitination and phosphorylation of Bcl-2 is very important for Bcl-2 function[24,28,32]. For example, ERK1-mediated phosphorylation of Bcl-2 promotes autophagy by dissociating Bcl-2 and Beclin 1[27,33]. Because p62 can regulate the activity of various kinases such as PKC and ERK[34,35,36], it is possible that p62 may affect the phosphorylation of Bcl-2 through its interaction with Bcl-2 and then modulate Bcl-2- and Beclin 1-mediated autophagy. The precise molecular mechanism underlying the modification of the interaction between Bcl-2 and Beclin 1 driven by p62 needs to be further explored in the future. In summary, we find that p62 directly binds to Bcl-2 to disturb the Bcl-2 and Beclin 1 interaction, thereby stimulating autophagy through the Bcl-2- and Beclin 1-mediated pathway. Our findings define a novel mechanism in which mammalian cells can use the key autophagic cargo adaptor protein p62 to regulate autophagy activity. Given that p62 is known to be involved in crosstalk between cellular protein quality control systems such as the proteasomal and lysosomal degradation systems[37,38], as well as diverse aspects of cellular pathways involved in cell death, apoptosis, tumorigenesis, metabolism and inflammation[21,39], this autophagic mechanism may help us to extend our knowledge of p62 function.

Author contribution

Liang ZHOU, Zheng YING, and Guang-hui WANG designed the research; Liang ZHOU, Hong-feng WANG, Hai-gang REN, Dong CHEN, Feng GAO, Qing-song HU, Chen FU, and Ran-jie XU performed the research; Liang ZHOU, Zheng YING, and Guang-hui WANG analyzed the data; Liang ZHOU, Zheng YING, and Guang-hui WANG wrote the paper.
  39 in total

Review 1.  Integration of clearance mechanisms: the proteasome and autophagy.

Authors:  Esther Wong; Ana Maria Cuervo
Journal:  Cold Spring Harb Perspect Biol       Date:  2010-11-10       Impact factor: 10.005

2.  Parkin mono-ubiquitinates Bcl-2 and regulates autophagy.

Authors:  Dong Chen; Feng Gao; Bin Li; Hongfeng Wang; Yuxia Xu; Cuiqing Zhu; Guanghui Wang
Journal:  J Biol Chem       Date:  2010-10-02       Impact factor: 5.157

Review 3.  Vesicular trafficking and autophagosome formation.

Authors:  A Longatti; S A Tooze
Journal:  Cell Death Differ       Date:  2009-04-17       Impact factor: 15.828

4.  The evolutionarily conserved interaction between LC3 and p62 selectively mediates autophagy-dependent degradation of mutant huntingtin.

Authors:  Ying-Tsen Tung; Wen-Ming Hsu; Hsinyu Lee; Wei-Pang Huang; Yung-Feng Liao
Journal:  Cell Mol Neurobiol       Date:  2010-03-05       Impact factor: 5.046

5.  Omi/HtrA2 is a positive regulator of autophagy that facilitates the degradation of mutant proteins involved in neurodegenerative diseases.

Authors:  B Li; Q Hu; H Wang; N Man; H Ren; L Wen; N Nukina; E Fei; G Wang
Journal:  Cell Death Differ       Date:  2010-05-14       Impact factor: 15.828

6.  A functional role for the p62-ERK1 axis in the control of energy homeostasis and adipogenesis.

Authors:  Sang Jun Lee; Paul T Pfluger; Ji Young Kim; Ruben Nogueiras; Angeles Duran; Gilles Pagès; Jacques Pouysségur; Matthias H Tschöp; Maria T Diaz-Meco; Jorge Moscat
Journal:  EMBO Rep       Date:  2010-02-12       Impact factor: 8.807

7.  Autophagy suppresses tumorigenesis through elimination of p62.

Authors:  Robin Mathew; Cristina M Karp; Brian Beaudoin; Nhan Vuong; Guanghua Chen; Hsin-Yi Chen; Kevin Bray; Anupama Reddy; Gyan Bhanot; Celine Gelinas; Robert S Dipaola; Vassiliki Karantza-Wadsworth; Eileen White
Journal:  Cell       Date:  2009-06-12       Impact factor: 41.582

Review 8.  Mechanisms of cross-talk between the ubiquitin-proteasome and autophagy-lysosome systems.

Authors:  Viktor I Korolchuk; Fiona M Menzies; David C Rubinsztein
Journal:  FEBS Lett       Date:  2009-12-28       Impact factor: 4.124

9.  Endogenous HMGB1 regulates autophagy.

Authors:  Daolin Tang; Rui Kang; Kristen M Livesey; Chun-Wei Cheh; Adam Farkas; Patricia Loughran; George Hoppe; Marco E Bianchi; Kevin J Tracey; Herbert J Zeh; Michael T Lotze
Journal:  J Cell Biol       Date:  2010-09-06       Impact factor: 10.539

10.  Autophagy induction reduces mutant ataxin-3 levels and toxicity in a mouse model of spinocerebellar ataxia type 3.

Authors:  Fiona M Menzies; Jeannette Huebener; Maurizio Renna; Michael Bonin; Olaf Riess; David C Rubinsztein
Journal:  Brain       Date:  2009-12-09       Impact factor: 13.501

View more
  26 in total

1.  Regulation of autophagic flux by CHIP.

Authors:  Dongkai Guo; Zheng Ying; Hongfeng Wang; Dong Chen; Feng Gao; Haigang Ren; Guanghui Wang
Journal:  Neurosci Bull       Date:  2015-07-28       Impact factor: 5.203

2.  Autophagy Portends the Level of Cardiac Hypertrophy in Experimental Hypertensive Swine Model.

Authors:  Xin Zhang; Matthew E Gibson; Zi-Lun Li; Xiang-Yang Zhu; Kyra L Jordan; Amir Lerman; Lilach O Lerman
Journal:  Am J Hypertens       Date:  2015-04-22       Impact factor: 2.689

3.  G226, a novel epipolythiodioxopiperazine derivative, induces autophagy and caspase-dependent apoptosis in human breast cancer cells in vitro.

Authors:  Peng-xing He; Yong-sheng Che; Qiao-jun He; Yi Chen; Jian Ding
Journal:  Acta Pharmacol Sin       Date:  2014-08       Impact factor: 6.150

4.  Autophagy-mediated Mir6981 degradation exhibits CDKN1B promotion of PHLPP1 protein translation.

Authors:  Minggang Peng; Jingjing Wang; Zhongxian Tian; Dongyun Zhang; Honglei Jin; Claire Liu; Jiawei Xu; Jingxia Li; Xiaohui Hua; Jiheng Xu; Chao Huang; Chuanshu Huang
Journal:  Autophagy       Date:  2019-03-08       Impact factor: 16.016

5.  The adaptor protein p62 is involved in RANKL-induced autophagy and osteoclastogenesis.

Authors:  Rui-Fang Li; Gang Chen; Jian-Gang Ren; Wei Zhang; Zhong-Xing Wu; Bing Liu; Yi Zhao; Yi-Fang Zhao
Journal:  J Histochem Cytochem       Date:  2014-08-27       Impact factor: 2.479

6.  Single-Prolonged-Stress-Induced Changes in Autophagy-Related Proteins Beclin-1, LC3, and p62 in the Medial Prefrontal Cortex of Rats with Post-traumatic Stress Disorder.

Authors:  Shilei Zheng; Fang Han; Yuxiu Shi; Lili Wen; Dan Han
Journal:  J Mol Neurosci       Date:  2017-03-25       Impact factor: 3.444

7.  Bcl-2 Decreases the Affinity of SQSTM1/p62 to Poly-Ubiquitin Chains and Suppresses the Aggregation of Misfolded Protein in Neurodegenerative Disease.

Authors:  Liang Zhou; Hongfeng Wang; Haigang Ren; Qingsong Hu; Zheng Ying; Guanghui Wang
Journal:  Mol Neurobiol       Date:  2014-10-14       Impact factor: 5.590

8.  MiR-4465 directly targets PTEN to inhibit AKT/mTOR pathway-mediated autophagy.

Authors:  Zhouteng Tao; Chenxi Feng; Chenmei Mao; Jin Ren; Yusi Tai; Huijie Guo; Mei Pu; Yang Zhou; Guanghui Wang; Mei Wang
Journal:  Cell Stress Chaperones       Date:  2018-11-12       Impact factor: 3.667

9.  Low BIK outside-inside-out interactive inflammation immune-induced transcription-dependent apoptosis through FUT3-PMM2-SQSTM1-SFN-ZNF384.

Authors:  Juxiang Huang; Lin Wang; Minghu Jiang; Qingchun Chen; Xiaoyu Zhang; Yangming Wang; Zhenfu Jiang; Zhongjie Zhang
Journal:  Immunol Res       Date:  2016-04       Impact factor: 2.829

10.  TDP-43 loss of function increases TFEB activity and blocks autophagosome-lysosome fusion.

Authors:  Qin Xia; Hongfeng Wang; Zongbing Hao; Cheng Fu; Qingsong Hu; Feng Gao; Haigang Ren; Dong Chen; Junhai Han; Zheng Ying; Guanghui Wang
Journal:  EMBO J       Date:  2015-12-23       Impact factor: 11.598

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.