Literature DB >> 23531302

Mesenchymal stem cells and Interleukin-6 attenuate liver fibrosis in mice.

Ghazanfar Ali Nasir1, Sadia Mohsin, Mohsin Khan, Sulaiman Shams, Gibran Ali, Shaheen N Khan, Sheikh Riazuddin.   

Abstract

BACKGROUND: Mesenchymal stem cell (MSC) transplantation has emerged as a promising therapy for liver fibrosis. Issues concerning poor MSC survival and engraftment in the fibrotic liver still persist and warrant development of a strategy to increase MSC potency for liver repair. The present study was designed to examine a synergistic role for Interleukin-6 (IL-6) and MSCs therapy in the recovery of carbon tetrachloride (CCl(4)) induced injured hepatocytes in vitro and in vivo.
METHODS: Injury was induced through 3 mM and 5 mM CCl(4) treatment of cultured hepatocytes while fibrotic mouse model was established by injecting 0.5 ml/kg CCl(4) followed by treatment with IL-6 and MSCs. Effect of MSCs and IL-6 treatment on injured hepatocytes was determined by lactate dehydrogenase release, RT-PCR for (Bax, Bcl-xl, Caspase3, Cytokeratin 8, NFκB, TNF-α) and annexin V apoptotic detection. Analysis of MSC and IL-6 treatment on liver fibrosis was measured by histopathology, PAS, TUNEL and Sirius red staining, RT-PCR, and liver function tests for Bilirubin and Alkaline Phosphatase (ALP).
RESULTS: A significant reduction in LDH release and apoptosis was observed in hepatocytes treated with a combination of MSCs and IL-6 concomitant with upregulation of anti-apoptotic gene Bcl-xl expression and down regulation of bax, caspase3, NFκB and TNF-α. Adoptive transfer of MSCs in fibrotic liver pretreated with IL-6 resulted increased MSCs homing and reduced fibrosis and apoptosis. Hepatic functional assessment demonstrated reduced serum levels of Bilirubin and ALP.
CONCLUSION: Pretreatment of fibrotic liver with IL-6 improves hepatic microenvironment and primes it for MSC transplantation leading to enhanced reduction of liver injury after fibrosis. Synergistic effect of IL-6 and MSCs seems a favored therapeutic option in attenuation of liver apoptosis and fibrosis accompanied by improved liver function.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 23531302      PMCID: PMC3636128          DOI: 10.1186/1479-5876-11-78

Source DB:  PubMed          Journal:  J Transl Med        ISSN: 1479-5876            Impact factor:   5.531


Background

Mesenchymal stem cells (MSCs) are multipotent adult stem cells present in bone marrow, adipose tissue and cord blood and have emerged recently as an attractive candidate for liver repair. MSCs have been shown to form functional hepatocytes in vitro [1,2] and possess the ability to secrete soluble factors stimulating endogenous parenchymal cells to support tissue recovery [3,4]. Moreover, MSC transplantation in a liver fibrosis model can reduce fibrosis [5] and restore depleted hepatic function [5-7]. Similarly, treatment with bone marrow derived stem cells can attenuate liver fibrosis by preservation of metalloproteinase levels in fibrotic liver [8]. During the course of liver fibrosis different cytokines, chemokines and growth factors are released as part of the inflammatory response. Among these secreted factors, IL-6 is a pleiotropic cytokine involved in inflammatory pathways, hematopoiesis and immune regulation. Recent evidence implicates IL-6 in survival and regeneration of hepatocytes through Nuclear Factor-kappa B (NF-κB) signal transduction and the Ras–MAPK (mitogen-activated protein kinase) pathway [9]. Increased liver injury was observed on CCl4 induction in IL-6−/− mice due to TNF-α production showing the role of IL-6 downstream of TNF-α in hepatoprotection [10]. Hepatocyte apoptosis is attenuated through IL-6 and many of the antiapoptotic genes like Bcl-xl, Bcl-2 and FLIP are upregulated [11]. Exogenous IL-6 treatment corrected the defects in cell proliferation in IL-6−/− mice showing its role as mitogenic agent in liver regeneration after partial hepatectomy [12,13]. In addition, positive effects of IL-6 on proliferation and DNA synthesis have been observed on primary hepatocyte cultures [14]. Accumulating evidence suggests that MSCs can home and migrate to injured liver but are unable to differentiate into hepatocytes rather promoting fibrogenesis in vivo [15,16]. Moreover, issues with MSC engraftment and long term survival within hostile liver microenvironment may also adversely affect the outcome of MSC therapy for liver repair. The aim of the present study was to enhance MSC potential for hepatic repair after CCl4 induced liver injury in mouse. We hypothesized that priming hepatic microenvironment with IL-6 would allow an increase in MSC mediated regenerative response by imparting protection to existing hepatocytes. We demonstrate that IL-6 and MSCs synergistically enhance hepatic repair, reduce liver fibrosis and improve overall hepatic function compared to either of the treatments alone.

Materials and methods

Animals

The investigation conforms to the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85–23, revised 1985). All animals were treated according to procedures approved by the Institutional Review Board (IRB) at the National Center of Excellence in Molecular Biology, Lahore, Pakistan.

Cell culture

Mesenchymal stem cells (MSCs) were isolated from tibias and femora of 2 months old C57BL/6 mice (n=10) according to their ability to adhere to plastic surface of a culture flask and were cultured as described previously [17].

Hepatocyte isolation

Hepatocytes were isolated from C57BL/6 mice (n=20) according to the two step perfusion method as described previously [18]. Isolated hepatocytes were plated at a concentration of 1 x 104 cells/cm2 in collagen coated plates (Becton Dickinson, USA) in RPMI 1640 medium (Sigma Aldrich, USA) supplemented with 100 ug/ml streptomycin (MP Biomedicals, USA), 100 units/ml penicillin (MP Biomedicals, USA) and 10% fetal bovine serum (Sigma Aldrich, USA) in a humidified incubator at 5% CO2 and 37°C temperature. Medium was replaced after 3 and 24 hrs after seeding followed by various treatments.

In vitro co-culture model

Hepatocytes were plated on a 6-well collagen coated plate (Becton Dickinson, USA) at a concentration of 1 × 104 cells/cm2 and were subjected to injury with 3 mM and 5 mM Carbon tetrachloride (CCl4, Merck, Germany) dissolved in DMSO (Merck, Germany) [19,20]. Injured hepatocytes were treated with Interleukin-6 [(IL-6, 10 ng/ml) (Sigma Aldrich, USA)] for 24 hours followed by MSCs administration in a transwell culture system with Dulbecco's Modified Eagle Medium (DMEM) (sigma) medium having 10% FBS, 100 U/ml penicillin and 100 μg/ml streptomycin. Hepatocyctes were divided into 5 groups as, non-treated, CCl4, IL-6, MSCs and MSCs + IL-6 treated hepatocytes. Co-culture lasted for 24 hours and hepatocytes were harvested for RNA extraction, apoptosis analysis and LDH cytotoxicity tests [21].

LDH Assay

Cytotoxicity was analyzed through Lactate dehydrogenase assay according to manufacturer’s protocol (Sigma Aldrich, USA) in hepatocytes co-cultured with MSCs in the presence or absence of IL-6. Normal, CCl4 and IL-6 treated hepatocytes were used as controls. Assay was run in triplicate for each sample and absorbance was measured at 490nm [22].

Apoptosis

FITC-Annexin V kit (Abcam, USA) was used for detection of apoptosis in all of the above mentioned in vitro groups 24 hours after co-culture. Cells were incubated with Annexin-V for 15 minutes, fixed in 2% paraformaldehyde and stained with DAPI (MP Biomedicals, USA). Apoptosis was estimated on frozen liver sections of control and treatment groups by TUNEL assay kit (Millipore, USA). Sections were fixed by 4% Paraformaldehyde and stained with TUNEL assay kit according to manufacturer’s protocol. Three sections were selected for each mouse and three mice per treatment.

CCl4 induced fibrotic liver model

Female C57BL/6 mice (6–8 weeks old) were subjected to liver fibrosis by injecting 1 ml/kg CCl4 (Merck, Germany) in olive oil (1:1) intraperitoneally for four weeks as previously described [23].

In vivo IL-6 treatment

IL-6 (Sigma Aldrich, USA) was administered at a dose of 100μg/kg intraperitonealy 24 and 48 hours after completion of 4 week CCl4 treatment. Mice were divided into five groups i.e. non-treated, CCl4, IL-6, MSCs and MSCs + IL-6 treated mice with n=10 animals in each group.

MSC Transplantation

MSCs were labeled with PKH-26 fluorescent cell linker dye (Sigma Aldrich, USA) for their detection in the liver post transplantation as shown previously [23]. MSCs + IL-6 groups received MSC transplantation 4 hours after completion of IL-6 injections. Anesthesia was induced and abdomen was neatly cut below diaphragm. After exposing liver, approximately 106 cells/ml were transplanted directly in to liver lobes at three lateral and two median sites with a 30 G syringe.

Periodic acid schiff (PAS) stain

Periodic acid schiff [(PAS) (Sigma Aldrich, USA)] staining was performed for the estimation of glycogen storage levels in sections from all animal groups 30 days after MSCs and IL-6 treatment. After hydrating, paraffin sections were incubated in periodic acid for 5 minutes followed by staining with Schiffs reagent for 15 minutes and finally hematoxylin staining. Sections from three animals for each group and three sections per treatment were analyzed.

Sirius red

Sirius red staining provided assessment of the collagen deposition in CCl4 injured and treated liver sections 30 days after MSCs and IL-6 treatment. Nuclei were stained with hemotoxylin (Sigma Aldrich, USA) and then picro-sirius red stain (Direct red 80, Sigma) was applied for 1 hour.

Gene expression

Total RNA was extracted from injured and treated cells and also from liver tissues samples using TRIZOL (Invitrogen, USA). cDNA synthesis was carried out from 1 μg of RNA sample using M-MLV reverse transcriptase (Invitrogen, USA). For analysis of gene expression in MSCs after various treatments, real time RT-PCR was carried out using SYBR Green PCR Super Mix (BioRad, USA), 8 mM of each primer and 100–500 ng/ml of template cDNA on BioRad System iQ5. The relative ratio and standard deviation between the normal and treated samples were calculated using the comparative Ct method (DD Ct value), as recommended by the BioRad iQ5system. The expression of Bax, Bcl-xl, albumin, caspase-3, cytokeratin-8, NFκB, TNF-α was estimated by using Image J software. βactin was used as internal control. All primer sequences have been mentioned in Table  1.
Table 1

Primer sequences

GeneSequenceProduct size
Bax (F)
TGGAGATGAACTGGACAGCA
182
Bax (R)
CAAAGTAGAAGAGGGCAACCAC
 
Bcl-xl (F)
TTCGGGATGGAGTAAACTGG
150
Bcl-xl (R)
AAGGCTCTAGGTGGTCATTCAG
 
Albumin (F)
GCTGTAGTGGATCCCTGGTG
196
Albumin (R)
GCTGTAGCCTTGGGCTTG
 
Cytokeratin-8 (F)
CTCACTAGCCCTGGCTTCAG
232
Cytokeratin-8 (R)
ACAGCTGTCTCCCCGTGA
 
Caspase3 (F)
TGTCATCTCGCTCTGGTACG
220
Caspase 3 (R)
AAATGACCCCTTCATCACCA
 
NF-κB (F)
GCACCTGTTCCAAAGAGCAC
200
NF-κB (R)
GTGGAGTGAGACATGGACACAC
 
TNF-α (F)
ACGGCATGGATCTCAAAGAC
162
TNF-α (R)
GGAGGTTGACTTTCTCCTGGTA
 
βactin (F)
GCTGTGTTGTCCCTGTATGC
106
βactin (R)GAGCGCGTAACCCTCATAGA 
Primer sequences

Biochemical tests

Blood samples were taken from all experimental groups 30 days after treatment with MSCs and IL-6. Serum was isolated and the amount of bilirubin (Diazyme Europe, Gmbh) and alkaline phosphatase (Bioassay System, USA) was estimated using commercial kits according to the manufacturer’s protocol.

Statistical analysis

Quantitative data was obtained from 3 slides from each animal in different experimental groups for Sirius red staining and were expressed as means ± SEM. Analysis for percentage of fibrosis between groups was performed by one-way ANOVA (p value of less than 0.05 was considered statistically significant) with bonferroni post-hoc test. Data from10 animals/group was analyzed for bilirubin and ALP.

Results

In vitro hepatocyte injury model

Hepatocytes were exposed to different concentrations of CCl4 i.e. 3 mM and 5 mM in medium for 2, 4 and 6 hours. Expression of apoptotic markers such as Bax, and caspase-3 was significantly upregulated in 6 hours group while Bcl-xl was downregulated as measured by RT-PCR. Similarly, hepatic markers albumin and cytokeratin-8 were decreased with increase in CCl4 concentration and duration of treatment (Figure  1A). Concurrently, level of cytotoxicity as measured by LDH assay was significantly higher 6 hours after 5 mM CCl4 treatment (Figure  1B). Therefore, 5 mM CCl4 concentration for 6 hours was used in subsequent experiments with in vitro cultured hepatocytes.
Figure 1

In vitro hepatocyte injury model. A) Gene expression analysis of hepatic (Albumin, Cytokeratin-8), apoptotic (Bax, caspase-3) and anti-apoptotic (Bcl-xl) markers after 3 mM and 5 mM CCl4 treatment is dose and time dependent as measured by RT-PCR (n=3). B) LDH (%) release in hepatocytes shows maximum release after 5 mM CCl4 treatment for 6 hours (n=3).

In vitro hepatocyte injury model. A) Gene expression analysis of hepatic (Albumin, Cytokeratin-8), apoptotic (Bax, caspase-3) and anti-apoptotic (Bcl-xl) markers after 3 mM and 5 mM CCl4 treatment is dose and time dependent as measured by RT-PCR (n=3). B) LDH (%) release in hepatocytes shows maximum release after 5 mM CCl4 treatment for 6 hours (n=3).

Enhanced hepatocyte protection in vitro after MSCs + IL-6 treatment

Hepatocytes were subjected to CCl4 treatment (5 mM for 6 hours) followed by treatment with IL-6 for 24 hours. At the end of IL-6 treatment, MSCs were co-cultured with hepatocytes in a transwell system with or without IL-6. Hepatocyte co-cultures were divided into five groups i.e. Non-treated, CCl4, IL-6, MSCs and MSCs + IL-6 treated hepatocytes. Analysis of gene expression showed reduction in apoptotic markers such as Bax, Caspase-3, NFκB and TNF-α in hepatocytes treated with MSCs and IL-6 alone compared to CCl4 group but a significant reduction was observed after treatment with MSCs + IL-6 compared to all other groups. Similarly, increased levels of anti apoptotic marker Bcl-xl was observed after MSCs and IL-6 treatment alone but a greater reduction was observed after combined treatment of MSCs + IL-6 compared to CCl4 treated hepatocytes (Figure  2A-B). Significant reduction in LDH levels was observed in IL-6 (32.5 ± 1.8%) and MSCs (31.2 ± 1.5%) treated injured hepatocytes (Figure  2C). However, treatment with MSCs + IL-6 showed significant higher reduction (21.6 ± 1.6%) in cell injury than any other treatment groups. Conversely, level of apoptosis as measured by Annexin-V staining was lower in IL-6 (20.7 ± 1.4%) and MSCs (17.9 ± 0.9%) compared to CCl4 (27.0 ± 2.0%). However, MSCs + IL-6 treatment (10.8 ± 0.9%) showed significant reduction in Annexin-V staining compared to all other groups (Figure  2D).
Figure 2

Enhanced hepatocyte survival after co-culture with MSCs + IL-6. A) Gene expression of apoptotic (Bax, caspase-3, NF-κB, TNF-α) and anti-apoptotic (Bcl-xl) markers in hepatocytes co-cultured with MSCs together with IL-6. B) Gel band quantification of gene expressions through Image J (n=3). CCl4 vs MSCs + IL-6 ɸ p< 0.05, ɸ ɸ p< 0.01 and ɸ ɸ ɸ p< 0.001. C) LDH (%) release levels in control and treatment groups (n=4). D) Analysis of apoptotic cells through annexin V staining (n=4). CCl4 vs IL-6 *p< 0.05, **p< 0.01 and ***p< 0.001, CCl4 vs MSCs #p< 0.05, ##p< 0.01 and ###p< 0.001, CCl4 vs MSCs + IL-6 ɸ p< 0.05, ɸ ɸ p< 0.01 and ɸ ɸ ɸ p< 0.001, IL-6 vs MSCs + IL-6 ψp< 0.05, ψψp< 0.01 and ψψψp< 0.001, MSCs vs MSCs + IL-6 δp< 0.05, δδp< 0.01 and δδδp< 0.001.

Enhanced hepatocyte survival after co-culture with MSCs + IL-6. A) Gene expression of apoptotic (Bax, caspase-3, NF-κB, TNF-α) and anti-apoptotic (Bcl-xl) markers in hepatocytes co-cultured with MSCs together with IL-6. B) Gel band quantification of gene expressions through Image J (n=3). CCl4 vs MSCs + IL-6 ɸ p< 0.05, ɸ ɸ p< 0.01 and ɸ ɸ ɸ p< 0.001. C) LDH (%) release levels in control and treatment groups (n=4). D) Analysis of apoptotic cells through annexin V staining (n=4). CCl4 vs IL-6 *p< 0.05, **p< 0.01 and ***p< 0.001, CCl4 vs MSCs #p< 0.05, ##p< 0.01 and ###p< 0.001, CCl4 vs MSCs + IL-6 ɸ p< 0.05, ɸ ɸ p< 0.01 and ɸ ɸ ɸ p< 0.001, IL-6 vs MSCs + IL-6 ψp< 0.05, ψψp< 0.01 and ψψψp< 0.001, MSCs vs MSCs + IL-6 δp< 0.05, δδp< 0.01 and δδδp< 0.001.

Homing of transplanted MSCs

MSCs labeled with PKH 26 and DAPI were transplanted into fibrotic livers in the presence or absence of IL-6. Increased homing in fibrotic liver from MSCs + IL-6 (Figure 3A-C) treatment group was observed as evidenced by increased number of PKH-26/DAPI colabeled cells (31 ± 3.2 cells/mm2) compared to MSCs (20 ± 1.2 cells/mm2) only transplantation group thus showing augmentation of MSC homing and engraftment in fibrotic livers treated with IL-6.
Figure 3

MSC homing in injured liver 30 days post transplantation. A) Quantification of transplanted MSCs (n=6). B) Injured liver with MSCs Transplantation. C) Injured liver with combined treatment (MSCs + IL-6). MSCs vs MSCs + IL-6 *p< 0.05, **p< 0.01 and ***p< 0.001.

MSC homing in injured liver 30 days post transplantation. A) Quantification of transplanted MSCs (n=6). B) Injured liver with MSCs Transplantation. C) Injured liver with combined treatment (MSCs + IL-6). MSCs vs MSCs + IL-6 *p< 0.05, **p< 0.01 and ***p< 0.001.

Reduced fibrosis and apoptosis in CCl4 injured liver after treatment with MSCs + IL-6

In order to demonstrate the combined treatment effect of MSCs and IL-6 on fibrosis and apoptosis in fibrotic liver, liver section from all treatment groups were stained with Sirius red for fibrosis and TUNEL staining for apoptosis detection. Mice treated with IL-6 and MSCs alone showed reduction in fibrosis which was 3.1 ± 0.4% and 2.1 ± 0.3% respectively compared to CCl4 treated animals (4.5 ± 0.1%) as evidenced by sirius red staining (Figure  4A-F). However, significant reduction in fibrosis was observed in MSCs + IL-6 treatment group (0.9 ± 0.2%) compared to all other groups. Conversely, TUNEL+ cells were reduced in fibrotic liver after IL-6 (28 ± 0.9%) and MSCs (20 ± 1.6%) compared to CCl4 (39 ± 0.5%) treatments (Figure  4G-L). However, there was significant reduction in TUNEL+ cells in MSCs + IL-6 (9 ± 1.5%) group compared to all other groups.
Figure 4

Reduced fibrosis and apoptosis in injured liver treated with MSCs + IL-6. A: Normal, B: CCl4 injury, C: IL-6 treated, D: MSCs transplanted, E: IL-6 + MSCs transplanted, F: Graphical presentation of collagen levels (n=). CCl4 vs IL-6 NS, CCl4 vs MSCs #p< 0.05, ##p< 0.01 and ###p< 0.001, CCl4 vs MSCs + IL-6 ɸ p< 0.05, ɸ ɸ p< 0.01 and ɸ ɸ ɸ p< 0.001, IL-6 vs MSCs + IL-6 ψp< 0.05, ψψp< 0.01 and ψψψp< 0.001, MSCs vs MSCs + IL-6 δp< 0.05, δδp< 0.01 and δδδp< 0.001. G-L Estimation of apoptosis in control fibrotic liver and treatment groups through TUNEL Assay. G: Normal, H: CCl4 injury, I: IL-6 treated, J: MSCs transplanted, K: IL-6 + MSCs transplanted, L: Graphical presentation of apoptotic positive cells in different treatment groups (n=). CCl4 vs IL-6 *p< 0.05, **p< 0.01 and ***p< 0.001, CCl4 vs MSCs #p< 0.05, ##p< 0.01 and ###p< 0.001, CCl4 vs MSCs + IL-6 ɸ p< 0.05, ɸ ɸ p< 0.01 and ɸ ɸ ɸ p< 0.001, IL-6 vs MSCs + IL-6 ψp< 0.05, ψψp< 0.01 and ψψψp< 0.001, MSCs vs MSCs + IL-6 δp< 0.05, δδp< 0.01 and δδδp< 0.001.

Reduced fibrosis and apoptosis in injured liver treated with MSCs + IL-6. A: Normal, B: CCl4 injury, C: IL-6 treated, D: MSCs transplanted, E: IL-6 + MSCs transplanted, F: Graphical presentation of collagen levels (n=). CCl4 vs IL-6 NS, CCl4 vs MSCs #p< 0.05, ##p< 0.01 and ###p< 0.001, CCl4 vs MSCs + IL-6 ɸ p< 0.05, ɸ ɸ p< 0.01 and ɸ ɸ ɸ p< 0.001, IL-6 vs MSCs + IL-6 ψp< 0.05, ψψp< 0.01 and ψψψp< 0.001, MSCs vs MSCs + IL-6 δp< 0.05, δδp< 0.01 and δδδp< 0.001. G-L Estimation of apoptosis in control fibrotic liver and treatment groups through TUNEL Assay. G: Normal, H: CCl4 injury, I: IL-6 treated, J: MSCs transplanted, K: IL-6 + MSCs transplanted, L: Graphical presentation of apoptotic positive cells in different treatment groups (n=). CCl4 vs IL-6 *p< 0.05, **p< 0.01 and ***p< 0.001, CCl4 vs MSCs #p< 0.05, ##p< 0.01 and ###p< 0.001, CCl4 vs MSCs + IL-6 ɸ p< 0.05, ɸ ɸ p< 0.01 and ɸ ɸ ɸ p< 0.001, IL-6 vs MSCs + IL-6 ψp< 0.05, ψψp< 0.01 and ψψψp< 0.001, MSCs vs MSCs + IL-6 δp< 0.05, δδp< 0.01 and δδδp< 0.001.

Improved hepatocyte survival and function in vivo after MSCs + IL-6 treatment

PAS staining of liver sections from all animal groups was done to evaluate the effect of combined treatment of MSCs and IL-6 on restoration of functional hepatocytes in liver damaged by CCl4 treatment. It was demonstrated that animals treated with MSCs + IL-6 showed high levels of glycogen storage compared to MSCs, IL-6 and CCl4 treated groups as evidence by PAS staining (Figure  5A-D). In addition, increased expression of Bcl-xl was observed in livers treated with MSCs + IL-6 compared to groups treated with either MSCs or IL-6 and CCl4 (Figure  5F). Similarly, expression levels of apoptotic markers such as Bax, caspase-3, NF-κB and TNF-α demonstrated significant reduction after combined MSCs + IL-6 administration compared both treatment alone and CCl4 treated groups (Figure  5E) providing evidence that MSCs + IL-6 administration enhances glycogen storing ability of hepatocytes, promotes survival and decreases apoptotic signaling.
Figure 5

Increased glycogen storage and survival signaling in livers after treatment with MSCs + IL-6. PAS staining of liver section from A) - CCl4, B) IL-6, C) MSCs, D) MSCs + IL-6 treated animals (n=). E) Gene expression analysis of bcl-xl, bax, caspase-3, NFκB, TNF-α as measured by quantitative RT-PCR (n=). CCl4 vs MSCs + IL-6 *p< 0.05, **p< 0.01 and ***p< 0.001.

Increased glycogen storage and survival signaling in livers after treatment with MSCs + IL-6. PAS staining of liver section from A) - CCl4, B) IL-6, C) MSCs, D) MSCs + IL-6 treated animals (n=). E) Gene expression analysis of bcl-xl, bax, caspase-3, NFκB, TNF-α as measured by quantitative RT-PCR (n=). CCl4 vs MSCs + IL-6 *p< 0.05, **p< 0.01 and ***p< 0.001.

Biochemical functions

To further evaluate the role of combined treatment with MSCs and IL-6 on augmentation of liver function, serum levels of Alkaline phosphatase (ALP) and Bilirubin were analyzed in all treatment groups. Serum levels of ALP were significantly lower in mice receiving combined treatment with MSCs + IL-6 (208 units/L) compared to treatment with IL-6 (450 units/L), MSCs (390 units/L) and CCl4 (613 units/L) groups (Figure  6A). Similarly, Bilirubin level in MSCs + IL-6 treated group was 0.4 mg/dl, which was significantly lower than IL-6 (0.83 mg/dl), MSCs (0.63 mg/dl) and CCl4 (1.17 mg/dl) treatment groups (Figure  6B). Collectively, these results indicate that combined treatment with MSCs and IL-6 results in higher recovery of hepatic function than either of the treatment alone compared to CCl4 treated mice.
Figure 6

Liver function tests. A) Alkaline phosphatase in serum of all animal groups B) Bilirubin serum levels in all animal groups (n= 10/group). CCl4 vs IL-6 *p< 0.05, **p< 0.01 and ***p< 0.001, CCl4 vs MSCs #p< 0.05, ##p< 0.01 and ###p< 0.001, CCl4 vs MSCs + IL-6 ɸ p< 0.05, ɸ ɸ p< 0.01 and ɸ ɸ ɸ p< 0.001, IL-6 vs MSCs + IL-6 ψp< 0.05, ψψp< 0.01 and ψψψp< 0.001, MSCs vs MSCs + IL-6 δp< 0.05, δδp< 0.01 and δδδp< 0.001.

Liver function tests. A) Alkaline phosphatase in serum of all animal groups B) Bilirubin serum levels in all animal groups (n= 10/group). CCl4 vs IL-6 *p< 0.05, **p< 0.01 and ***p< 0.001, CCl4 vs MSCs #p< 0.05, ##p< 0.01 and ###p< 0.001, CCl4 vs MSCs + IL-6 ɸ p< 0.05, ɸ ɸ p< 0.01 and ɸ ɸ ɸ p< 0.001, IL-6 vs MSCs + IL-6 ψp< 0.05, ψψp< 0.01 and ψψψp< 0.001, MSCs vs MSCs + IL-6 δp< 0.05, δδp< 0.01 and δδδp< 0.001.

Discussion

Liver fibrosis is a progressive disease that involves disruption of hepatic tissue architecture and accumulation of extracellular matrix in response to pathological insults. Hepatocyte apoptosis as a consequence of prolonged liver disease is one of the hallmarks of liver fibrosis and leads to development of a fibrotic scar [24]. Bone marrow derived mesenchymal stem cells (MSCs) have been shown to develop into functional hepatocytes in vitro [25] and in vivo [26] proclaiming them as possible source for repair of damaged liver. However, recent reports indicate poor survival and engraftment of MSCs in hostile hepatic milieu [15,27]. There is a dire need of strategies that protect hepatocytes against injury promoting liver microenvironment for MSCs engraftment and survival. Therefore, in the present study we combined MSC transplantation for repair of fibrotic liver with IL-6 treatment with the premise that IL-6 treatment will protect hepatocytes from fibrotic injury thereby priming MSCs engraftment and survival. A large number of studies have been conducted aimed at protecting hepatocytes from pathological injury thereby augmenting hepatic milieu and promoting repair. Hepatocyte protection from hypoxic injury was recently demonstrated by treatment with methylene blue and epimorphin in rats [28,29]. Similarly, treatment with different cytoprotective chemicals can protect hepatocytes against toxic injury [30-32]. Alternatively, treatment with cytokines released by hepatocytes in response to injury can enhance hepatocyte survival by activation of pro survival cascades. Preconditioning hepatocytes with IL-6, a major regulator of hepatic regeneration, before induction of injury promotes proliferation [13,33,34] and has a protective effect against apoptosis [11], ethanol and TNF induced injuries [35]. Conversely, IL-6 −/− mice display delayed weight recovery, defective DNA synthesis post operative mortality and severe liver fibrosis [36-38]. Exogenous administration of IL-6 in IL-6 −/− mice enhanced DNA replication to the levels seen in wild type mice [13,34]. Therefore, we sought to augment fibrotic liver tissue with exogenous IL-6 treatment with the premise that IL-6 administration will protect existing hepatocytes from CCl4 induced injury. Increased hepatocyte survival will prime the hepatic milieu for MSCs engraftment and survival leading to increase hepatic repair. Recent evidence shows that soluble factors produced by bone marrow cells can functionally enhance hepatocytes in a co-culture system [21,39]. Conversely, IL-6 pretreated hepatocytes were co-cultured with MSCs to determine whether combined treatment with IL-6 and MSCs can protect hepatocytes against CCl4 injury. Increased survival was observed in hepatocytes pretreated with IL-6 co-cultured with MSCs in response to CCl4 induced injury as evidenced by decreased expression of pro apoptotic markers (BAX, Caspase-3, TNF-α NFκB) and LDH activity (Figure  2). Interestingly, co-culture of MSCs alone or IL-6 treatment did not result in a significant increase in hepatocyte survival compared to the combination of MSC co-culture with IL-6 treatment. Therefore, combination of IL-6 and soluble factors released by MSCs can result in significantly improved hepatocyte survival against CCl4 induced fibrosis than any other treatment modality. Beneficial effect of combined MSC and IL-6 treatment on hepatocyte survival in vitro was extended in vivo to demonstrate that IL-6 can enhance hepatocyte survival and improve hepatic milieu that would lead to increased efficacy of MSC therapy for the repair of fibrotic liver. Recent studies show that IL-6−/− mice demonstrate hepatocyte apoptosis after treatment with ethanol emphasizing the role of IL-6 in liver protection against drug induced hepatoxicity [35]. Moreover, IL-6 can exert an antioxidant effect on hepatocytes by imparting protection against ROS while Bcl2 and Bcl-xl levels were shown to increase in IL-6 dependent manner [11]. Improvement in hepatic environment by virtue of increased hepatocyte protection by IL-6 administration against CCl4 induced injury would enable enhanced MSC survival and hepatic repair. Concurrently, increased MSC homing was observed in IL-6 treated fibrotic livers compared to non-treated hepatic tissue (Figure  3) and was associated with reduced fibrosis and apoptosis (Figure  4). In addition, combined treatment of MSCs and IL-6 resulted in increased glycogen storing ability of livers affected by CCl4 induced fibrosis in conjunction with increased expression of Bcl-xl and decreased expression of Bax, caspase-3, TNF-α and NFκB (Figure  5). Augmented hepatic environment evidenced by increased hepatocyte survival leads to increased MSCs survival that significantly improved hepatic function demonstrated by serum levels of ALP and Bilirubin (Figure  6). Cell therapy remains an attractive therapeutic modality for the treatment of liver fibrosis however, the efficacy of bone marrow derived MSCs within the hostile liver tissue remains a serious concern. MSCs have the ability to promote hepatocyte survival via paracrine mediated effects [21,39] and can differentiate into functional hepatocytes. Therefore, augmenting MSC capability for liver repair by enhancing liver tissue environment by IL-6 administration can lead to increased MSC homing and engraftment. Increased MSC survival within fibrotic liver pretreated with IL-6 leads to functional hepatic improvement and may be a novel therapeutic strategy for the treatment of liver fibrosis.

Conclusion

We have demonstrated that IL-6 administration can significantly enhance the ability of MSCs to repair liver after CCl4 induced fibrosis. IL-6 is one of the pleiotropic inflammatory cytokines produced by the liver in response to injury. Recent evidence shows that IL-6 can enhance hepatocyte survival while IL-6 depleted mice have enhanced liver fibrosis. Furthermore, studies demonstrating MSC therapy for repair of liver fibrosis has debatable results warranting a new strategy to enhance the potential of MSCs for repair of damaged liver. MSC transplantation in fibrotic livers treated together with IL-6 results increases MSC engraftment leading to improved hepatic function. Therefore, we report here a clinically viable therapeutic option combining IL-6 treatment with MSCs transplantation for the treatment of fibrotic liver.

Competing interests

The authors have no financial conflicts of interest.

Authors’ contributions

All authors have read and approved the manuscript. GAN and SM designed research; GAN, GA, SS performed research; GAN and SM analyzed data; and GAN, SM, MK, SNK and SR. wrote the paper.
  38 in total

1.  Increased toxin-induced liver injury and fibrosis in interleukin-6-deficient mice.

Authors:  K Kovalovich; R A DeAngelis; W Li; E E Furth; G Ciliberto; R Taub
Journal:  Hepatology       Date:  2000-01       Impact factor: 17.425

2.  Elevated interleukin-6 during ethanol consumption acts as a potential endogenous protective cytokine against ethanol-induced apoptosis in the liver: involvement of induction of Bcl-2 and Bcl-x(L) proteins.

Authors:  Feng Hong; Won-Ho Kim; Zhigang Tian; Barbara Jaruga; Edward Ishac; Xuening Shen; Bin Gao
Journal:  Oncogene       Date:  2002-01-03       Impact factor: 9.867

3.  Human umbilical cord matrix stem cells efficiently rescue acute liver failure through paracrine effects rather than hepatic differentiation.

Authors:  Shichang Zhang; Li Chen; Tao Liu; Bo Zhang; Dedong Xiang; Zhengguo Wang; Yingjie Wang
Journal:  Tissue Eng Part A       Date:  2012-06-05       Impact factor: 3.845

4.  Liver failure and defective hepatocyte regeneration in interleukin-6-deficient mice.

Authors:  D E Cressman; L E Greenbaum; R A DeAngelis; G Ciliberto; E E Furth; V Poli; R Taub
Journal:  Science       Date:  1996-11-22       Impact factor: 47.728

5.  Interleukin-6 protects against Fas-mediated death by establishing a critical level of anti-apoptotic hepatic proteins FLIP, Bcl-2, and Bcl-xL.

Authors:  K Kovalovich; W Li; R DeAngelis; L E Greenbaum; G Ciliberto; R Taub
Journal:  J Biol Chem       Date:  2001-05-10       Impact factor: 5.157

6.  Systemic infusion of FLK1(+) mesenchymal stem cells ameliorate carbon tetrachloride-induced liver fibrosis in mice.

Authors:  Baijun Fang; Mingxia Shi; Lianming Liao; Shaoguang Yang; Yuhao Liu; Robert Chunhua Zhao
Journal:  Transplantation       Date:  2004-07-15       Impact factor: 4.939

7.  Massive liver growth in mice induced by systemic interleukin 6 administration.

Authors:  Teresa A Zimmers; Iain H McKillop; Robert H Pierce; Joo-Yeon Yoo; Leonidas G Koniaris
Journal:  Hepatology       Date:  2003-08       Impact factor: 17.425

8.  Prevention of carbon tetrachloride-induced rat liver injury by soluble tumor necrosis factor receptor.

Authors:  M J Czaja; J Xu; E Alt
Journal:  Gastroenterology       Date:  1995-06       Impact factor: 22.682

9.  Primary cultures of human hepatocytes as a tool in cytotoxicity studies: cell protection against model toxins by flavonolignans obtained from Silybum marianum.

Authors:  Zdenek Dvorák; Pavel Kosina; Daniela Walterová; Vilím Simánek; Petr Bachleda; Jitka Ulrichová
Journal:  Toxicol Lett       Date:  2003-02-03       Impact factor: 4.372

10.  The development and compensation of biliary cirrhosis in interleukin-6-deficient mice.

Authors:  T Ezure; T Sakamoto; H Tsuji; J G Lunz; N Murase; J J Fung; A J Demetris
Journal:  Am J Pathol       Date:  2000-05       Impact factor: 4.307

View more
  49 in total

Review 1.  Stem Cell Therapy: Current Applications and Potential for Urology.

Authors:  Bridget Wiafe; Peter D Metcalfe; Adetola B Adesida
Journal:  Curr Urol Rep       Date:  2015-11       Impact factor: 3.092

Review 2.  Epithelial-mesenchymal transition: An emerging target in tissue fibrosis.

Authors:  Meirong Li; Fuxin Luan; Yali Zhao; Haojie Hao; Yong Zhou; Weidong Han; Xiaobing Fu
Journal:  Exp Biol Med (Maywood)       Date:  2015-09-11

3.  Corticosterone mediates the inhibitory effect of restraint stress on the migration of mesenchymal stem cell to carbon tetrachloride-induced fibrotic liver by downregulating CXCR4/7 expression.

Authors:  Shanshan Zhang; Chuan Lv; Xue Yang; Zhipeng Han; Shuili Zhang; Jianwei Zhang; Chen Zong; Lu Gao; Li Li; Qiudong Zhao; Rong Li; Yang Yang; Fenghai Yu; Xiaoning Li; Ping Zhang; Lixin Wei
Journal:  Stem Cells Dev       Date:  2014-11-11       Impact factor: 3.272

Review 4.  Use of mesenchymal stem cells to treat liver fibrosis: current situation and future prospects.

Authors:  Silvia Berardis; Prenali Dwisthi Sattwika; Mustapha Najimi; Etienne Marc Sokal
Journal:  World J Gastroenterol       Date:  2015-01-21       Impact factor: 5.742

Review 5.  Novel insights into the function and dynamics of extracellular matrix in liver fibrosis.

Authors:  Morten A Karsdal; Tina Manon-Jensen; Federica Genovese; Jacob H Kristensen; Mette J Nielsen; Jannie Marie B Sand; Niels-Ulrik B Hansen; Anne-Christine Bay-Jensen; Cecilie L Bager; Aleksander Krag; Andy Blanchard; Henrik Krarup; Diana J Leeming; Detlef Schuppan
Journal:  Am J Physiol Gastrointest Liver Physiol       Date:  2015-03-12       Impact factor: 4.052

6.  Anti-TGFβ-1 receptor inhibitor mediates the efficacy of the human umbilical cord mesenchymal stem cells against liver fibrosis through TGFβ-1/Smad pathway.

Authors:  Ji Xuan; Wang Feng; Zheng-Tao An; Jian Yang; Hua-Bing Xu; Jing Li; Zhi-Fei Zhao; Wei Wen
Journal:  Mol Cell Biochem       Date:  2017-02-08       Impact factor: 3.396

Review 7.  Mesenchymal Stem/Stromal Cells in Liver Fibrosis: Recent Findings, Old/New Caveats and Future Perspectives.

Authors:  Esteban J Fiore; Guillermo Mazzolini; Jorge B Aquino
Journal:  Stem Cell Rev Rep       Date:  2015-08       Impact factor: 5.739

8.  Transplanted Umbilical Cord Mesenchymal Stem Cells Modify the In Vivo Microenvironment Enhancing Angiogenesis and Leading to Bone Regeneration.

Authors:  Maria Rosa Todeschi; Rania El Backly; Chiara Capelli; Antonio Daga; Eugenio Patrone; Martino Introna; Ranieri Cancedda; Maddalena Mastrogiacomo
Journal:  Stem Cells Dev       Date:  2015-03-18       Impact factor: 3.272

Review 9.  Pathogenesis of liver cirrhosis.

Authors:  Wen-Ce Zhou; Quan-Bao Zhang; Liang Qiao
Journal:  World J Gastroenterol       Date:  2014-06-21       Impact factor: 5.742

10.  Human Amnion-Derived Mesenchymal Stem Cell Transplantation Ameliorates Liver Fibrosis in Rats.

Authors:  Kimitoshi Kubo; Shunsuke Ohnishi; Hidetaka Hosono; Moto Fukai; Ayano Kameya; Ryosuke Higashi; Takahiro Yamada; Reizo Onishi; Kenichi Yamahara; Hiroshi Takeda; Naoya Sakamoto
Journal:  Transplant Direct       Date:  2015-05-26
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.