Literature DB >> 23457528

Genetic variation and exchange in Trypanosoma cruzi isolates from the United States.

Dawn M Roellig1, Mason Y Savage, A Wendy Fujita, Christian Barnabé, Michel Tibayrenc, Frank J Steurer, Michael J Yabsley.   

Abstract

Trypanosoma cruzi, the causative agent of Chagas disease, is a multiclonal parasite with high levels of genetic diversity and broad host and geographic ranges. Molecular characterization of South American isolates of T. cruzi has demonstrated homologous recombination and nuclear hybridization, as well as the presence of 6 main genetic clusters or "discrete typing units" (DTUs). Few studies have extensively investigated such exchange events and genetic diversity in North American isolates. In the current study, we genetically characterized over 50 US isolates from wildlife reservoirs (e.g., raccoons, opossums, armadillos, skunks), domestic dogs, humans, nonhuman primates, and reduviid vectors from nine states (TX, CA, OK, SC, FL, GA, MD, LA, TN) using a multilocus sequencing method. Single nucleotide polymorphisms were identified in sequences of the mismatch-repair class 2 (MSH2) and Tc52 genes. Typing based on the two genes often paralleled genotyping by classic methodologies using mini-exon and 18S and 24Sα rRNA genes. Evidence for genetic exchange was obtained by comparing sequence phylogenies of nuclear and mitochondrial gene targets, dihydrofolate reductase-thymidylate synthase (DHFR-TS) and the cytochrome oxidase subunit II- NADH dehydrogenase subunit I region (COII-ND1), respectively. We observed genetic exchange in several US isolates as demonstrated by incongruent mitochondrial and nuclear genes phylogenies, which confirms a previous finding of a single genetic exchange event in a Florida isolate. The presence of SNPs and evidence of genetic exchange illustrates that strains from the US are genetically diverse, even though only two phylogenetic lineages have been identified in this region.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 23457528      PMCID: PMC3572986          DOI: 10.1371/journal.pone.0056198

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Trypanosoma cruzi, the causative agent of Chagas disease, is a clonally proliferative parasite with a heterogeneous population [1], [2]. It is a biologically, molecularly, and biochemically diverse parasite that has been detected in over 200 mammalian species, including humans [3]. Prior to advances in molecular biology and genetics, differences in T. cruzi were based solely on growth characteristics and manifestations of disease in various hosts [4]. Today, T. cruzi is segregated into six major discrete typing units, TcI to TcVI and a scarcely described Tcbat genotype [5]–[8]. Characterizing a strain of T. cruzi into one of these six genotypes is useful in determining the evolutionary ecology of the parasite in a region, as well as, associating biological characters with disease manifestations. Previously, a predominately clonal population structure for T. cruzi was accepted [9], but with recent evidence for genetic exchange events, hybridization, and mitochondrial introgression this model has been challenged [10]–[17]. Looking at ten intergenic regions of the T. cruzi genome in well-characterized isolates, TcV and TcVI have been confirmed as direct hybrids of parental groups TcII and TcIII [18]. Machado and Ayala [10] have also illustrated genetic exchange by comparing nuclear and mitochondrial gene phylogenies and while the majority of isolates included in their study were from South and Central America, three isolates were from the US, of which one exhibited genetic exchange. Additionally, experimental evidence of genetic exchange in a laboratory system was revealed with the hybridization of clones [11]; however, such events in nature are rare [9] and the mechanism of recombination in T. cruzi is still unknown. Because T. cruzi is such a significant cause of morbidity and mortality in Central and South America, considerable characterization work on T. cruzi has been conducted in these regions, but because human cases in the US are rare, little work has been conducted to characterize US isolates. Since 1955, six autochthonous human cases have been reported in the United States with the most recent occurring in 2006 [19]–[23]. In addition to these six cases, over 1,750 individual blood donors currently residing in the United States were positive for antibodies reactive to T. cruzi [24]. The objective of this study was to explore the molecular diversity of T. cruzi from the US. Our goals were to investigate genetic exchange in US isolates and compare sequences of several gene targets with those from South America to identify evidence of genetic diversity between these different regions. To accomplish these goals, nucleotide sequences of two nuclear genes, the mismatch-repair class 2 gene (MSH2) and the thiol-disulfide oxido-reductase Tc52 gene (Tc52), were compared with a selection of T. cruzi isolates from the United States to identify single nucleotide polymorphisms that indicate heterogeneity and potential virulence differences. To investigate potential genetic exchange, the phylogenies of a nuclear gene [dihydrofolate reductase-thymidylate synthase (DHFR-TS)] and mitochondrial gene targets [cytochrome oxidase subunit II-NADH dehydrogenase subunit I region (COII-ND1)] were compared.

Materials and Methods

Ethics Statement

Samples labeled as “human” origin and from various animals were obtained through a material transfer agreement with CDC, Pasteur Institute, and Southeastern Cooperative Wildlife Disease Study. The conditions and approvals for the archived samples are unknown to the authors. No authors came in contact with human subjects during the research. Remaining samples from animals were obtained by handling wild-trapped animals. These animals were cared for in accordance with the guidelines of the Institutional Animal Care and use Committee and under animal use protocol A2009-3-006 approved by this committee at the University of Georgia.

Isolates

T. cruzi was isolated from multiple species of free-ranging and captive wildlife, domestic animals, triatomine bug vectors, and humans who were autochthonously infected in the United States; host and origin of each isolate can be seen in Table 1. Some isolates were obtained as liquid nitrogen-stored parasites from the Centers for Disease Control and Prevention, Pasteur Institute, and the Southeastern Cooperative Wildlife Disease Study and were established in axenic LIT medium as previously described [25]. Additional isolates were obtained from wild-trapped animals in axenic LIT medium or canine macrophage-cell culture as previously described [26]. Biological clones are indicated with the prefix “clX.”
Table 1

Lineage typing of Trypanosoma cruzi isolates from the United States.

Gene target
Host (Order)IsolateOriginLineage>> Tc52MSH2DHFR-TSCOII-ND1
HumanTC CCCorpus Christi, TXIIII n.d.
(Primate)CA RCaliforniaIIIII
TC CaliforniaLake Don Pedro, TXIIIn.d.I
Domestic DogCaesar DogNot knownIVIVIVIVIV
(Carnivora)Dog TheisNot knownIVIVIVIVIV
Griffin DogHillsboro, TNI/IVIV/IIV/IIVI
OK DogBartlesville, OKIVIVIVIVIV
Samantha DogSouth CarolinaIVIVIVIVIV
SmokeySouth CarolinaIVIVIVIVIV
USA Dog YCaliforniaIVIIIIV
VA Opossum92101601P cl2Statesboro, GAn.d.IIIIV
(Didelphimorphia)93041401P cl1Statesboro, GAIIIIIV
93070103P cl2Fort Stewart, GAIIIIIV
FH4South GeorgiaIIIIIV
FL Opo 2Wakulla Springs, FLIIIIIV
FL Opo 3Wakulla Springs, FLIIIIIV
FL Opo 15Maclay State Park, FLIIIn.d.IV
Opossum 1970New Orleans, LAIIIII
USA OpossumSouth LouisianaIIIII
Raccoon92122102RStatesboro, GAIVIVIVIVIV
(Carnivora)93040701R cl2Statesboro, GAIVIVIVIVIV
93053103R cl3Harrold Preserve, GAIIIII
93071502R cl2Fort Stewart, GAIVIVIVIVIV
93072805R cl3Fort Stewart, GAIVIVIVIVIV
FL Rac 13Maclay State Park, FLI/IVIIIVn.d.
FL Rac 15Wakulla Springs, FLIVIVIVIVIV
FL Rac 30Wakulla Springs, FLIVIVIVIVIV
FL Rac 46Tall Timbers, FLIVIVIVIVn.d.
FL Rac 5Torreya State Park, FLIVIVIVIVn.d.
FL Rac 7Lake Talquin, FLIVIVIVIVIV
FL Rac 9Torreya State Park, FLIVIVIVIVIV
GA Rac 107Ossabaw Island, GAIVIVIVIVIV
GA Rac 134Whitehall Forest, GAIVIVIVIVIV
GA Rac 143Athens, GAIVIIVIVIV
GA Rac 45Skidaway Island, GAIVIVIVIVn.d.
GA Rac 69Athens, GAIVIVIVIVIV
Maryland RacLaurel, MDIVIVIVIVIV
STC 10R cl3St. Catherine's Island, GAIVIVIVIVIV
STC 35RSt. Catherine's Island, GAIVIVIVIVIV
TN Rac 18Rutherford Co., TNIVIVIVIVIV
T. sanguisuga FloridaGainesville, FLIIIIn.d.
(Hemiptera)Florida C1F8Gainesville, FLIIIIIV
T. sang 5 cl1Bulloch Co., GAIIVIVIVn.d.
RT lemurNildaSt. Catherine's Island, GAIVIVn.d.IVn.d.
(Primate)ClarenceSt. Catherine's Island, GAIVIVIVIVIV
MegSt. Catherine's Island, GAIVIVIVn.d.IV
Rh. Macaque (Primate)Texas TheisNot knownIIVIVn.d.IV
Nb Armadillo (Cingulata)Armadillo 1973New Orleans, LAIIIII
GA Arm 20Ossabaw Island, GAIVIVIVIVIV
USA ArmadilloSouth LouisianaIIIII
Str. Skunk (Carnivora)GA Sk 1Ludiwici, GAIVIVIVn.d.IV

Table abbreviations: VA opossum = Virginia Opossum; RT lemur = Ring-tailed Lemur; Rh. Macaque = Rhesus Macaque; Nb Armadillo = Nine-banded Armadillo; Str. Skunk = Striped Skunk; n.d. = not determined.

previously characterized using mini-exon, D7 divergent domain of 24 s alpha rRNA, and 18 s rRNA genetic analysis in [34].

partial sequences were analyzed.

Table abbreviations: VA opossum = Virginia Opossum; RT lemur = Ring-tailed Lemur; Rh. Macaque = Rhesus Macaque; Nb Armadillo = Nine-banded Armadillo; Str. Skunk = Striped Skunk; n.d. = not determined. previously characterized using mini-exon, D7 divergent domain of 24 s alpha rRNA, and 18 s rRNA genetic analysis in [34]. partial sequences were analyzed.

Molecular Technique

Template was obtained for polymerase chain reactions by boiling parasites for 15 min and using the resulting supernatant for DNA extraction with the DNeasy blood and tissue kit (Qiagen, Inc., Valencia, CA) following the manufacturer's protocol. PCR amplification with GoTaq Taq polymerase (Promega Corporation, Madison, WI) was completed for the four gene targets, MSH2, Tc52, DHFR-TS, and COII-ND1, following the respective previously published protocols [27], [28], [10]. DNA extraction, amplification, and product analysis were performed in separate dedicated laboratory areas. A negative water control was included in each set of extractions and PCR reactions as contamination controls. Sequencing reactions were performed at the Clemson University Genomics Institute (Clemson, SC). Sanger sequencing reactions were carried out with purified PCR product and amplicons were bidirectionally sequenced on an ABI 3100 Automated Sequencer using the provided ABI equipment software for basecalling and sequencing analysis (Applied Biosystems, Foster City, CA). In the case of COII-ND1 products, reactions that did not yield complete sequences were identified and a heminested PCR reaction was performed using primers ND1.3A and COII.2A in the primary reaction and ND1.3S and COII.A400 or COII.2A and COII.A400R in the secondary reactions [10]. Because of the size (1,473 bp, DHFR-TS; 1,226 bp, COII-ND1; 875 bp, MSH2; 1,300 bp, Tc52) and inherent properties of the amplicons, cloning attempts were unsuccessful. Therefore, multiple sequences were obtained for each isolate and polymorphisms were noted if observed in at least two sequences for an analyzed sample.

Phylogenetic Analysis and Genotyping

Contiguous sequences were assembled in Sequencher and sequences aligned by the Clustal Wallis method in Mega4. Three phylogenetic trees were created by neighbor-joining, minimum evolution and maximum parsimony methods from the alignment of each gene target with the bootstrap consensus tree being inferred from 500 replicates and the bat trypanosome T. cruzi marinkellei [593 (B3)] or T. brucei [TReu927] used as the outgroup [29]–[32]. A strict consensus tree was interpreted from the three methods based on topology with no observed bootstrap supported incongruencies. Evolutionary distances were computed using the Kimura 2-parameter method [33]. Lineage typing of each isolate was performed with whole or partial sequences of the obtained gene sequence and a BLAST search was administered on GenBank to determine sequence identity with previously genotyped T. cruzi strains. Nucleotide sequence data reported in this paper are available in the GenBank database under accession numbers: GU212870-GU212990, GU212992-GU213035.

Results

Based on MSH2, Tc52, and DHFR-TS sequences, all human (TcI), ring-tailed lemurs (TcIV), armadillo (TcI or TcIV) and skunk (TcIV) isolates were genotyped as the equivalent lineages previously determined [34]. In contrast, some isolates from domestic dogs, Virginia opossums, raccoons, a rhesus macaque, and a Triatoma sanguisuga were classified as different lineages by different gene targets. The domestic dog isolate ‘Griffin Dog,’ previously thought to be a mixed population of TcI and TcIV [34], was confirmed in this study to have multiple sequences consistent with the TcI and TcIV reference isolates. A mixed population was demonstrated with polymorphic positions identified in the MSH2 and Tc52 genes (Tables 2 and 3).
Table 2

Nucleotide sequence variations within the MSH2 gene sequence of 50 T. cruzi isolates from the United States compared to reference strains.

Genotype/IsolateNucleotide Position
7197109172244351367373403404460478490500634645658735750775816
TcI Reference strain (Silvio X10 cl1) CAGACTAGGGATCATCACAGA
TcI – 17 US sequences* A
TcI-USA OpossumAG
TcI-93070103P cl2AYYST
Amino acid changeV→DS→C

Genotype of each isolate precedes the isolate name. Nucleotide positions correspond to sites from SilvioX10 cl1 (Genbank AY540739). Dots represent nucleotide site identical to reference strain (either Silvio X10 cl1 for TcI or CANIII cl1 for TcIV).

The following 17 US TcI sequences were identical: Human isolates (TC CC, CA R, TC California), domestic dogs (USA Dog Y), Virginia opossums (92101601P cl2, 93041401P cl2, FH4, FL Opo 2, FL Opo 3, FL Opo 15, Opossum 1970), armadillos (Armadillo 1973, USA Armadillo), triatomine bugs (Florida C1F8, Florida), and raccoons (93053103R cl3, FL Rac 13).

The following 23 US TcIV sequences were identical: Raccoons (FL Rac 9, 92122102R, 93071502R cl2, 93040701R cl1, 93072805R cl3, FL Rac 15, FL Rac 46, FL Rac 5, GA Rac 134, GA Rac 143, GA Rac 69, Maryland Rac, STC 35R), domestic dogs (Samantha Dog, Caesar Dog, Dog Theis, OK Dog, Smokey), ring-tailed lemurs (Clarence, Meg), rhesus macaque (Texas Theis), striped skunk (GA Sk 1), and armadillo (GA Arm 20).

Table 3

Nucleotide sequence variations within the Tc52 gene sequence of 51 T. cruzi isolates from the United States compared to reference strains.

Genotype/IsolateNucleotide Position
8591121148151–153155–156159–160200221231242336357392443500560588
TcI reference strain (P209) CATGACAGGCTAATTACTGAGA
TcI – 17 US sequences* •••••••
TcI-TC California•••••••
TcI-93041401P cl1C•••••••
TcI-FL Opo 2•••••••
Amino acid changeV→AL→P
TcIV reference strain (CANIII cl1) A A T G ACA GG CT G A T C G G C G G G G
TcIIa- 27 US sequences C•••••••AGGTAA
TcIIa-TN Rac 18CCAGGTCAGAAGGTAA
TcIIa-FL Rac 7C•••••••AGGTAAA
TcI/IIa-Texas Theis•••••••AGGAA
TcI/IIa-Griffin Dog•••••••ARKKSYRRA
Amino acid changeE→AE→AY→WK→YE→KL→ES→AA→T

Genotype of each isolate precedes the isolate name. Nucleotide positions correspond to sites from P209 (Genbank EF065175). Dots represent nucleotide site identical to reference strain (either P209 for TcI or CANIII cl1 for TcIV). Dashes represent missing nucleotides.

The following 17 US TcI sequences were identical: Human isolates (TC CC, CA R), domestic dogs (USA Dog Y), Virginia opossums (USA Opossum, Opossum 1970, 92101601P cl2, FH4, 93070103P cl2, FL Opo 3, FL Opo 15), armadillos (Armadillo 1973, USA Armadillo), triatomine bugs (Florida C1F8, Florida), and raccoons (GA Rac 143, 93053103R cl3, FL Rac 13).

The following 26 US TcIV sequences were identical: Raccoons (STC 10R cl3, FL Rac 9, 92122102R, 93071502R cl2, 93040701R cl1, 93072805R cl3, FL Rac 15, FL Rac 46, FL Rac 5, FL Rac 30, GA Rac 134, GA Rac 69, GA Rac 107, Maryland Rac, STC 35R), domestic dogs (Samantha Dog, Caesar Dog, Dog Theis, OK Dog, Smokey), ring-tailed lemurs (Clarence, Meg, Nilda), striped skunk (GA Sk 1), triatomine bug (T sang5 cl1), and armadillo (GA Arm 20).

Genotype of each isolate precedes the isolate name. Nucleotide positions correspond to sites from SilvioX10 cl1 (Genbank AY540739). Dots represent nucleotide site identical to reference strain (either Silvio X10 cl1 for TcI or CANIII cl1 for TcIV). The following 17 US TcI sequences were identical: Human isolates (TC CC, CA R, TC California), domestic dogs (USA Dog Y), Virginia opossums (92101601P cl2, 93041401P cl2, FH4, FL Opo 2, FL Opo 3, FL Opo 15, Opossum 1970), armadillos (Armadillo 1973, USA Armadillo), triatomine bugs (Florida C1F8, Florida), and raccoons (93053103R cl3, FL Rac 13). The following 23 US TcIV sequences were identical: Raccoons (FL Rac 9, 92122102R, 93071502R cl2, 93040701R cl1, 93072805R cl3, FL Rac 15, FL Rac 46, FL Rac 5, GA Rac 134, GA Rac 143, GA Rac 69, Maryland Rac, STC 35R), domestic dogs (Samantha Dog, Caesar Dog, Dog Theis, OK Dog, Smokey), ring-tailed lemurs (Clarence, Meg), rhesus macaque (Texas Theis), striped skunk (GA Sk 1), and armadillo (GA Arm 20). Genotype of each isolate precedes the isolate name. Nucleotide positions correspond to sites from P209 (Genbank EF065175). Dots represent nucleotide site identical to reference strain (either P209 for TcI or CANIII cl1 for TcIV). Dashes represent missing nucleotides. The following 17 US TcI sequences were identical: Human isolates (TC CC, CA R), domestic dogs (USA Dog Y), Virginia opossums (USA Opossum, Opossum 1970, 92101601P cl2, FH4, 93070103P cl2, FL Opo 3, FL Opo 15), armadillos (Armadillo 1973, USA Armadillo), triatomine bugs (Florida C1F8, Florida), and raccoons (GA Rac 143, 93053103R cl3, FL Rac 13). The following 26 US TcIV sequences were identical: Raccoons (STC 10R cl3, FL Rac 9, 92122102R, 93071502R cl2, 93040701R cl1, 93072805R cl3, FL Rac 15, FL Rac 46, FL Rac 5, FL Rac 30, GA Rac 134, GA Rac 69, GA Rac 107, Maryland Rac, STC 35R), domestic dogs (Samantha Dog, Caesar Dog, Dog Theis, OK Dog, Smokey), ring-tailed lemurs (Clarence, Meg, Nilda), striped skunk (GA Sk 1), triatomine bug (T sang5 cl1), and armadillo (GA Arm 20). Single nucleotide polymorphisms (SNPs) were observed in the MSH2 and Tc52 genes of the analyzed sequences compared to TcI and TcIV reference strains from South America (Tables 2 and 3). The majority of sequences for the MSH2 (19TcI and 24 TcIV) and Tc52 (18 TcI and 27 TcIV) genes were identical among the US isolates (Tables 2 and 3). For the MSH2 gene, only one or two nucleotides distinguished US TcI isolates from the reference strain (Silvio X10 cl1) while four to six nucleotides distinguished US TcIV from the reference strain (CANIII cl1) (Table 2). For the Tc52 gene, three to four nucleotide substitutions distinguished the US TcI isolates from the reference strain (P209) with one exception; a human isolate from a California patient (Tc California) was identical to the South American reference strain (Table 3). Numerous SNPs [13]–[22] distinguished the Tc52 sequences of US and reference TcIV strains (CANIII cl1). Overall at least four SNPs were identified in these two genes that could be used to separate US isolates of TcI and TcIV from the two South American reference strains (Tables 2 and 3). Several nucleotide changes resulted in amino acid changes (Tables 2 and 3). The phylogenies of the two gene targets show the clustering of isolates with their respective genotype, including those that exhibited unique SNPs (Figure 1).
Figure 1

Evolutionary relationships among mismatch-repair class 2 gene (MSH2) and the thiol-disulfide oxido-reductase Tc52 gene (Tc52) from 50 and 51 Trypanosoma cruzi isolates, respectively.

Three phylogenetic trees were created by neighbor-joining (NJ), minimum evolution (ME), and maximum parsimony (MP) methods from the alignment of each gene target and a consensus tree was interpreted. Numbers at the branches are bootstrap values >50% (500 replicates) for the same nodes of the NJ, ME, MP trees. Evolutionary distances were computed using the Kimura 2-parameter method [29]. ▴ = the 17 US TcI isolates that were identical; • = the 24 or 27 US TcIIa isolates that were identical. * = reference strains: SilvioX10 cl1, Colombiana, P209 (TcI); X110/8 (TcIII); CANIII cl1, Dog Theis, Ecua6 (TcIV); CL Brener (TcVI).

Evolutionary relationships among mismatch-repair class 2 gene (MSH2) and the thiol-disulfide oxido-reductase Tc52 gene (Tc52) from 50 and 51 Trypanosoma cruzi isolates, respectively.

Three phylogenetic trees were created by neighbor-joining (NJ), minimum evolution (ME), and maximum parsimony (MP) methods from the alignment of each gene target and a consensus tree was interpreted. Numbers at the branches are bootstrap values >50% (500 replicates) for the same nodes of the NJ, ME, MP trees. Evolutionary distances were computed using the Kimura 2-parameter method [29]. ▴ = the 17 US TcI isolates that were identical; • = the 24 or 27 US TcIIa isolates that were identical. * = reference strains: SilvioX10 cl1, Colombiana, P209 (TcI); X110/8 (TcIII); CANIII cl1, Dog Theis, Ecua6 (TcIV); CL Brener (TcVI). Phylogenetic analysis of the nuclear gene region, DHFR-TS, supported the findings of the Tc52 and MSH2 gene analyses and resulted in a tree that had a similar topology to a previous study [10] with three major clades (Figure 2). Little diversity was present between US TcIV isolates, but all US TcIV sequences branched separately from the reference South American TcIV sequence. Similar to sequence analysis results for the DHRF-TS gene of various TcI isolates [10], limited differences were noted within the US isolates as no separation of TcI sequences was present (Figure 2). TcIV isolates had 99% sequence identity to the CANIII cl1 reference strains with 7 SNPs; TcI isolates had 99% sequence identity to the Silvio X10 cl1 reference strain with 4 SNPs.
Figure 2

Evolutionary relationships among dihydrofolate reductase-thymidylate synthase (DHFR-TS) from 43 Trypanosoma cruzi isolates.

Three phylogenetic trees were created by neighbor-joining (NJ), minimum evolution (ME), and maximum parsimony (MP) methods from the alignment of each gene target and a consensus tree was interpreted. Numbers at the branches are bootstrap values >50% (500 replicates) for the same nodes of the NJ, ME, MP trees. Evolutionary distances were computed using the Kimura 2-parameter method [29]. The nine isolates with positions incongruent to the mitochondrial phylogenies (Fig. 3) are highlighted. * = reference strains. Sequences clustered in 3 clades: Clade 1 includes TcIV T. cruzi isolates from the US and reference TcIV and TcV S. America strains. T. cruzi isolates of TcI lineage from the US and reference strains clustered in Clade 2, while Clade 3 consists on TcII and TcVI S. American reference strains.

Evolutionary relationships among dihydrofolate reductase-thymidylate synthase (DHFR-TS) from 43 Trypanosoma cruzi isolates.

Three phylogenetic trees were created by neighbor-joining (NJ), minimum evolution (ME), and maximum parsimony (MP) methods from the alignment of each gene target and a consensus tree was interpreted. Numbers at the branches are bootstrap values >50% (500 replicates) for the same nodes of the NJ, ME, MP trees. Evolutionary distances were computed using the Kimura 2-parameter method [29]. The nine isolates with positions incongruent to the mitochondrial phylogenies (Fig. 3) are highlighted. * = reference strains. Sequences clustered in 3 clades: Clade 1 includes TcIV T. cruzi isolates from the US and reference TcIV and TcV S. America strains. T. cruzi isolates of TcI lineage from the US and reference strains clustered in Clade 2, while Clade 3 consists on TcII and TcVI S. American reference strains.
Figure 3

Evolutionary relationships among cytochrome oxidase subunit II- NADH dehydrogenase subunit I region (COII-ND1) from 43 Trypanosoma cruzi isolates.

Three phylogenetic trees were created by neighbor-joining (NJ), minimum evolution (ME), and maximum parsimony (MP) methods from the alignment of each gene target and a consensus tree was interpreted. Numbers at the branches are bootstrap values >50% (500 replicates) for the same nodes of the NJ, ME, MP trees. Evolutionary distances were computed using the Kimura 2-parameter method [29]. The nine isolates with positions incongruent to the nuclear phylogenies (Fig. 2) are highlighted. * = reference strains. Sequences clustered in 4 distinct clades. Clade 1 contains exclusively US origin TcIV strains of T. cruzi. Reference TcIII-TcIV strains of T. cruzi clustered in Clade 2. TcI T. cruzi from the US and S. American reference strains clustered in Clade 3, while a separation of a TcII reference strain results in the fourth clade.

The phylogeny for the COII-ND1 mitochondrial region showed greater divergence with four clades containing additional divisions (Figure 3). Eight isolates that were classified as TcI by analysis of various nuclear genes (e.g., 18S, mini-exon, 24S alpha, MSH2, Tc52, DHFR-TS) were classified as TcIV by phylogenetic analysis of COII-NDI sequences. A single TcIV isolate, Griffin Dog, had an incongruent phylogenetic position. These nine isolates are highlighted in Figures 2 and 3.

Evolutionary relationships among cytochrome oxidase subunit II- NADH dehydrogenase subunit I region (COII-ND1) from 43 Trypanosoma cruzi isolates.

Three phylogenetic trees were created by neighbor-joining (NJ), minimum evolution (ME), and maximum parsimony (MP) methods from the alignment of each gene target and a consensus tree was interpreted. Numbers at the branches are bootstrap values >50% (500 replicates) for the same nodes of the NJ, ME, MP trees. Evolutionary distances were computed using the Kimura 2-parameter method [29]. The nine isolates with positions incongruent to the nuclear phylogenies (Fig. 2) are highlighted. * = reference strains. Sequences clustered in 4 distinct clades. Clade 1 contains exclusively US origin TcIV strains of T. cruzi. Reference TcIII-TcIV strains of T. cruzi clustered in Clade 2. TcI T. cruzi from the US and S. American reference strains clustered in Clade 3, while a separation of a TcII reference strain results in the fourth clade. SNPs were not observed among the COII-ND1 US TcIV isolate sequences, but they only had 96% sequence identity to the CANIII cl1 reference strain with 36 SNPs (data not shown). Among the COII-ND1 US TcI isolate sequences, 88 SNPs were identified so that two TcI alleles were identified (data not shown). One allele corresponds to TcI strains proposed to exhibit evidence of genetic exchange based on the mitochondrial and nuclear incongruent phylogenies seen in Figures 2 and 3, while the other consists of TcI strains that do not show evidence of such events. Compared with the TcI reference strain, those that did exhibit exchange events had 92% sequence similarity to the Silvio X10 cl1 reference strain, with 85 SNPs; sequences without genetic exchange had 98% sequence identity to Silvio X10 cl1, with only 19 SNPs.

Discussion

In the current investigation, genetic diversity was demonstrated among T. cruzi isolates from the United States. T. cruzi strains are currently categorized into six major lineages, TcI to TcVI and a Tcbat genotype [5]–[8]. All six major genotypes have been characterized from South American isolates from various host species [35]. Contrastingly, strains from Mexico and Central America (Guatemala) have been characterized as TcI (both) and TcIV (Guatemala only), with a clear predominance of TcI isolates [36]–[39]. Isolates from the United States, have also been characterized only as TcI or TcIV [34], [40], [41]. Further confirming the paucity of genotypes in North America, in the current study, sequences of additional gene targets had sequence identity only to either TcI or TcIV. Regardless of gene target, TcIV isolates were clearly distinguished from the South American TcIV reference strain which provides additional evidence for considerable divergence within this lineage [10], [42]–[44]. To investigate genetic diversity among US T. cruzi isolates, the sequences of two nuclear genes, Tc52 and MSH2, were analyzed to identify SNPs. Tc52 is a single-copy gene constitutively-expressed in all developmental stages of T. cruzi and is implemented in the immune response to T. cruzi infection, where it suppresses T-cell proliferation by scavenging cysteine and glutathione (GSH) [45], [46]. Similar to previous findings [28], [47], [42], numerous SNPs were found in the sequences of 50 isolates analyzed in this study. Of the 47 SNPs identified, 17 resulted in amino acid changes, several of which have been previously linked to GSH binding [28]. Additional research is needed to determine if there is an association of these SNPs with biological differences (e.g., virulence) due to changes in GSH binding efficacy or between isolates from the US and those from South America. Polymorphisms were also identified in MSH2, a homologue of the mutS gene of other eukaryotes [48]. The MSH2 protein is a part of the mismatch repair machinery that binds base-base mismatches and excises and repairs them. In T. cruzi, MSH2 is also a single copy gene that is constitutively-expressed in all life stages of the parasite [48]. In the current investigation, we identified 21 SNPs of the MSH2 gene, including several that could distinguish between TcI and TcIV strains. Previous findings suggested that SNPs in TcII lineage had decreased mismatch-repair ability compared to TcI strains [27]. In our study, the majority of genetic variability was noted in the TcIV isolates. Interestingly, TcIV isolates from the US tend to be less virulent to laboratory mice and to date, no human infections with this genotype have been reported in North America [49]; TcIV strains have been isolated from primates, prosimians, and domestic dogs [34], [50], [51]. Previously, different T. cruzi MSH2 phenotypes have exhibited different levels of susceptibility to cisplatin and oxidative damage [48], [52]. The ability or inability to withstand such external pressures from DNA damaging compounds was associated with genetic variability and subsequent strain differences [48], [52]. One may speculate, then, that the sequence differences within and between lineages observed in the current study may result in phenotypic differences affecting drug susceptibility. In addition to identifying sequence differences in these US isolates, phylogenies were constructed for DHFR-TS (nuclear) and COII-ND1 (mitochondrial) to elucidate genealogical relationships among isolates and illustrate evidence for genetic exchange. The nuclear phylogeny of DHFR-TS exhibited three major clades. Isolates of TcI from the US clustered with S. American isolates, illustrating the limited genetic variability of the lineage reported in previous studies with this gene [10], [39]. Although genetic variability among TcI isolates was minimal for nuclear gene targets in this study, considerable biological differences between isolates have been previously noted [53]–[55]. Other studies have differentiated TcI isolates using the microsatellite analysis, comparative genome hybridization, and mini-exon and cytochrome b genes, sometimes suggesting the subdivision of the lineage [13], [14], [56]–[59]. Division between N. and S. American TcIV strains may be evidence of the independent evolution of N. American TcIV strains from its ancestral S. American strains, as is supported by the results of this and previous studies [43], [60]. The phylogeny of COII-ND1 demonstrated greater genetic diversity with additional clustering occurring within the four clades present. As with the nuclear phylogeny, TcIV strains from the US diverged from TcIV strains of S. America. Additional clusters within the US TcIV clade indicate additional genetic diversity within the group; however, several of these subclades had low bootstrap support. The clade representing TcI strains contained both US isolates from this study and South American isolates, which is consistent with the nuclear DHFR-TS phylogeny. As previously suggested, the clustering of all TcI sequences may be due to a single origin of these strains [39], [61]. It is also possible that TcI represents a more recent introduction or spread into North America compared with TcIV, which may have been separate from the South American strains for a significant period of time which would allow divergence. The most compelling finding from the COII-ND1 phylogeny is the clustering of several TcI strains (classified based on several nuclear genes) within the US TcIV clade. Incongruencies between nuclear and mitochondrial phylogenies have been previously reported with S. American isolates and a single US isolate and is interpreted as evidence of rare genetic exchange events in the T. cruzi population [10], [62]. These findings in addition to in vitro demonstration of genetic recombination and previous multilocus sequence typing studies illustrate that genetic exchange does occur, albeit rarely [10], [11], [43], [62]. In the current study, several TcI sequences represent isolates that may have undergone genetic exchange in comparison to few TcIV sequences. This suggests that TcI isolates may be more susceptible or likely to have recombination, possibly as a result of more rapid evolution in this lineage [61]. While these phylogenies can be associated with genetic exchange, the role of such events in driving the evolution of the species has not been explored [61]. In the current study, we identified several isolates with evidence of genetic exchange. While only two (TcI and TcIV) of the six genealogical lineages have been detected circulating in mammal populations in the US, the presence of SNPs and evidence of genetic exchange suggest that parasite populations in the US are genetically diverse.
  55 in total

1.  Scarce events of mitochondrial introgression in Trypanosoma cruzi: new case with a Bolivian strain.

Authors:  Christian Barnabé; Simone Frédérique Brenière
Journal:  Infect Genet Evol       Date:  2012-09-13       Impact factor: 3.342

2.  The neighbor-joining method: a new method for reconstructing phylogenetic trees.

Authors:  N Saitou; M Nei
Journal:  Mol Biol Evol       Date:  1987-07       Impact factor: 16.240

3.  Isozymic heterogeneity of Trypanosoma cruzi in the first autochthonous patients with Chagas' disease in Amazonian Brazil.

Authors:  M A Miles; A Souza; M Povoa; J J Shaw; R Lainson; P J Toye
Journal:  Nature       Date:  1978-04-27       Impact factor: 49.962

4.  Host specificity of ribosomal DNA variation in sylvatic Trypanosoma cruzi from North America.

Authors:  C G Clark; O J Pung
Journal:  Mol Biochem Parasitol       Date:  1994-07       Impact factor: 1.759

5.  Indigenous Chagas' disease (American trypanosomiasis) in California.

Authors:  R J Schiffler; G P Mansur; T R Navin; K Limpakarnjanarat
Journal:  JAMA       Date:  1984-06-08       Impact factor: 56.272

6.  Identifying four Trypanosoma cruzi I isolate haplotypes from different geographic regions in Colombia.

Authors:  Claudia Herrera; M Dolores Bargues; Anabella Fajardo; Marleny Montilla; Omar Triana; Gustavo Adolfo Vallejo; Felipe Guhl
Journal:  Infect Genet Evol       Date:  2006-12-28       Impact factor: 3.342

7.  Trypanosoma cruzi infection of free-ranging lion-tailed macaques (Macaca silenus) and ring-tailed lemurs (Lemur catta) on St. Catherine's Island, Georgia, USA.

Authors:  O J Pung; J Spratt; C G Clark; T M Norton; J Carter
Journal:  J Zoo Wildl Med       Date:  1998-03       Impact factor: 0.776

8.  Sex, subdivision, and domestic dispersal of Trypanosoma cruzi lineage I in southern Ecuador.

Authors:  Sofía Ocaña-Mayorga; Martin S Llewellyn; Jaime A Costales; Michael A Miles; Mario J Grijalva
Journal:  PLoS Negl Trop Dis       Date:  2010-12-14

9.  Trypanosoma cruzi MSH2: Functional analyses on different parasite strains provide evidences for a role on the oxidative stress response.

Authors:  Priscila C Campos; Viviane G Silva; Carolina Furtado; Alice Machado-Silva; Wanderson D Darocha; Eduardo F Peloso; Fernanda R Gadelha; Marisa H G Medeiros; Gustavo de Carvalho Lana; Ying Chen; Rebecca L Barnes; Danielle Gomes Passos-Silva; Richard McCulloch; Carlos Renato Machado; Santuza M R Teixeira
Journal:  Mol Biochem Parasitol       Date:  2010-11-10       Impact factor: 1.759

10.  Autochthonous transmission of Trypanosoma cruzi, Louisiana.

Authors:  Patricia L Dorn; Leon Perniciaro; Michael J Yabsley; Dawn M Roellig; Gary Balsamo; James Diaz; Dawn Wesson
Journal:  Emerg Infect Dis       Date:  2007-04       Impact factor: 6.883

View more
  33 in total

1.  Tc52 amino-terminal-domain DNA carried by attenuated Salmonella enterica serovar Typhimurium induces protection against a Trypanosoma cruzi lethal challenge.

Authors:  Marina N Matos; Silvia I Cazorla; Augusto E Bivona; Celina Morales; Carlos A Guzmán; Emilio L Malchiodi
Journal:  Infect Immun       Date:  2014-07-28       Impact factor: 3.441

2.  Genetic variation in RPOIILS gene encoding RNA polymerase II largest subunit from Leishmania major.

Authors:  Gilda Eslami; Rasoul Salehi
Journal:  Mol Biol Rep       Date:  2014-01-23       Impact factor: 2.316

3.  Molecular study of Trypanosoma caninum isolates based on different genetic markers.

Authors:  Juliana H S Barros; Helena K Toma; Maria de Fatima Madeira
Journal:  Parasitol Res       Date:  2015-01-08       Impact factor: 2.289

4.  PATHOLOGY AND DISCRETE TYPING UNIT ASSOCIATIONS OF TRYPANOSOMA CRUZI INFECTION IN COYOTES (CANIS LATRANS) AND RACCOONS (PROCYON LOTOR) OF TEXAS, USA.

Authors:  Carolyn L Hodo; Rosa M Bañuelos; Erin E Edwards; Edward J Wozniak; Sarah A Hamer
Journal:  J Wildl Dis       Date:  2019-09-30       Impact factor: 1.535

Review 5.  Chagas Disease in the United States: a Public Health Approach.

Authors:  Caryn Bern; Louisa A Messenger; Jeffrey D Whitman; James H Maguire
Journal:  Clin Microbiol Rev       Date:  2019-11-27       Impact factor: 26.132

Review 6.  Evolution of Trypanosoma cruzi: clarifying hybridisations, mitochondrial introgressions and phylogenetic relationships between major lineages.

Authors:  Nicolás Tomasini; Patricio Diosque
Journal:  Mem Inst Oswaldo Cruz       Date:  2015-03-24       Impact factor: 2.743

Review 7.  Between a bug and a hard place: Trypanosoma cruzi genetic diversity and the clinical outcomes of Chagas disease.

Authors:  Louisa A Messenger; Michael A Miles; Caryn Bern
Journal:  Expert Rev Anti Infect Ther       Date:  2015-08       Impact factor: 5.091

8.  Molecular Characterization of Four Mexican Isolates of Trypanosoma cruzi and Their Profile Susceptibility to Nifurtimox.

Authors:  López-Domínguez Jaime; López-Monteon Aracely; Ochoa-Martínez Paulina; Eric Dumonteil; Christian Barnabé; Etienne Waleckx; Rubén Gustavo Hernández-Giles; Angel Ramos-Ligonio
Journal:  Acta Parasitol       Date:  2022-08-27       Impact factor: 1.534

9.  Reproductive Outcomes in Rhesus Macaques (Macaca mulatta) with Naturally-acquired Trypanosoma cruzi Infection.

Authors:  April L Kendricks; Stanton B Gray; Gregory K Wilkerson; Courtney M Sands; Christian R Abee; Bruce J Bernacky; Peter J Hotez; Maria Elena Bottazzi; Suzanne L Craig; Kathryn M Jones
Journal:  Comp Med       Date:  2020-03-17       Impact factor: 0.982

10.  Multiplex Real-Time PCR Assay Using TaqMan Probes for the Identification of Trypanosoma cruzi DTUs in Biological and Clinical Samples.

Authors:  Carolina I Cura; Tomas Duffy; Raúl H Lucero; Margarita Bisio; Julie Péneau; Matilde Jimenez-Coello; Eva Calabuig; María J Gimenez; Edward Valencia Ayala; Sonia A Kjos; José Santalla; Susan M Mahaney; Nelly M Cayo; Claudia Nagel; Laura Barcán; Edith S Málaga Machaca; Karla Y Acosta Viana; Laurent Brutus; Susana B Ocampo; Christine Aznar; Cesar A Cuba Cuba; Ricardo E Gürtler; Janine M Ramsey; Isabela Ribeiro; John L VandeBerg; Zaida E Yadon; Antonio Osuna; Alejandro G Schijman
Journal:  PLoS Negl Trop Dis       Date:  2015-05-19
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.