Literature DB >> 23494605

Mutations in the cardiac troponin T gene show various prognoses in Japanese patients with hypertrophic cardiomyopathy.

Etsuko Fujita1, Toshio Nakanishi, Tsutomu Nishizawa, Nobuhisa Hagiwara, Rumiko Matsuoka.   

Abstract

Hypertrophic cardiomyopathy (HCM) is an autosomal dominant disorder resulting from mutations in genes for at least 15 various sarcomere-related proteins including cardiac β-myosin heavy chain, cardiac myosin-binding protein C, and cardiac troponin T. The troponin T gene (TNNT2) mutation has the third incidence of familial HCM, and the genotype-phenotype correlation of this gene still remains insufficient in Japanese familial HCM. Therefore, in the present study, we focused on screening the TNNT2 mutation in 173 unrelated Japanese patients with familial HCM, and found three reported mutations and a new mutation of TNNT2 in 11 individuals from four families. In these families, two individuals from one family had double mutations, Arg130Cys and Phe110Ile, six individuals from two other families had an Arg92Trp mutation, and one individual of another family had a new mutation, Ile79Thr, of TNNT2. The phenotype of each family was often different from reported cases, even if they had the same genetic mutation. In addition, families with the same genetic mutation showed a similar trend in the phenotype, but it was not exactly the same. However, sudden death in youth was observed in all of these families. Although the type of genetic mutation is not useful for predicting prognosis in HCM, the possibility of sudden cardiac death remains. Therefore, the prognosis of individuals bearing the TNNT2 mutation with familial HCM should be more carefully observed from birth.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 23494605      PMCID: PMC3830204          DOI: 10.1007/s00380-013-0332-3

Source DB:  PubMed          Journal:  Heart Vessels        ISSN: 0910-8327            Impact factor:   2.037


Introduction

Hypertrophic cardiomyopathy (HCM) is characterized by left and/or right ventricular hypertrophy, with predominant involvement of the interventricular septum in the absence of other causes of hypertrophy, such as hypertension, valvular heart disease, or metabolic disease [1-7]. Familial HCM is an autosomal dominant disorder caused by mutations in genes that encode sarcomere proteins. It has been reported that at least 15 genes are implicated in 55–70 % of HCM, and the major genes causing HCM include cardiac β-myosin heavy chain (MYH7), α-tropomyosin, cardiac troponin T (TNNT2), cardiac myosin-binding protein C (MYBPC3), cardiac troponin I (TNNI3), cardiac myosin regulatory light chains (MYL2), and cardiac myosin essential light chains (MYL3) [1, 4, 5, 8–11]. Cardiac troponin T is a thin-filament protein that takes part in muscle contraction. The troponin complex on the actin filament regulates the force and velocity of muscle contraction. Troponin C functions as a calcium receptor while troponin I inhibits adenosine triphosphatase (ATPase) activity when bound to actin. Troponin T fixes the troponin group to tropomyosin. During relaxation, the troponin group is bound to actin and tropomyosin, blocking the interaction of myosin and actin [12]. TNNT2 was mapped to chromosome 1q32. Mutations of TNNT2 were thought to account for approximately 15 % of familial HCM, with most missense mutations located in exons 8–16 [3], and were associated with a particularly severe form of the disease characterized by a poor overall prognosis with a high incidence of sudden death despite only mild left ventricular hypertrophy (LVH) [1-4]. Most TNNT2 mutations of familial HCM alter the contractile properties of cardiac muscle, especially the Ca2+ sensitivity of force development and ATPase activity in vitro and in vivo [13-17]. Previous reports have suggested that there is a more consistent relationship between certain genetic mutations and clinical outcome, allowing for the classification of “benign” and “malignant” mutations [18-30]. For example, a favorable prognosis has been reported in patients with a Phe110Ile mutation of the TNNT2 mutation (in 16 individuals of 6 Japanese families) [19, 20]. From these data, genetic analysis and determination of genotype were thought to be important for assisting with patient management. However, these findings were based on limited experience; to date, only 30 different mutations have been identified in TNNT2 [9–11, 18]. In addition to this genetic diversity, the phenotypic expression of these mutations varies considerably, ranging from asymptomatic individuals with a normal life expectancy to those with sudden cardiac death or the need for an early heart transplant. Clinical parameters such as the degree of LVH, the presence or absence of a left ventricular outflow tract gradient, and electrophysiology testing have not been predictive markers of poor prognosis [1-5]. More recently, it was reported that late gadolinium enhancement with cardiac magnetic resonance can be a predictive marker of the ventricular arrhythmia and poor prognosis in HCM [31]. In recent years, mutation-specific risk stratification was considered to be not possible, but genetic test-based risk stratification seemed to be clinically informative [32]. The TNNT2 mutation has the third-ranked incidence of familial HCM, and the genotype–phenotype correlation of this gene still remains insufficient in Japanese familial HCM. Therefore, in the present study we focused on screening the TNNT2 mutation.

Patients and methods

Subjects

We genetically evaluated 173 patients (101 men and 72 women; 0–79 years old, median age 20 years) who were clinically diagnosed with familial HCM. Pediatric patients with HCM were recruited from Tokyo Women’s Medical University. Written informed consent was obtained from all study subjects in accordance with the Declaration of Helsinki. If patients were younger than 16 years, informed consent was given by their guardians. We assessed each patient by taking their history and performing a physical examination, and reviewed their medical records. All assessments were done with the approval of the Ethics Committees of Tokyo Women’s Medical University. The diagnosis of HCM was determined through clinical evaluation, chest radiography, electrocardiography, echocardiography, and cardiac catheterization based on current international consensus criteria. Diseases of the heart, hypertension, valvular heart disease, or metabolic disease attributable to HCM were excluded from this study by pediatric cardiologists.

Mutation screenings

Genomic DNA was prepared from peripheral blood lymphocytes or lymphoblast cell lines transformed by the Epstein–Barr virus, as described previously [33]. TNNT2 coding regions and exon–intron boundaries, including regions approximately 30–100 bp upstream and downstream from the exons, were amplified from genomic DNA using primers, as described in previous reports [34, 35]. Genomic DNA (50 ng) was amplified through the use of primers designed from flanking intron sequences (Table 1).
Table 1

Primers used for amplification of fragments from TNNT2

ExonForward (5′–3′)Reverse (5′–3′)
2GAGCTCTTCTGAGGAAGGCACTACCCAGAATCCGAGGGAC
3 and 4CAGGGCAGCGTGGACTCCCCCCAGGGCTCCCAGGATTT
5CCATTCTCTGCTCTGGGTTCGTGCACATGGGAAAGCTGTTCT
6TAGGGCTTATCTGTGGGGAAGGCCTTCCCTGGAAAGAGCACTG
7GAAATGGAAATCCACAGGGATACTGCACCCCGTTCCATCA
8 and 9CTCTAGGAAGGATCAGGGCCCCTCACAAAAGGGATGGAGGA
10GCGATGTCACCTTCTCCCTACACCGCACCCGGCCAATA
11GGTTTCCAATCCTTTCCCCTAAGCTGCAGTGGACACCTCATTC
12GCCTTTGTCTTCCTGCCTTCTCCAGCCAGCCCAATCTCTTCACT
13ACAGGGAGGGGGCAATCTGGCCCCCAGAGCAGATGCGGGCAGTG
14ACTGGGTGCTGCCGTCTGGTCAAGGGGGCTGTTGGGGAATAGG
15CACTCAGCCCCCTTCTCCAAGCTTCTCCGCCCCACATTTC
16GGCACCCCAGTCCTACCCGTCCCCCTCAACAGCACTTTT
Primers used for amplification of fragments from TNNT2 Amplified products were purified using a MultiScreen polymerase chain reaction (PCR) plate (Millipore, Billerica, MA, USA) and directly sequenced using the ABI-PRISM BigDye-terminator cycle sequencing reaction kit and ABI 3130xl genetic analyzer (Applied Biosystems, Foster City, CA, USA). When a mutation was detected, we confirmed that it was not presenting 363 Japanese normal chromosomes by direct sequencing. The PCR conditions of these genes were modified and fragments were analyzed by electrophoresis, as described previously [36, 37]. Proband patients bearing TNNT2 mutations were additionally examined for reported HCM mutations, the coding regions of MYH7, MYBPC3, TNNI3, α-tropomyosin, MLY2, MLY3, and all exons, and a promoter region of the α-galactosidase A gene. Primer sequences and detailed PCR conditions for these additional analyses are available upon request. Reference sequences and single-nucleotide polymorphism information were obtained from the National Center for Biotechnology Information.

Results

Clinical report and DNA analysis

To investigate mutations of TNNT2, we performed DNA analysis in 173 unrelated Japanese patients with familial HCM. We identified three reported mutations and a new mutation of TNNT2 in 11 individuals from four families (A, B, C, D) (Table 2).
Table 2

Clinical features of patients with TNNT2 mutation in families A, B, C, and D

HCM individualsA III-2A III-1A II-6A II-6′ (III-2/mother)B III-7B III-2B IV-3C IV-3C III-3C II-3D III-2
Exon9 and 109 and 109109991010108
Nucleotide substitutionT328A and C388TT328A and C388TT328AC388TC274C274C274C388C388C388T236C
Amino substitutionP110I and R130CP110I and R130CP110IR130CR92WR92WR92WR92WR92WR92WI79T
SexFMMFFMMFFFF
Age (years)121455463541242158025
Outcome (years)12, Vf survivor14, died suddenly24, Vf survivor
Clinical diagnosisHCMHCMCAVB, PMINormalDHCM (HCM)Abnormal ECGHCMHCMHCMHCMHCM
ElectrocardiogramSR + CRBBBSR + CRBBB, abnQPM rhythm (CAVB)WNLR-wave progressionDetails unknownRVH, deep QLVH, ST depDetails unknownDetails unknownST dep, inv T
2D echocardiogramLVH, ASHLVH, ASHLVHWNLLVH, apical hypertrophyDetails unknownLVHLVH, ASHLVHDetails unknownLVH, ASH
Cardiac catheterizationLV relaxation abnormalitiesLV relaxation abnormalitiesLV relaxation abnormalitiesNDNDNDNDNDNDNDND

HCM hypertrophic cardiomyopathy, HOCM hypertrophic obstructive cardiomyopathy, DHCM dilated phase of HCM, LVH left ventricular hypertrophy, Vf ventricular fibrillation, CAVB complete atrioventricular block, SR sinus rhythm, CRBBB complete right bundle branch block, abnQ abnormal Q wave, LVH left ventricular hypertrophy, RVH right ventricular hypertrophy, ST dep ST depression, inv T inversion T, PMI pacemaker implantation, ECG electrocardiogram, ASH asymmetric septal hypertrophy, APH apical hypertrophy, ND not determined, WNL within normal limits

Clinical features of patients with TNNT2 mutation in families A, B, C, and D HCM hypertrophic cardiomyopathy, HOCM hypertrophic obstructive cardiomyopathy, DHCM dilated phase of HCM, LVH left ventricular hypertrophy, Vf ventricular fibrillation, CAVB complete atrioventricular block, SR sinus rhythm, CRBBB complete right bundle branch block, abnQ abnormal Q wave, LVH left ventricular hypertrophy, RVH right ventricular hypertrophy, ST dep ST depression, inv T inversion T, PMI pacemaker implantation, ECG electrocardiogram, ASH asymmetric septal hypertrophy, APH apical hypertrophy, ND not determined, WNL within normal limits In family A, all five members who carried or were suspected of having HCM also had arrhythmia. Four of them had blocks, including a complete atrioventricular block (CAVB) and complete right bundle branch block (CRBBB) (Fig. 1; II-1, 6, III-1, 2), and one had bradycardia. Two of them died suddenly (Fig. 1; I-2, III-1), and one was a ventricular fibrillation (Vf) survivor (Fig. 1; III-2). The proband (Fig. 1; III-2), aged 12 years, with sinus rhythm (SR) and a CRBBB, had an episode of Vf, and her elder brother (Fig. 1; III-1), aged 14, also with SR and a CRBBB, had died suddenly. Her father and her uncle had pacemakers implanted to treat complete AV blocks. Her mother and mother’s family had no symptoms or abnormal findings. The proband and her brother and father (Fig. 1; III-2, III-1, I-2) showed mild LVH (maximum wall thickness <20 mm). All three members underwent cardiac catheterization, and showed significant left ventricular relaxation abnormalities.
Fig. 1

Pedigree and phenotype of Family A. Pedigree with three generations (Roman Numerals), the propositus is denoted by an arrow. Further clinical data for family members is detailed in the table. HCM hypertrophic cardiomyopathy, CAVB complete atrioventricular block, PMI pacemaker implantation, CRBBB complete right bundle-branch block, Vf ventricular fibrillation

Pedigree and phenotype of Family A. Pedigree with three generations (Roman Numerals), the propositus is denoted by an arrow. Further clinical data for family members is detailed in the table. HCM hypertrophic cardiomyopathy, CAVB complete atrioventricular block, PMI pacemaker implantation, CRBBB complete right bundle-branch block, Vf ventricular fibrillation DNA analysis showed that the proband and her elder brother had the double reported mutations, Arg130Cys and Phe110Ile, of TNNT2 (Fig. 1). Her father, who had arrhythmia and mild HCM, had the Phe110Ile mutation, and her mother (II-6′), who had no symptoms or abnormal findings, had the Arg130Cys mutation. In family B, 3 of 10 members who carried or were suspected of having HCM were thought to have obstructive hypertrophic cardiomyopathy. Two female members (Fig. 2; II-4, III-9) died suddenly at a young age. The proband (Fig. 2; III-7) showed apical hypertrophy and apical aneurysm at a comparatively young age. Her aunt (Fig. 2; II-4), who had a heart murmur, was thought to have hypertrophic obstructive cardiomyopathy (HOCM), and died when she was 19 years old. Her younger sister (Fig. 2; III-9) did not show obstructive HCM, but died suddenly when she was 21 years old. Her grandmother (Fig. 2; I-1) died suddenly at the age of 50 years. DNA analysis showed that the proband (Fig. 2; III-7), her son (Fig. 2; IV-3), and her cousin (Fig. 2; III-2), who carried HCM, had an Arg92Trp mutation of TNNT2.
Fig. 2

Pedigree and phenotype of Family B. Pedigree with four generations (Roman Numerals), the propositus is denoted by an arrow. Further clinical data for family members is detailed in the table. HCM hypertrophic cardiomyopathy, HOCM hypertrophic obstructive cardiomyopathy, ECG electrocardiogram

Pedigree and phenotype of Family B. Pedigree with four generations (Roman Numerals), the propositus is denoted by an arrow. Further clinical data for family members is detailed in the table. HCM hypertrophic cardiomyopathy, HOCM hypertrophic obstructive cardiomyopathy, ECG electrocardiogram In family C, the proband (Fig. 3; IV-3), her mother (Fig. 3; III-3), and her grandmother (Fig. 3; II-3) showed mild cardiac hypertrophy (maximum wall thickness <20 mm) and asymmetric septal hypertrophy, and her myocardial hypertrophy had been gradually increasing. Her mother was suspected of having a shifting dilated phase by recent cardiac magnetic resonance imaging (MRI). The proband (Fig. 3; IV-3) had symptomatic West syndrome following perinatal brain damage, and was treated with corticotropin. DNA analysis showed that the proband (Fig. 3; IV-3) and her mother (Fig. 3; III-3) had the Arg92Trp mutation of TNNT2.
Fig. 3

Pedigree and phenotype of Family C. Pedigree with four generations (Roman Numerals), the propositus is denoted by an arrow. Further clinical data for family members is detailed in the table. HCM hypertrophic cardiomyopathy, WPW syndrome Wolff-Parkinson-White syndrome

Pedigree and phenotype of Family C. Pedigree with four generations (Roman Numerals), the propositus is denoted by an arrow. Further clinical data for family members is detailed in the table. HCM hypertrophic cardiomyopathy, WPW syndrome Wolff-Parkinson-White syndrome In family D, two of three members who carried or were suspected of having HCM died suddenly (Fig. 4; I-4, III-3), and one was a Vf survivor (Fig. 4; III-2). The proband (Fig. 4; III-2) had relatively strong cardiac hypertrophy (maximum wall thickness >20 mm), and cardiac standstill from ventricular fibrillation at the age of 24 years. Her cousin (Fig. 4; III-3) died suddenly at a young age (13 years), and her granduncle also died at the age of 40. DNA analysis shows that the proband had the 236T → C nucleotide alteration. This transition was observed in codon 79, and converted an isoleucine residue to a threonine residue (Fig. 5a). Ile79Thr occurred in conserved residues found in TNNT2 orthologues of human, mouse, rat, cat, and ox (Fig. 5b). This mutation was not observed in 363 chromosomes from unaffected Japanese populations. The proband (Fig. 4; III-2) also had a 5-bp (CTTCT) deletion/deletion polymorphism of intron 3 of TNNT2 (Fig. 6a).
Fig. 4

Pedigree and phenotype of Family D. Pedigree with four generations (Roman Numerals), the propositus is denoted by an arrow. Further clinical data for family members is detailed in the table. HCM hypertrophic cardiomyopathy, Vf ventricular fibrillation

Fig. 5

a The new Ile79Thr mutation of TNNT2 (Exon 8). b The position of the 79th Ile codes for the binding site of tropomyosin. This domain is well preserved in mammals

Fig. 6

a The deletion/deletion (D/D) polymorphism. b The insertion/insertion (I/I) polymorphism. c The insertion/deletion (I/D) polymorphism

Pedigree and phenotype of Family D. Pedigree with four generations (Roman Numerals), the propositus is denoted by an arrow. Further clinical data for family members is detailed in the table. HCM hypertrophic cardiomyopathy, Vf ventricular fibrillation a The new Ile79Thr mutation of TNNT2 (Exon 8). b The position of the 79th Ile codes for the binding site of tropomyosin. This domain is well preserved in mammals a The deletion/deletion (D/D) polymorphism. b The insertion/insertion (I/I) polymorphism. c The insertion/deletion (I/D) polymorphism To clarify the clinical importance of this polymorphism, we performed genetic analysis in 47 HCM patients from 173 unrelated Japanese patients with familial HCM. In these 47 patients, 24 had the deletion/deletion polymorphism (51 %, 14 men and 10 women; 0–72 years old, median age 30 years old). Five of the 24 (21 %) patients who had the deletion/deletion polymorphism were diagnosed with apical HCM or HOCM. In 6 of the 10 (60 %) with available data of echocardiography among these 24 patients, the maximum wall thickness was more than 30 mm. On the other hand, in the 47 HCM patients, the remaining 23 did not have the deletion/deletion polymorphism, but had the deletion/insertion or insertion/insertion polymorphism (49 %, 15 men and 8 women; 0–76 years old, median age 18 years). Two of the 23 (9 %) patients were diagnosed with apical HCM, and there were no HOCM patients. Two of the seven (29 %) with available data of echocardiography among these 23 patients showed the maximum wall thickness of more than 30 mm.

Discussion

Previous studies have reported familial HCM cases where a consistent relationship between certain genetic mutations and clinical outcome was observed, allowing for the classification of “benign” and “malignant” mutations [18-30]. However, in recent years it was considered that the specific gene mutation cannot be the sole factor that dictates clinical phenotype. Since around 1 %–2 % of all patients with HCM had a “benign” or “malignant” mutation, mutation type was not seen to be clinically useful in predicting prognosis in HCM given this very low incidence rate [32, 38–40]. In addition, it was reported that mutation of a sarcomeric protein gene can cause RCM, HCM, and DCM within the same family, and patients with a benign mutation experienced a very serious clinical course [41, 42]. In the present study, the phenotype of each family was often different from reported cases, even if they had the same genetic mutation. In addition, families with the same genetic mutation showed a similar trend in the phenotype, but it was not exactly the same. However, sudden death in youth was observed in all of these families. On the other hand, there seemed to be a family with a “malignant” mutation, which did not show the phenotype of HCM or a family history of sudden death. For example, in family A, two TNNT2 mutations were found, the Arg130 Cys and Phe110Ile mutations. The Arg130 Cys mutation has been reported by a Chinese research group [21], whose clinical features had an early onset, syncope, sudden death in youth, heart failure, and arrhythmia as atrial fibrillation. The Phe110Ile mutation has been reported to show a favorable prognosis, and have comparatively slight hypertrophy or apical hypertrophy (in 16 individuals of 6 Japanese Families) [19, 20]. Both of these reported pedigrees are Asian. In family A, whereas the proband and her elder brother, who carried these two mutations, showed similar reported phenotypes of the Arg130 Cys mutation [21], her mother and mother’s family members, who had the Arg130Cys mutation, showed no abnormal clinical features such as cardiac hypertrophy, sudden death, or abnormal electrocardiograms. Furthermore, her father and father’s family members, who had the Phe110Ile mutation, showed atrioventricular blocks, and these phenotypes have not been reported. In family B, an Arg92Trp mutation of TNNT2 was found. The mutation showed comparatively slight cardiac hypertrophy or a high incidence of sudden death in males (19 individuals of two mixed racial families) [22-24]. However, the proband and her family, who carried HCM, showed relatively severe cardiac hypertrophy, with a high incidence of sudden death in females. In family C, an Arg92Trp mutation was also found. The proband and her family, who carried HCM, showed mild cardiac hypertrophy and asymmetric septal hypertrophy. The proband’s myocardial hypertrophy had been gradually increasing, and her mother had a suspected shift to the dilated phase. In family D, the proband carried the new mutation Ile79Thr of TNNT2. She survived following an episode of Vf, and her cousin died suddenly at the age of 13 years. Previously, a mutation of the 79 residue, the Ile79Asn mutation, had been reported [24, 25], and this mutation also showed a poor prognosis. In our mutated case, even if the amino acid mutation (Ile79Thr) was different from the reported case (Ile79Asn), the patient showed a malignant prognosis. In family D, a 5-base-pair (CTTCT) deletion/deletion (D/D) polymorphism in intron 3 of the TNNT2 was also found. It has been reported that this polymorphism had caused skipping of exon 4 of TNNT2, and that the deletion allele could be associated with a predisposition for prominent LVH [42]. Although it was in a very limited range, from our genetic study on this polymorphism we gained the impression that a patient carrying the TNNT2 deletion/deletion polymorphism had a stronger tendency toward hypertrophy. To conduct further analysis, further examination including new cases is required. We considered that, at least in Japanese familial HCM, only the type of genetic mutation of TNNT2 did not seem useful in distinguishing the prognosis. However, if mutations were found, there was a risk of sudden death in youth. Therefore, regardless of the type of genetic mutation, it would be more important to observe the patient in detail from birth in each lineage. The development of a “case-based” method would be useful to treat and help each individual, and more attention needs to be paid toward searching for the modifier and environmental factors including diet, lifestyle, exercise, and the modification gene and polymorphism.
  41 in total

Review 1.  Hypertrophic cardiomyopathy.

Authors:  B J Maron
Journal:  Lancet       Date:  1997-07-12       Impact factor: 79.321

2.  Novel missense mutation in cardiac troponin T gene found in Japanese patient with hypertrophic cardiomyopathy.

Authors:  C Nakajima-Taniguchi; H Matsui; Y Fujio; S Nagata; T Kishimoto; K Yamauchi-Takihara
Journal:  J Mol Cell Cardiol       Date:  1997-02       Impact factor: 5.000

3.  Codon 102 of the cardiac troponin T gene is a putative hot spot for mutations in familial hypertrophic cardiomyopathy.

Authors:  J F Forissier; L Carrier; H Farza; G Bonne; J Bercovici; P Richard; B Hainque; P J Townsend; M H Yacoub; S Fauré; O Dubourg; A Millaire; A A Hagège; M Desnos; M Komajda; K Schwartz
Journal:  Circulation       Date:  1996-12-15       Impact factor: 29.690

4.  The activin receptor-like kinase 1 gene: genomic structure and mutations in hereditary hemorrhagic telangiectasia type 2.

Authors:  J N Berg; C J Gallione; T T Stenzel; D W Johnson; W P Allen; C E Schwartz; C E Jackson; M E Porteous; D A Marchuk
Journal:  Am J Hum Genet       Date:  1997-07       Impact factor: 11.025

5.  Alpha-tropomyosin and cardiac troponin T mutations cause familial hypertrophic cardiomyopathy: a disease of the sarcomere.

Authors:  L Thierfelder; H Watkins; C MacRae; R Lamas; W McKenna; H P Vosberg; J G Seidman; C E Seidman
Journal:  Cell       Date:  1994-06-03       Impact factor: 41.582

6.  Familial hypertrophic cardiomyopathy mutations from different functional regions of troponin T result in different effects on the pH and Ca2+ sensitivity of cardiac muscle contraction.

Authors:  Keita Harada; James D Potter
Journal:  J Biol Chem       Date:  2004-01-12       Impact factor: 5.157

7.  PCR detection of the insertion/deletion polymorphism of the human angiotensin converting enzyme gene (DCP1) (dipeptidyl carboxypeptidase 1).

Authors:  B Rigat; C Hubert; P Corvol; F Soubrier
Journal:  Nucleic Acids Res       Date:  1992-03-25       Impact factor: 16.971

8.  The role of a common TNNT2 polymorphism in cardiac hypertrophy.

Authors:  Kazuo Komamura; Naoharu Iwai; Koichi Kokame; Yoshio Yasumura; Jiyoong Kim; Masakazu Yamagishi; Takayuki Morisaki; Akinori Kimura; Hitonobu Tomoike; Masafumi Kitakaze; Kunio Miyatake
Journal:  J Hum Genet       Date:  2004-02-24       Impact factor: 3.172

Review 9.  The management of hypertrophic cardiomyopathy.

Authors:  P Spirito; C E Seidman; W J McKenna; B J Maron
Journal:  N Engl J Med       Date:  1997-03-13       Impact factor: 91.245

10.  Mutations in the genes for cardiac troponin T and alpha-tropomyosin in hypertrophic cardiomyopathy.

Authors:  H Watkins; W J McKenna; L Thierfelder; H J Suk; R Anan; A O'Donoghue; P Spirito; A Matsumori; C S Moravec; J G Seidman
Journal:  N Engl J Med       Date:  1995-04-20       Impact factor: 91.245

View more
  7 in total

1.  Prognostic significance of late gadolinium enhancement quantification in cardiac magnetic resonance imaging of hypertrophic cardiomyopathy with systolic dysfunction.

Authors:  Akira Funada; Hideaki Kanzaki; Teruo Noguchi; Yoshiaki Morita; Yasuo Sugano; Takahiro Ohara; Takuya Hasegawa; Hiromi Hashimura; Hatsue Ishibashi-Ueda; Masafumi Kitakaze; Satoshi Yasuda; Hisao Ogawa; Toshihisa Anzai
Journal:  Heart Vessels       Date:  2015-03-28       Impact factor: 2.037

2.  Prognostic predictive value of gene mutations in Japanese patients with hypertrophic cardiomyopathy.

Authors:  Ayako Chida; Kei Inai; Hiroki Sato; Eriko Shimada; Tsutomu Nishizawa; Mitsuyo Shimada; Michiko Furutani; Yoshiyuki Furutani; Yoichi Kawamura; Masaya Sugimoto; Jun Ishihara; Masako Fujiwara; Takashi Soga; Masatoshi Kawana; Shinya Fuji; Shigeru Tateno; Kenji Kuraishi; Shigetoyo Kogaki; Mitsuhiro Nishimura; Mamoru Ayusawa; Fukiko Ichida; Hirokuni Yamazawa; Rumiko Matsuoka; Shigeaki Nonoyama; Toshio Nakanishi
Journal:  Heart Vessels       Date:  2016-11-24       Impact factor: 2.037

3.  Forced aggregation and defined factors allow highly uniform-sized embryoid bodies and functional cardiomyocytes from human embryonic and induced pluripotent stem cells.

Authors:  Martin Pesl; Ivana Acimovic; Jan Pribyl; Renata Hezova; Aleksandra Vilotic; Jeremy Fauconnier; Jan Vrbsky; Peter Kruzliak; Petr Skladal; Tomas Kara; Vladimir Rotrekl; Alain Lacampagne; Petr Dvorak; Albano C Meli
Journal:  Heart Vessels       Date:  2013-11-21       Impact factor: 2.037

4.  Effects of alcohol septal ablation on left ventricular diastolic filling patterns in obstructive hypertrophic cardiomyopathy.

Authors:  You-Zhou Chen; Fu-Jian Duan; Jian-Song Yuan; Feng-Huan Hu; Jin-Gang Cui; Wei-Xian Yang; Yan Zhang; Hao Wang; Shu-Bin Qiao
Journal:  Heart Vessels       Date:  2015-03-05       Impact factor: 2.037

5.  Evaluation of coronary artery disease and cardiac morphology and function in patients with hypertrophic cardiomyopathy, using cardiac computed tomography.

Authors:  Satoshi Okayama; Tsunenari Soeda; Rika Kawakami; Yasuhiro Takami; Satoshi Somekawa; Tomoya Ueda; Yu Sugawara; Takaki Matsumoto; Ji Hee Sung; Taku Nishida; Shiro Uemura; Yoshihiko Saito
Journal:  Heart Vessels       Date:  2013-12-11       Impact factor: 2.037

6.  Effects of flecainide on left ventricular pressure gradient and symptoms in obstructive hypertrophic cardiomyopathy: a comparison of flecainide and disopyramide.

Authors:  Shintaro Haruki; Yuichiro Minami; Atsushi Suzuki; Nobuhisa Hagiwara
Journal:  Heart Vessels       Date:  2014-06-12       Impact factor: 2.037

7.  Diseases and Molecular Diagnostics: A Step Closer to Precision Medicine.

Authors:  Shailendra Dwivedi; Purvi Purohit; Radhieka Misra; Puneet Pareek; Apul Goel; Sanjay Khattri; Kamlesh Kumar Pant; Sanjeev Misra; Praveen Sharma
Journal:  Indian J Clin Biochem       Date:  2017-08-22
  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.