Literature DB >> 23409683

Multiplex qPCR for reliable detection and differentiation of Burkholderia mallei and Burkholderia pseudomallei.

Ingmar Janse1, Raditijo A Hamidjaja, Amber C A Hendriks, Bart J van Rotterdam.   

Abstract

BACKGROUND: Burkholderia mallei and B. pseudomallei are two closely related species of highly virulent bacteria that can be difficult to detect. Pathogenic Burkholderia are endemic in many regions worldwide and cases of infection, sometimes brought by travelers from unsuspected regions, also occur elsewhere. Rapid, sensitive methods for identification of B. mallei and B. pseudomallei are urgently needed in the interests of patient treatment and epidemiological surveillance.
METHODS: Signature sequences for sensitive, specific detection of pathogenic Burkholderia based on published genomes were identified and a qPCR assay was designed and validated.
RESULTS: A single-reaction quadruplex qPCR assay for the detection of pathogenic Burkholderia, which includes a marker for internal control of DNA extraction and amplification, was developed. The assay permits differentiation of B. mallei and B. pseudomallei strains, and probit analysis showed a very low detection limit. Use of a multicopy signature sequence permits detection of less than 1 genome equivalent per reaction.
CONCLUSIONS: The new assay permits rapid detection of pathogenic Burkholderia and combines enhanced sensitivity, species differentiation, and inclusion of an internal control for both DNA extraction and PCR amplification.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 23409683      PMCID: PMC3579680          DOI: 10.1186/1471-2334-13-86

Source DB:  PubMed          Journal:  BMC Infect Dis        ISSN: 1471-2334            Impact factor:   3.090


Background

The ubiquitous Proteobacterial genus Burkholderia includes several animal and plant pathogens. Two closely related Burkholderia species cause severe, potentially fatal disease in humans. Burkholderia mallei is an obligate mammalian pathogen that causes glanders, a disease that is found in much of the world apart from North America, Europe and Australia. The disease mainly affects solipeds, but transmission to humans is possible through direct contact with animals and aerosols. Naturally infected human cases are reported only sporadically, but the causative agent is highly pathogenic under laboratory conditions and there have been several reports of laboratory-acquired infections [1]. Burkholderia pseudomallei is present in the environment and is a facultative pathogen that causes melioidosis, a glanders-like disease. It is a disease of humans and animals in all tropical and sub-tropical regions, but particularly South and Southeast Asia and northern Australia. Cases, included those brought by travelers, also occur outside endemic regions [2,3]. Glanders and melioidosis cause diagnostic problems in endemic regions, and even more so when imported into non-endemic areas due to a lack of awareness of these diseases there. The variety of clinical manifestations means that the diagnosis of melioidosis or glanders cannot be based on symptomatic evidence alone and currently requires cultivation of the causative agent. This is a time-consuming process, and even more time is needed to confirm the species involved by means of biochemical tests. Moreover, misidentification due to the use of rapid biochemical methods has been reported [4,5]. Timely recognition of B. mallei and B. pseudomallei is vital for appropriate therapy, since both pathogens cause rapidly progressive diseases and are resistant to several antibiotics. These features, together with the relative ease with which these pathogens can be obtained and transmitted, the difficulties experienced in diagnosing the resultant diseases, and the fact that no effective protection through vaccination exists, have put them in the highest risk category of biothreat agents (classified as ‘Tier 1’ under the revised US select agents regulations, http://www.selectagents.gov). It is thus vital to have fast, sensitive methods for the identification of B. mallei and B. pseudomallei, both for patient treatment and for epidemiological surveillance and forensic investigation in the event of their deliberate release. Several molecular tests using different detection platforms have been described for this purpose [6,7]. A real-time single-reaction assay for detection would however permit faster detection with less effort. Such assays for the detection and differentiation of B. mallei and B. pseudomallei, based on duplex hydrolysis probes for allelic discrimination, were recently described [6,8]. These assays did not include internal controls for DNA extraction and PCR amplification, however. Moreover, reliance on one signature sequence for detection of pathogenic Burkholderia may not be sufficiently specific, since B. pseudomallei and B. mallei display considerable genomic plasticity [9,10] and emerging novel strains will continue to challenge the coverage and sensitivity of these assays. We have developed a single-reaction quadruplex qPCR assay for rapid, reliable detection of pathogenic Burkholderia. The assay combines enhanced sensitivity based on use of a specific multicopy sequence shared by both species, robust differentiation based on use of two different species-specific signature sequences, and enhanced reliability due to the incorporation of a marker that serves as internal control for DNA extraction and PCR amplification.

Methods

Design of primers and probes for multiplex hydrolysis probe assay

Both completed and unfinished genomes from B. mallei (10) and B. pseudomallei (29) available from public databases were analyzed by using the software package Kodon for management and analysis of sequences ( http://www.applied-maths.com) and the insignia web tool ( http://insignia.cbcb.umd.edu). Several potential signature sequences were identified for these organisms. The transposase ISBma2 was present in about 40–50 copies in B. mallei and about 5 copies in B. pseudomallei. Although this transposase has homologues in other organisms, a region of approximately 150 bp could be identified, which is present exclusively in B. mallei and B. pseudomallei, and not in B. oklahomensis. In addition, several unique signature sequences for differentiation of B. mallei and B. pseudomallei were identified. Out of these, the longest unique sequences were selected for primer and probe design. Both signature sequences corresponded to hypothetical proteins. The B. pseudomalllei signature sequence psu corresponded to locus BPSS1387 in the published genome of strain K96243 (Genebank accession number BX571966). This gene codes for a putative acetyltransferase, which is part of the type III secretion system-associated gene cluster. B. mallei signature sequence mau corresponded to locus BMA2524.1 in the published genome of strain ATCC 23344 (Genebank accession number CP000010). This gene codes for a phage integrase family protein. The Cry1 gene of Bacillus thuringiensis was used as a signature sequences for the detection of this organism. Addition of these highly refractory spores to the assays served as internal control for DNA isolation and amplification (see also [11,12]). The software package Visual OMP ( http://www.DNAsoftware.com) was used to design a 4-target real-time PCR, as was described before [12]. An initial design yielded an unexpectedly high Cq for the multicopy sequence for two B. pseudomallei isolates (NCTC 4845 and NCTC 12939 T). Sequence analysis revealed a variation at one position of the probe annealing site, and a degeneracy was introduced to cover all strain variants (Table 1).
Table 1

Primers and probes for multiplex qPCR

OrganismTargetOligo functionOligo nameSequence 5'-3'a
B. pseudomallei +
ISBma2
primer
Bumcpri_f
GCGGAAGCGGAAAAAGGG
B. mallei
ISBma2transposase
primer
Bumcpri_r
GCGGGTAGTCGAAGCTG
 
 
probe
Tqpro_Bumc
FAM-TCRCCAGACGCAGCAGCAT-BHQ1
B. pseudomallei
Hypothetical
primer
psupri_f
GCGCGATCCGTCGAG
 
protein
primer
psupri_r
AGCCGCTACGACGATTATG
 
 
probe
Tqpro_psu
JOE-CCGCGACAATACGACCATCC-BHQ1
B. mallei
Hypothetical
primer
maupri3_f
GGCGAAAGAACGCGAAC
 
protein
primer
maupri3_r
GCGTTCCACGATCAACTCT
 
 
probe
Tqpro2_mau
CF590-CATCCCGCACCGTCCG-BHQ2
B. thuringiensis
Crystal protein
primer
Btpri_f
GCAACTATGAGTAGTGGGAGTAATTTAC
 
gene
primer
Btpri_r
TTCATTGCCTGAATTGAAGACATGAG
  probeTqpro_BtCy5-ACGTAAATACACT-BHQ2-TGATCCATTTGAAAAG-P

a CFR590= CalFluor Red 590, BHQ= Black Hole quencher, P= phosporylation.

Primers and probes for multiplex qPCR a CFR590= CalFluor Red 590, BHQ= Black Hole quencher, P= phosporylation.

PCR and real-time qPCR

Oligonucleotides were synthesized by Biolegio (Biolegio, Nijmegen, the Netherlands). All qPCR reactions were carried out in a final volume of 20 µl containing iQ Multiplex Powermix (Bio-Rad, Veenendaal, the Netherlands), 200 nM of each primer and 100–300 nM hydrolysis probes and 3 µl of DNA template. Probe concentrations had been optimized to yield minimal spectral overlap between fluorescence level of the reporter dyes for each target in a multiplex assay and were 100, 200, 300 and 300 nM for FAM, JOE, CFR590 and Cy5 labeled probes respectively. The thermal cycling conditions were as follows: first enzyme activation at 95°C for 5 min, followed by amplification and detection by 45 thermocycles at 95°C for 5 sec and 60°C for 35 sec. Each real-time qPCR experiment included a negative (no template) control. Measurements were carried out on a LightCycler 480 (Roche, Almere, the Netherlands). Analyses were performed on the instruments software: LightCycler 480 Software release 1.5.0. SP3 and Cq values were calculated using the second derivative method. Color compensation was carried out according to the manufacturers’ guidelines.

Bacterial isolates and genomic DNA preparation

The detection limits and specificities of the assays were evaluated using genomic materials from the bacterial strains and other sources displayed in Table 2. More details about the source and handling of the materials can be found in [12]. Lysates from the clinical isolates designated BD (Table 2) were prepared by boiling colonies cultivated on blood agar plates in water for 30 min. Autopsy materials were obtained from a melioidosis patient. A QIAamp DNA Mini kit (Qiagen, Crawley, UK) was used to extract DNA from liver, spleen, lung and prostate tissue samples. Spore suspensions of B. thuringiensis strain ATCC 29730 (var. galleriae Heimpel) that were used as internal controls, were obtained from Raven Biological Laboratories (Omaha, Nebraska, USA). These washed spores were counted by microscopy and then aliquotted and stored at 4°C. The amount of spores that needs to be added to samples to obtain suitable Cq values for this internal control must be determined empirically for each stock spore suspension. Ten-fold serial dilutions were made from the spore stock and DNA was extracted from 50 µl portions of each dilution by using the Nuclisens Magnetic Extraction Reagents (bioMérieux). The developed real-time qPCR assays were used to determine the amount of spores required for a Cq value between 32 and 35.
Table 2

Panel of organisms used for coverage and specificity analysis

SpeciesStrainStrain detailsaTargetsb
 
 
 
BuMC
psu
mau
cry1
Burkholderia
NCTC 10229
Bird, 1961
14,5
-
19,2
-
mallei
NCTC 10230
Horse, 1961
14,6
-
19,3
-
 
NCTC 10245
Horse, 1972
14,1
-
18,8
-
 
NCTC 10247
Turkey, 1960
15,2
-
19,8
-
 
NCTC 10248
Clinical isolate, Turkey, 1950
12,2
-
17,4
-
 
NCTC 10260
Clinical isolate, Turkey, 1949
16,2
-
20,8
-
 
NCTC 120
1920
14,8
-
19,4
-
 
NCTC 3708
Mule, India, 1932
14,8
-
19,4
-
 
NCTC 3709
Horse, India, 1932
15,0
-
19,3
-
 
NCTC 12938 T
Clinical isolate
15,6
-
20,0
-
Burkholderia
NCTC 10274
Clinical isolate, Kuala Lumpur, 1962
16,3
18,5
-
-
pseudomallei
NCTC 10276
Clinical isolate, 1962
16,5
19,0
-
-
 
NCTC 11642
 
14,7
18,2
-
-
 
NCTC 1688
Rat, Malaysia, 1923
16,9
19,2
-
-
 
NCTC 4845
infected laboratory monkey, Singapore,1935
-
18,8
-
-
 
NCTC 4846
infected laboratory monkey, Singapore,1935
15,9
18,3
-
-
 
NCTC 6700
Clinical isolate, 1942
15,9
18,7
-
-
 
NCTC 7383
1948
16,0
18,7
-
-
 
NCTC 7431
1948
16,0
18,3
-
-
 
NCTC 8016
Sheep, Queensland, 1949
17,0
18,8
-
-
 
NCTC 8707
Jordan, 1946
16,6
18,8
-
-
 
NCTC 8708
Jordan, 1946
17,8
19,9
-
-
 
NCTC 12939 T
Clinical isolate, USA, 1953
-
18,4
-
-
 
BD08-00100
Clinical isolate, Netherlands, 2008c
17,0
18,3
-
-
 
BD08-00103
Clinical isolate, Netherlands, 2008
18,8
20,2
-
-
 
BD08-00268
Clinical isolate, Netherlands, 2008
16,2
19,0
-
-
 
BD10-00211
Clinical isolate, Netherlands, 2010
-
18,6
-
-
 
BD12-00016
Clinical isolate, Netherlands, 2012
18,5
21,1
-
-
 
BD12-00217
Clinical isolate, Netherlands, 2012
19,6
22,2
-
-
Burkholderia
DSM 13276
Environmental sample, Thailand
-
-
-
-
thailandensis
CIP 106301
Soil, Thailand, 1994
-
-
-
-
 
CIP 106302
 
-
-
-
-
Bacillus anthracis
NCTC 8234
Weybridge, 1951 (Sterne)
-
-
-
-
 
NCTC 10340
Cow, Edinburgh, 1963 (Vollum)
-
-
-
-
Francisella tularensis
BD07-537
Clinical isolate, Netherlands, 2007
-
-
-
-
subsp. holarctica (B)
 
 
 
 
 
 
Yersinia pestis
Kenya 164
Biovar antiqua, Kenya, <1952
-
-
-
-
 
Harbin
Biovar mediaevalis, China, <1948
-
-
-
-
 
Madagascar 34-94
Biovar orientalis, Madagascar
-
-
-
-
Bacillus atrophaeus
ATCC 9372
 
-
-
-
-
Bacillus cereus
ATCC 11778
NCIB Aberdeen, 1962
-
-
-
-
Bacillus coagulans
 
Purchased at Raven Labs, USA
-
-
-
-
Bacillus megaterium
ATCC 8245
 
-
-
-
-
Bacillus pumilus
ATCC 27142
 
-
-
-
-
Bacillus subtilis
ATCC 6633
 
-
-
-
-
Bacillus thuringiensis
ATCC 29730
var. galleriae Heimpel
-
-
-
20,4
Enterobacter cloacae
NCTC 13168
 
-
-
-
-
Escherichia coli
ATCC 25922
Clinical isolate, 1946
-
-
-
-
Pseudomonas
ATCC 15442
 
-
-
-
-
aeruginosa
ATCC 27853
Blood culture, 1969
-
-
-
-
Klebsiella pneumoniae
BD05-258
Clinical isolate, 2005
-
-
-
-
Salmonella enterica
ATCC 14028
Serovar Typhimurium.
-
-
-
-
subsp. enterica
 
liver, 1987
-
-
-
-
 
ATCC 13076
Serovar Enteritidis
-
-
-
-
Bos taurus
0469
Netherlands, 2009
-
-
-
-
Chrysops relictus
I
Tissue, Netherlands, 2009
-
-
-
-
Homo sapiens
Volunteer 8
Blood, Netherlands, 2009
-
-
-
-
 
Volunteer 10
Blood, Netherlands, 2009
-
-
-
-
Equus ferus caballus
 
Tissue, Netherlands, 2010
-
-
-
-
Mus musculus
 
Netherlands, 2009
-
-
-
-
Ovis aries
Twello 67
Slaughterhouse, Netherlands, 2009
-
-
-
-
Rattus norvegicus
08604
Netherlands, 2009
-
-
-
-
Rattus rattus
08402
Netherlands, 2009
-
-
-
-
Sus scrofa566Slaughterhouse, Netherlands, 2009----

aThe names of the countries or towns are those used at the time of the strain isolation and have been kept for strain designation.

bNumbers represent Cq values; - means no amplification. cAll clinical isolates from B. pseudomallei designated BD were isolated in the Netherlands from imported cases from Thailand.

Panel of organisms used for coverage and specificity analysis aThe names of the countries or towns are those used at the time of the strain isolation and have been kept for strain designation. bNumbers represent Cq values; - means no amplification. cAll clinical isolates from B. pseudomallei designated BD were isolated in the Netherlands from imported cases from Thailand.

Limit of detection, efficiency, repeatability and internal control dynamic range

Characterization of qPCR performance was guided by the MIQE guidelines [13]. Validations were carried out using genomic DNA that was purified from culture lysates. Detection limits (LOD) for genomic DNA were determined by using purified DNA from cultures of B.mallei strain NCTC 10229 and B. pseudomallei strain NCTC 10276. The concentration of purified genomic DNA was measured by using the Quant-iT™ PicoGreen dsDNA detection kit (Invitrogen) and a Fluoroskan Ascent Microplate fluorometer (Thermo Scientific). Serial dilutions of genomic DNA were used to calculate LODs from the proportion of positive qPCRs at each dilution. Four replicates of 10 serial dilutions of genomic DNA were measured by qPCR. Based on the results, an additional measurement was performed on 4 replicates of 10 novel serial dilutions. The measurements included at least one dilution with all replicates positive and one with all replicates negative. A probit analysis was performed using SPSS Statistics 19.0.0 to calculate the DNA concentration that could be measured with 95% probability. Efficiency and repeatability were calculated from the log-linear portion of the calibration curve, covering 6 orders of magnitude. Four replicate measurements were obtained from each dilution. Because the variation in Cqs at the lowest template concentration was relatively high, these values were excluded from the calculations. To investigate the concentration range of internal control B. thuringiensis DNA that could be added to Burkholderia DNA without interfering with the detection of low pathogen concentrations, a dilution series of the internal control was made in the presence of a constant and low concentration of the pathogens. Genomic DNA from Burkholderia mallei or B. pseudomallei (14 and 48 fg/reaction, respectively) was mixed with serial dilutions from genomic DNA from B. thuringiensis (1.3∙101 – 1.3?∙108 fg/reaction). These DNA mixtures were amplified in triplicate by using the developed qPCR assays and the Cq values were plotted to investigate possible inhibition.

Results

Three signature sequences were developed to permit sensitive detection and differentiation of B. mallei and B. pseudomallei. ISBma2 transposase is present in multiple copies in both species, thus enabling sensitive detection. Although homologs of this transposase occur in related organisms, a portion of this sequence was identified that is unique for B. mallei and B. pseudomallei. Two unique signature sequences (designated mau and psu respectively) differentiate between B. mallei and B. pseudomallei by their presence or absence. Table 1 shows the oligonucleotides designed for the detection of these signature sequences in the multiplex qPCR assay. This assay uses oligonucleotides to detect the cry1 gene from Bacillus thuringiensis. Spores from this organism added before DNA extraction thus provide internal checks on the successful recovery and amplification of DNA. The specificity and strain coverage of the assay were validated with the aid of a panel of DNA from B. mallei and B. pseudomallei strains, a number of close relatives of these organisms, and several other bacterial and eukaryote strains (Table 2). The assay was able to discriminate correctly between the two species. Clinical samples were obtained from the melioidosis patient from whom B. pseudomallei strain BD10-00211 had been isolated. Samples derived from the liver and spleen tested positive only for signature sequence psu, at Cqs of 37.8 and 34.9 respectively. The enhanced sensitivity of detection of pathogenic Burkholderia with the aid of the multicopy target (BuMC) was demonstrated by the Cq values for this target, which were clearly lower than those for the single-copy targets (a difference of 4.4 – 5.2 for B. mallei and 1.3 – 3.5 for B. pseudomallei). The multicopy sequence could not be detected in three of the B. pseudomallei strains (NCTC 4845, NCTC 12939 T and BD10-00211). All standard curves had an R2 of >0.998 and showed high amplification efficiencies and linearity for the different targets, over at least 6 orders of magnitude (Table 3). Calculation of the limit of detection (LOD) using probit analysis showed high sensitivities of 0.2 and 3.7 fg for B. mallei and B. pseudomallei respectively (based on use of the multicopy target BuMC).
Table 3

Assay performance

OrganismaTargetEfficiency (%)Linear range (fg/reaction)Repeatability (SD of Cq)bLOD gDNA (fg/reaction)c
B. mallei
BuMC
99,0
1.4·10-1 – 1.4·106
0,072
0.2
 
mau
98,7
1.4·100 – 1.4·106
0,080
4.5
B. pseudomallei
BuMC
96,6
1·100 - 1·107
0,085
3,7
 psu99,21·101 – 1·1070,07757

a Organism from which genomic DNA was used for assessment of assay performance.

b Values represent the average from the standard deviations calculated at 6 different dilutions from 4 replicate Cq measurements.

c Values displayed represent the lowest DNA concentration at which 95% of the positive samples are detected, as calculated by using probit analysis.

Assay performance a Organism from which genomic DNA was used for assessment of assay performance. b Values represent the average from the standard deviations calculated at 6 different dilutions from 4 replicate Cq measurements. c Values displayed represent the lowest DNA concentration at which 95% of the positive samples are detected, as calculated by using probit analysis. To confirm that the addition of the internal control has no effect on pathogen detection, a dilution series of B. thuringiensis DNA was made in the presence of a constant and very low concentration of Burkholderia DNA. As shown in Figure 1, the detection of all signature sequences of B. mallei and B. pseudomallei was unaffected by the presence of the internal control DNA, even when the latter was present at an excess of 105:1.
Figure 1

Effect of increasing amounts of internal control on qPCR detection. A concentration range of genomic DNA from B. thuringiensis was mixed with a constant and low concentration of 14 fg B. mallei gDNA (A) or 48 B. pseudomallei DNA (B), and measured by using the developed multiplex qPCR.

Effect of increasing amounts of internal control on qPCR detection. A concentration range of genomic DNA from B. thuringiensis was mixed with a constant and low concentration of 14 fg B. mallei gDNA (A) or 48 B. pseudomallei DNA (B), and measured by using the developed multiplex qPCR.

Discussion

Methods for the rapid, specific identification of pathogenic Burkholderia species are important for timely recognition of glanders or melioidosis in patients with general clinical symptoms that could fit various diseases. Both B. pseudomallei and B. mallei are intrinsically resistant to many widely-used antibiotics, and susceptibilities differ between the two species [6,14]. Identification of and differentiation between the two pathogens could thus help healthcare workers to choose the right antibiotics to treat infected patients. In regions where these species are endemic, infection with Burkholderia mallei or B. pseudomallei can often be pinpointed by consideration of prevalences and infection risk factors. The presence of the pathogens is less evident in non-endemic areas. Numerous cases of imported melioidosis have been reported [3,6], and are likely to continue to occur as travel and trade increase. Fast diagnostic methods are therefore essential for use in non-endemic areas, not only to support appropriate patient treatment but also to ensure the safety of laboratory workers culturing unknown organisms for diagnostic purposes. Another scenario in which rapid identification of pathogenic Burkholderia including species distinction is a challenging but essential task is that of deliberate release of these biothreat agents, where appropriate assay methods may be needed e.g. for forensic tracking. The assay presented in this paper permits sensitive, reliable detection of pathogenic Burkholderia, thanks to the use of qPCR (real-time polymerase chain reaction). It reduces false-negative measurements, thanks to the inclusion of an internal control and the high sensitivity that was achieved. The idea of adding spores from B. thuringiensis as internal controls was based on their properties as highly refractory biological structures. The detection of the B. thuringiensis signature sequence cry1 guarantees successful DNA extraction and amplification from any microorganism in the sample [11,12]. The target BuMC was used as a sensitive, specific indicator for the presence of pathogenic Burkholderia strains. The selection of this target based on its presence in multiple copies in all 21 publicly available genomes and its usefulness for sensitive detection was evidenced by the in vitro validation showing lower Cq values (Table 2). However, the benefit of more sensitive detection did not hold for all strains, since BuMC could not be amplified from three of the B. pseudomallei strains tested (Table 2). The absence of this target from the clinical samples is congruent with its absence from strain BD10-00211, which had been isolated from the patient from which the clinical samples were taken. It is possible that the rather diverse species B. pseudomallei[9] contains a phylogenetic cluster that has the absence of the targeted ISBma2 transposase gene as a common feature. Further research is required to substantiate this assumption, however. We did not find any strains that were not detected by the species-specific signature sequences we developed. However, probe design is always limited by the available sequences and strains. Hence, the possibility that some strain exists or could arise which does not possess one of the signature sequences used in this assay cannot be excluded. This is true of any assay, however, and the multiplex qPCR assay described here has the advantage of possessing two signatures for each strain, thus reducing the risk that some strains will escape detection. The measured linearity and efficiency show that the qPCR assay is very suitable for quantitative measurement. The calculated LODs were very low, particularly when based on multicopy target sequence BuMC. The detection limits of 0.2 fg per reaction for B. mallei and 3.7 fg per reaction for B. pseudomallei (Table 3) correspond to approximately 0.03 and 0.5 genomic equivalents respectively. The LODs were lower than or similar to those reported for other assays [6,8,14-19]. However, it is difficult to make a direct comparison between reported LODs due to the differences between the methods used to measure and calculate them, and to measure the DNA concentration of the standards. We used the DNA intercalating dye picogreen for accurate determination of the concentration of double-stranded DNA in our stocks and probit analysis as a basis for robust calculation of the concentration at which the probability of detecting the target is 95% [11]. The high reliability and sensitivity of the qPCR assay described here make it very useful for screening of samples containing few organisms and potential inhibitors, as is the case in many environmental and clinical samples. It can furthermore be used to supplement other assays, including molecular assays based on other signature sequences, for definitive identification. Burkholderiaceae are highly recombining organisms [6,9,10,18] and emerging novel strains will continue to challenge the coverage and sensitivity of detection assays. This qPCR assay offers the potential of continuing to meet this challenge effectively in the foreseeable future.

Conclusions

We designed an assay for rapid and reliable detection of pathogenic Burkholderia spp. The qPCR assay reduces false-negative measurements, due to the inclusion of an internal control and to the high sensitivity that was achieved. Based on a multicopy signature sequence, detection of less than 1 genome equivalent per reaction was possible. Species could be differentiated based on two species-specific signature sequences. The multiplex format limits sample handling, labor and cost per sample. This makes the assay very useful for reliable screening of environmental and clinical samples.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

IJ conceived of and designed the study, performed bioinformatics and probe design, analyzed the data and drafted the manuscript. RAH performed the experimental work and participated in study design and data analysis. AH performed experimental work. BJvR coordinated the work. All authors read and approved the final manuscript.

Pre-publication history

The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1471-2334/13/86/prepub
  19 in total

1.  Glanders in a military research microbiologist.

Authors:  A Srinivasan; C N Kraus; D DeShazer; P M Becker; J D Dick; L Spacek; J G Bartlett; W R Byrne; D L Thomas
Journal:  N Engl J Med       Date:  2001-07-26       Impact factor: 91.245

2.  Genomic plasticity of the causative agent of melioidosis, Burkholderia pseudomallei.

Authors:  Matthew T G Holden; Richard W Titball; Sharon J Peacock; Ana M Cerdeño-Tárraga; Timothy Atkins; Lisa C Crossman; Tyrone Pitt; Carol Churcher; Karen Mungall; Stephen D Bentley; Mohammed Sebaihia; Nicholas R Thomson; Nathalie Bason; Ifor R Beacham; Karen Brooks; Katherine A Brown; Nat F Brown; Greg L Challis; Inna Cherevach; Tracy Chillingworth; Ann Cronin; Ben Crossett; Paul Davis; David DeShazer; Theresa Feltwell; Audrey Fraser; Zahra Hance; Heidi Hauser; Simon Holroyd; Kay Jagels; Karen E Keith; Mark Maddison; Sharon Moule; Claire Price; Michael A Quail; Ester Rabbinowitsch; Kim Rutherford; Mandy Sanders; Mark Simmonds; Sirirurg Songsivilai; Kim Stevens; Sarinna Tumapa; Monkgol Vesaratchavest; Sally Whitehead; Corin Yeats; Bart G Barrell; Petra C F Oyston; Julian Parkhill
Journal:  Proc Natl Acad Sci U S A       Date:  2004-09-17       Impact factor: 11.205

3.  Serological evidence for increased human exposure to Burkholderia pseudomallei following the tsunami in southern Thailand.

Authors:  Vanaporn Wuthiekanun; Wirongrong Chierakul; Jurairat Rattanalertnavee; Sayan Langa; Damrong Sirodom; Charnkij Wattanawaitunechai; Wut Winothai; Nicholas J White; Nicholas Day; Sharon J Peacock
Journal:  J Clin Microbiol       Date:  2006-01       Impact factor: 5.948

4.  Identification and discrimination of Burkholderia pseudomallei, B. mallei, and B. thailandensis by real-time PCR targeting type III secretion system genes.

Authors:  F M Thibault; E Valade; D R Vidal
Journal:  J Clin Microbiol       Date:  2004-12       Impact factor: 5.948

5.  Use of a real-time PCR TaqMan assay for rapid identification and differentiation of Burkholderia pseudomallei and Burkholderia mallei.

Authors:  Jana M U'Ren; Matthew N Van Ert; James M Schupp; W Ryan Easterday; Tatum S Simonson; Richard T Okinaka; Talima Pearson; Paul Keim
Journal:  J Clin Microbiol       Date:  2005-11       Impact factor: 5.948

6.  Case report: melioidosis imported from West Africa to Europe.

Authors:  Juan Cuadros; Horacio Gil; Julio De Miguel; Graciela Marabé; Teresa Arroyo Peña Gómez-Herruz; Bruno Lobo; Ruth Marcos; Pedro Anda
Journal:  Am J Trop Med Hyg       Date:  2011-08       Impact factor: 2.345

7.  Rapid presumptive identification of Burkholderia pseudomallei with real-time PCR assays using fluorescent hybridization probes.

Authors:  Herbert Tomaso; Tyrone L Pitt; Olfert Landt; Sascha Al Dahouk; Holger C Scholz; Emil C Reisinger; Lisa D Sprague; Ilka Rathmann; Heinrich Neubauer
Journal:  Mol Cell Probes       Date:  2005-02       Impact factor: 2.365

8.  Detection and differentiation of Burkholderia pseudomallei, Burkholderia mallei and Burkholderia thailandensis by multiplex PCR.

Authors:  May-Ann Lee; Dongling Wang; Eu Hian Yap
Journal:  FEMS Immunol Med Microbiol       Date:  2005-03-01

9.  Development and comparison of two assay formats for parallel detection of four biothreat pathogens by using suspension microarrays.

Authors:  Ingmar Janse; Jasper M Bok; Raditijo A Hamidjaja; Hennie M Hodemaekers; Bart J van Rotterdam
Journal:  PLoS One       Date:  2012-02-15       Impact factor: 3.240

10.  Structural flexibility in the Burkholderia mallei genome.

Authors:  William C Nierman; David DeShazer; H Stanley Kim; Herve Tettelin; Karen E Nelson; Tamara Feldblyum; Ricky L Ulrich; Catherine M Ronning; Lauren M Brinkac; Sean C Daugherty; Tanja D Davidsen; Robert T Deboy; George Dimitrov; Robert J Dodson; A Scott Durkin; Michelle L Gwinn; Daniel H Haft; Hoda Khouri; James F Kolonay; Ramana Madupu; Yasmin Mohammoud; William C Nelson; Diana Radune; Claudia M Romero; Saul Sarria; Jeremy Selengut; Christine Shamblin; Steven A Sullivan; Owen White; Yan Yu; Nikhat Zafar; Liwei Zhou; Claire M Fraser
Journal:  Proc Natl Acad Sci U S A       Date:  2004-09-17       Impact factor: 11.205

View more
  4 in total

1.  Recent Advances in Burkholderia mallei and B. pseudomallei Research.

Authors:  Christopher L Hatcher; Laura A Muruato; Alfredo G Torres
Journal:  Curr Trop Med Rep       Date:  2015-06

2.  The Identification and Differentiation between Burkholderia mallei and Burkholderia pseudomallei Using One Gene Pyrosequencing.

Authors:  Damian H Gilling; Vicki Ann Luna; Cori Pflugradt
Journal:  Int Sch Res Notices       Date:  2014-10-02

3.  Development and evaluation of a panel of filovirus sequence capture probes for pathogen detection by next-generation sequencing.

Authors:  Jeffrey W Koehler; Adrienne T Hall; P Alexander Rolfe; Anna N Honko; Gustavo F Palacios; Joseph N Fair; Jean-Jacques Muyembe; Prime Mulembekani; Randal J Schoepp; Adeyemi Adesokan; Timothy D Minogue
Journal:  PLoS One       Date:  2014-09-10       Impact factor: 3.240

4.  Evaluation of microbial qPCR workflows using engineered Saccharomyces cerevisiae.

Authors:  S M Da Silva; L K Vang; N D Olson; S P Lund; A S Downey; Z Kelman; M L Salit; N J Lin; J B Morrow
Journal:  Biomol Detect Quantif       Date:  2016-02-19
  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.