Literature DB >> 23378733

A novel missense mutation of the paired box 3 gene in a Turkish family with Waardenburg syndrome type 1.

Filiz Hazan1, A Taylan Ozturk, Hamit Adibelli, Nurettin Unal, Ajlan Tukun.   

Abstract

PURPOSE: Screening of mutations in the paired box 3 (PAX3) gene in three generations of a Turkish family with Waardenburg syndrome type 1 (WS1).
METHODS: WS1 was diagnosed in a 13-month-old girl according to the WS Consortium criteria. Detailed family history of the proband revealed eight affected members in three generations. Routine clinical and audiological examination and ophthalmologic evaluation were performed on eight affected and five healthy members of the study family. Dystopia canthorum was detected in all affected patients; however, a brilliant blue iris was present in five patients who also had mild retinal hypopigmentation. Genomic DNA was extracted from the peripheral blood of affected and unaffected individuals in the family as well as 50 unrelated healthy volunteers. All coding exons and adjacent intronic regions of PAX3 were sequenced directly.
RESULTS: A novel missense heterozygous c.788T>G mutation was identified in eight patients. This nucleotide alteration was not found in unaffected members of the study family or in the 50 unrelated control subjects. The mutation causes V263G amino-acid substitution in the homeodomain of the PAX3 protein, which represents the 45(th) residue of helix 3.
CONCLUSIONS: We identified a novel missense c.788T>G mutation in PAX3 in a family with Waardenburg syndrome with intrafamilial phenotypic heterogeneity.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 23378733      PMCID: PMC3559089     

Source DB:  PubMed          Journal:  Mol Vis        ISSN: 1090-0535            Impact factor:   2.367


Introduction

Waardenburg syndrome (WS), which equally affects both sexes and all races, is an inherited disorder characterized by varying degrees of sensorineural deafness and pigmentary abnormalities affecting the skin, hair, and eye with an incidence of 1 in 40,000 [1,2]. Five major and five minor diagnostic criteria for WS were proposed by the Waardenburg Consortium [3]. Two major or one major and two minor criteria must be found in an individual to diagnose WS [3,4]. WS is classified into four major types depending on the presence or absence of dystopia canthorum and additional symptoms [1,5-8]. WS shows genetic heterogeneity. WS1 and WS3 are caused by mutations in the paired box 3 (PAX3) gene [9-12]. WS2 is due to mutations in the microphthalmia-associated transcription factor (MITF) gene [13-17] and the encoding snail homolog 2 (SNAI2) gene [18]. However, the molecular etiology of most patients with WS2 is still unknown [19]. WS4 is associated with mutations in the endothelin receptor type B (EDNRB) gene [17,20,21], the endothelin-3 (EDN3) gene [22-25], and the SRY (sex determining region Y)-box 10 (SOX10) gene [6,7,19,24]. Recently, deletions in SOX10 were also identified in patients with WS2 and WS4 [26]. PAX3, located on the long arm of chromosome 2 (2q35), includes ten exons [27]. This gene is a member of the mammalian PAX gene family that encodes for DNA-binding transcription factors and plays a role in maintaining stem cell pluripotency, cell-lineage specification, proliferation, migration, apoptosis, and inhibition of terminal differentiation [28,29]. PAX3 is expressed in neural crest cells including the spinal ganglia, the craniofacial mesectoderm, and the limb mesenchyme during embryogenesis and plays an important role in the migration and differentiation of melanocytes, which originate from the embryonic neural crest [17,28]. More than 70 pathogenic PAX3 mutations including missense, nonsense, and frameshifts mutations, small insertions or deletions, and splice alterations have been reported in patients with WS1 [17]. Most PAX3 mutations are located in exon 2; no mutations have been described in exons 9 and 10. Approximately 50% of the described mutations of PAX3 are missense; the remaining are truncating variations [17]. Partial or total gene deletions have been reported in 10% of patients without identified point mutations [30-35]. The literature that studied patients with WS1 caused by mutations in PAX3 was reviewed in 2009 by Pingault et al., and no relationship was found between the severity of disease and the type of mutation [17]. In this report, clinical features and intrafamilial heterogeneity of eight affected individuals in a Turkish family with WS1 with a novel mutation are presented.

Methods

Family description

Eight affected including the proband, and 5 unaffected members of the study family, as well as 50 healthy volunteers were included in the present study. Informed consent conforming to the tenets of the Declaration of Helsinki, blood samples, and clinical evaluations were obtained from each study participant, under protocols approved by Dr. Behçet Uz Children's Hospital ethics committee (approval number and date: B-10-4-ISM-4-35-65-72; 29.03.2012/25). Informed consent conforming to the tenets of the Declaration of Helsinki, blood samples, and clinical evaluations were obtained from each study participant, under protocols approved by the Behçet Uz Children's Hospital ethics committee (approval number and date: B-10–4-ISM-4–35–65–72; 29.03.2012/25). The female patient was referred to us for genetic evaluation because of dysmorphic facial features at the age of 13 months. The proband and her family were evaluated at the Medical Genetics Clinic, Dr. Behçet Uz Children's Hospital, Izmir, Turkey. The proband (Patient IV:6) was diagnosed with WS1 according to the WS Consortium criteria [3]. Her family history revealed eight affected members in three generations (Figure 1). Routine clinical examination and detailed audiological and ophthalmologic evaluation were performed on eight affected and five healthy members of the study family. Two major or one major and two minor criteria must be found in an individual to diagnose WS. In four patients (IV:3, IV:4, IV:5, and IV:6), premature graying of the hair was not evaluated because of the patients’ youth.
Figure 1

The pedigree of the family is shown. The squares indicate men, and the circles indicate women. Filled quadrants indicate phenotype associated with WS1. Upper left represents dystopia canthorum. Lower left represents brilliant blue iris. Upper right represents hearing loss. Lower right represents synophyris.

The pedigree of the family is shown. The squares indicate men, and the circles indicate women. Filled quadrants indicate phenotype associated with WS1. Upper left represents dystopia canthorum. Lower left represents brilliant blue iris. Upper right represents hearing loss. Lower right represents synophyris. Hearing loss was assessed with pure tone audiometry or, in children, with brainstem-evoked response audiometry (BERA). Degree of hearing loss was computed by using a four-frequency average called the pure-tone average. The average of the hearing threshold levels (decibels) taken at 500 Hz, 1000 Hz, 2000 Hz, and 4000 Hz was calculated for each patient to find the pure-tone average level. Afterwards, hearing loss was graded according to the classification defined by J.G. Clark in 1981 [36]. Dystopia canthorum, which is characterized by an increase in the distance between the inner angles of the eyelids with normal distances between the pupils and the outer canthus, was defined for each affected member of the family with a W index that exceeds 1.95 [1].

Mutation analysis

Peripheral blood samples which were collected in EDTA tubes and stored fresh (-20 °C) were obtained from participating members of the family and 50 unrelated healthy volunteers. Genetic analyses were performed in Duzen Laboratory Groups, Genetics Division, Ankara, Turkey. Genomic DNA was extracted from leukocytes using the QIAamp DNA mini kit (Qiagen, 51304, Dusseldorf, Germany), according to manufacturer's instructions. Genomic fragments including coding regions and adjacent intronic regions of PAX3 were amplified with PCR, using nine primer pairs described previously [7] (Table 1). The amplicons from individual exons were purified and analyzed with cycle sequencing with ABI BigDye Terminator Cycle Sequencing Kit v3.1 (ABI Applied Biosystems, Foster City, CA) on an automatic DNA sequencer (ABI 3130 Genetic Analyzer, Applied Biosystems). Sequencing results from patients and the consensus sequences from the NCBI Human Genome Database (NCBI Reference Sequence: NG_011632.1) were imported into the ABI SeqScape program and aligned to identify variations. Each found mutation was confirmed with bidirectional sequencing. The mutation was named following the nomenclature recommended by the Human Genomic Variation Society.
Table 1

Primers for amplifying and sequencing PAX3 genomic fragments [7].

ExonForward primersReverse primersProduct size (bp)
1
5′ GATGGGAAGAGAAAGTGGTC 3′
5′ TGCAGAAAGGAAATCGAGTA 3′
788
2
5′ CCGATGTCGAGCAGTTTCAG 3′
5′ CGCACCTTCACAAACCTCAG 3′
503
3
5′ TGGGATGTGTTCTGGTCTG 3′
5′ TCCCAATAGCTGAGATCGA 3′
420
4
5′ CTGGAGAAGGATGAGGATGT 3′
5′ CGTCAGATCACCAATGTCAG 3′
383
5
5′ TACGGATTGGTTAGACTTGT 3′
5′ AACAATATGCATCCCTAGTAA 3′
508
6
5′ CAACACAGAAGGCAGAGA 3′
5′ ATAGGTACGTTCAGGACAA 3′
445
7
5′ TGTGCAGAGATAGGTGTGAC 3′
5′ TTTGATGAAGCCAGTAGGA 3′
586
8
5′ TCTCCTGGACAGCTCTTTAA 3′
5′ GGCATGTGTGGCTTAATCT 3′
480
9&105′ GGTCAGCTCCAGGATCATAT 3′5′ GCAAATGGAATGTTCTAGCT 3′580

Results

Phenotype analysis

Eight affected patients (five women [III:7, IV:3, IV:4, IV:5, and IV:6] and three men [II:3, III:5, and III:9]) and five nonaffected members (three women [III:2, IV:1, and IV:2] and two men [II:1 and III:1]) of three generations in the study family were enrolled in the present study (Figure 1). Case I:1 was not evaluated in this study as he died before enrollment. The diagnostic criteria for WS proposed by the Waardenburg Consortium and the clinical features of the study patients are shown in Table 2.
Table 2

Diagnostic criteria of WS, and clinical evaluation of affected family members. Two major, or one major and two minor criteria have to be found in an individual to be diagnosed as WS

DIAGNOSTIC CRITERIAFEATURESSTUDY PARTICIPANTS
II-3III-5III-7III-9IV-3IV-4IV-5IV-6
MAJOR
CRITERIA
Sensorineural hearing loss
-
+
-
+
-
-
+
+
Iris pigmentary abnormality (heterochromia iridis, or segmentary heterochromia of the iris, or characteristic brilliant blue iris)
-
+
+
+
-
-
+
+
Hair hypopigmentation (white forelock, white hairs at other sites on the body)
-
-
-
-
-
-
-
-
Dystopia canthorum
+
+
+
+
+
+
+
+
First-degree relative previously diagnosed with Waardenburg syndrome
+
+
+
+
+
+
+
+
MINOR CRITERIASkin hypopigmentation
-
-
-
+
-
-
-
-
Synophrys
+
+
+
+
-
+
-
-
Broad nasal root
-
-
-
-
+
-
+
+
Hypoplasia alae nasi
+
-
+
-
-
-
-
+
Premature graying of the hair (before the age of 30 years)++++N/AN/AN/AN/A

N/A: Not applicable

N/A: Not applicable Dystopia canthorum was detected in all affected patients (Figure 2). A brilliant blue iris was present in five patients who also had mild retinal hypopigmentation (III:5, III:7, III:9, IV:5, and IV:6; Figure 2 and Figure 3). Orthoptic assessments were within normal limits, and nystagmus was not present in affected patients or nonaffected members of the family; however, astigmatic refractive errors were found frequently in all affected members. Synophrys was presented in five out of eight patients (II:3, III:5, III:7, III:9, and IV:4), and this finding was more prominent in two (II:3 and III:9; Figure 2). Clinical features of all unaffected family members (II:1, III:1, III:2, IV:1, and IV:2) were revealed as normal.
Figure 2

Photographs of eyes from patients with Waardenburg syndrome type 1. A: Dystopia canthorum (W index: 2.03) and synophyris were present in a 68-year old man (II:3). B: Dystopia canthorum (W index: 2.08), brilliant blue iris, and synophyris were present in a 32-year old man (III:5). C: Dystopia canthorum (W index: 1.96), brilliant blue iris, and synophyris were present in a 30-year old woman (III:7). D: Dystopia canthorum (W index: 2.35), brilliant blue iris, and synophyris were present in a 26-year old man (III:9). E: Dystopia canthorum (W index: 2.49) and broad nasal root were present in a 5-month old girl (IV:3). F: Dystopia canthorum (W index: 2.19), brilliant blue iris, and broad nasal root were present in a 10-year old girl (IV:5). G: Dystopia canthorum (W index: 2.39), brilliant blue iris, and broad nasal root. W index: 2.39.

Figure 3

Retinal hypopigmentation was seen on the fundus photograph of the proband.

Photographs of eyes from patients with Waardenburg syndrome type 1. A: Dystopia canthorum (W index: 2.03) and synophyris were present in a 68-year old man (II:3). B: Dystopia canthorum (W index: 2.08), brilliant blue iris, and synophyris were present in a 32-year old man (III:5). C: Dystopia canthorum (W index: 1.96), brilliant blue iris, and synophyris were present in a 30-year old woman (III:7). D: Dystopia canthorum (W index: 2.35), brilliant blue iris, and synophyris were present in a 26-year old man (III:9). E: Dystopia canthorum (W index: 2.49) and broad nasal root were present in a 5-month old girl (IV:3). F: Dystopia canthorum (W index: 2.19), brilliant blue iris, and broad nasal root were present in a 10-year old girl (IV:5). G: Dystopia canthorum (W index: 2.39), brilliant blue iris, and broad nasal root. W index: 2.39. Retinal hypopigmentation was seen on the fundus photograph of the proband. Four patients had a sensorineural hearing impairment. Three (III:5, IV:5, and IV:6) were profoundly and one (III:9) was moderately deaf. Out of the three profoundly deaf patients, two (IV:5 and IV:6) had received a cochlear implant. None had a white forelock, whereas premature graying of the hair (before the age of 30 years) was present in patients II:3, III:5, III:7, and III:9. Due to the patients’ youth, premature graying of the hair was not evaluated in four patients (IV:4 was 15 years old, IV:5 was 10 years old; IV:3 and IV:6 were younger than 2 years old). Hypopigmented patches of the skin were present in only one patient (III:9; Table 2). No patients had limb defects. After direct sequencing of PAX3, a heterozygous change T>G in exon 5, at position 788 of the translation start site was detected in all affected patients (Figure 4A). This position belongs to helix 3 of the homeodomain in the PAX3 protein, and converts the 45th amino acid in this domain from valine to glycine. This mutation was not found in the other unaffected relatives (II:1, III:2, IV:1, and IV:2) in the healthy controls (Figure 4B). Case III:1 declined the molecular genetic analysis.
Figure 4

Sequence chromatography. A: The heterozygous change, c.788T>G, was identified in affected family members. B: Unaffected members and 50 healthy controls are wild-type at this position.

Sequence chromatography. A: The heterozygous change, c.788T>G, was identified in affected family members. B: Unaffected members and 50 healthy controls are wild-type at this position.

Discussion

A careful clinical evaluation is necessary to differentiate various types of WS. Dystopia canthorum is a commonly seen feature of WS with an incidence of 41.2% to 99% [1,2]. However, dystopia canthorum is also the most penetrant (%99) and the most distinguishing feature of WS1 [1,2,6,37,38]. All affected patients in the present study had dystopia canthorum. In 2006, the frequencies of heterochromia iridis and synophrys were reported as 25% and 45% of WS1 patients, respectively [6]. However, incidence of synophrys in patients with WS1 was reported as 85% in a review published in 2009 [17]. Although a brilliant blue iris was present in five out of eight patients, heterochromia iridis was not detected in any members of the study family. However, synophrys, a minor criterion, was also present in five out of eight patients. WS accounts for approximately 2% to 5% of congenital sensorineural deafness [30,39]. Congenital sensorineural deafness is a feature in approximately 25% to 75% of patients with WS1 [17,40,41]. Deafness related to WS can be moderate to severe, unilateral, or bilateral but most commonly non-progressive [40,42]. In our study, three patients had total bilateral severe sensorineural deafness, and one patient had moderate bilateral deafness. Hearing tests were normal in the other four affected patients and five unaffected members of the family. However, Wang et al. reported a lack of deafness among their Chinese patients with WS1, and indicated a possible ethnic specific variation in clinical expression of the syndrome [43]. The incidence of hearing loss among Turkish patients with WS1 was published as 75% by Oysu et al. in 2000 [40]. Hearing loss was present in 50% of our study patients with WS1, which is in accordance with the literature [17,30,39-42]. Mutations of PAX3 on chromosome 2q37 have been reported in 33% to 80% of patients with WS1 in familial and sporadic cases [3,7,13,44]. PAX3 is a transcription factor that plays a major role in embryogenesis [45]. By 2009, about 70 mutations of PAX3 related to WS had been introduced [17]. The PAX3 protein is a member of the family of paired domain proteins that bind DNA and regulate gene expression [7]. PAX3 encodes a paired domain and a homeodomain [6]. Missense mutations are almost exclusively located within the two DNA binding domains. One, the homeodomain, includes three α-helices. Most PAX3 mutations are located in the paired domain or in helix 3 of the homeodomain [6]. Helix 3 of the homeodomain makes sequence-specific DNA contacts and several phosphate contacts in the major groove [6,7]. Mutations that affect helix 3 of the homeodomain in the PAX3 protein may lead to a decrease in DNA binding affinity and/or specificity [7]. We identified the novel c.788T>G mutation in PAX3 leading to V→G substitution on the 45th position of helix 3. The phenotypic variability among the eight affected patients with the same mutation is well matched with inheritance properties of the disease. PAX3 mutations are inherited dominantly with variable expressivity [43]. The disease is known as fully penetrant when at least one of its signs is detected, but the penetrance for each one is not complete. The fact that there is no obvious association between different types of mutations and the severity of disease could be due to the role of gene dosage as the pathophysiology of the syndrome. It is hypothesized that stochastic events were not solely responsible for its expression, so that genetic factors and/or the environmental background can modify the phenotype [17]. A few mutations of PAX3 have been tested for their functional consequences. The functional experiments mostly included DNA-binding activity and transactivation capabilities. Although missense mutations are thought to abolish PAX3 ability to bind and activate its transcriptional targets, further functional studies are necessary to evaluate the precise molecular mechanism caused by the c.788T>G mutation. In conclusion, we identified a novel missense mutation in PAX3 that is associated with the occurrence of WS1. The new mutation, like all other defined mutations, lead to phenotypic variability within the same family, which is one of the most important features of the disease.
  44 in total

Review 1.  Clinical features of the Waardenburg syndromes.

Authors:  Valerie E Newton
Journal:  Adv Otorhinolaryngol       Date:  2002

2.  Waardenburg syndrome: case report.

Authors:  Anna Krishtul; Ibrahim Galadari
Journal:  Int J Dermatol       Date:  2003-08       Impact factor: 2.736

Review 3.  Worldwide distribution of Waardenburg syndrome.

Authors:  Chetan S Nayak; Glenn Isaacson
Journal:  Ann Otol Rhinol Laryngol       Date:  2003-09       Impact factor: 1.547

4.  Waardenburg syndrome: a report of three cases.

Authors:  Sudip Kumar Ghosh; Debabrata Bandyopadhyay; Arghyaprasun Ghosh; Surajit Kumar Biswas; Rajesh Kumar Mandal
Journal:  Indian J Dermatol Venereol Leprol       Date:  2010 Sep-Oct       Impact factor: 2.545

5.  Uses and abuses of hearing loss classification.

Authors:  J G Clark
Journal:  ASHA       Date:  1981-07

6.  Audiometric manifestations of Waardenburg's syndrome.

Authors:  C Oysu; N Baserer; M Tinaz
Journal:  Ear Nose Throat J       Date:  2000-09       Impact factor: 1.697

7.  SLUG (SNAI2) deletions in patients with Waardenburg disease.

Authors:  Manuel Sánchez-Martín; Arancha Rodríguez-García; Jesús Pérez-Losada; Ana Sagrera; Andrew P Read; Isidro Sánchez-García
Journal:  Hum Mol Genet       Date:  2002-12-01       Impact factor: 6.150

8.  Apparent non-penetrance for dystopia in Waardenburg syndrome type I, with some hints on the diagnosis of dystopia canthorum.

Authors:  S Arias; M Mota
Journal:  J Genet Hum       Date:  1978-06

9.  Homozygous and heterozygous inheritance of PAX3 mutations causes different types of Waardenburg syndrome.

Authors:  Bernd Wollnik; Turgut Tukel; Oya Uyguner; Asadollah Ghanbari; Hulya Kayserili; Melike Emiroglu; Memnune Yuksel-Apak
Journal:  Am J Med Genet A       Date:  2003-09-15       Impact factor: 2.802

10.  Hearing loss and Waardenburg's syndrome: implications for genetic counselling.

Authors:  V Newton
Journal:  J Laryngol Otol       Date:  1990-02       Impact factor: 1.469

View more
  6 in total

1.  GENETIC DISORDERS OF PITUITARY DEVELOPMENT IN PATIENTS WITH SHEEHAN'S SYNDROME.

Authors:  H Diri; E F Sener; F Bayram; M Dundar; Y Simsek; O Baspinar; G Zararsiz
Journal:  Acta Endocrinol (Buchar)       Date:  2016 Oct-Dec       Impact factor: 0.877

2.  Anterior ethmoidal artery emerging anterior to bulla ethmoidalis: An abnormal anatomical variation in Waardenburg's syndrome.

Authors:  Danny K C Wong; Angus Shao; Raewyn Campbell; Richard Douglas
Journal:  Allergy Rhinol (Providence)       Date:  2014-01

3.  Whole genome genotyping mapped regions on chromosome 2 and 18 in a family segregating Waardenburg syndrome type II.

Authors:  Maan Abdullah Albarry; Ahdab Qasem Alreheli; Alia M Albalawi; Sulman Basit
Journal:  Saudi J Ophthalmol       Date:  2019-09-18

4.  Frameshift variant in MITF gene in a large family with Waardenburg syndrome type II and a co-segregation of a C2orf74 variant.

Authors:  Maan Abdullah Albarry; Muhammad Latif; Ahdab Qasem Alreheli; Mohammed A Awadh; Ahmad M Almatrafi; Alia M Albalawi; Sulman Basit
Journal:  PLoS One       Date:  2021-02-11       Impact factor: 3.240

Review 5.  A review of the revisions and complications management procedure in sinus surgery.

Authors:  Sara Khademi; Aida Kazemi; Reza Divanbeigi; Mohamadreza Afzalzadeh
Journal:  J Family Med Prim Care       Date:  2022-03-10

6.  PAX3 gene deletion detected by microarray analysis in a girl with hearing loss.

Authors:  Malgorzata Drozniewska; Olga Haus
Journal:  Mol Cytogenet       Date:  2014-04-29       Impact factor: 2.009

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.