Literature DB >> 23349658

Regulation of cel genes of C. cellulolyticum: identification of GlyR2, a transcriptional regulator regulating cel5D gene expression.

Imen Fendri1, Laetitia Abdou, Valentine Trotter, Luc Dedieu, Hédia Maamar, Nigel P Minton, Chantal Tardif.   

Abstract

Transcription and expression regulation of some individual cel genes (cel5A, cel5I, cel5D and cel44O) of Clostridium cellulolyticum were investigated. Unlike the cip-cel operon, these genes are transcribed as monocistronic units of transcription, except cel5D. The location of the transcription initiation sites was determined using RT-PCR and the mRNA 5'-end extremities were detected using primer extension experiments. Similarly to the cip-cel operon, cel5A and cel5I expressions are regulated by a carbon catabolite repression mechanism, whereas cel44O and cel5D expressions do not seem to be submitted to this regulation. The role of the putative transcriptional regulator GlyR2 in the regulation of cel5D expression was investigated. The recombinant protein GlyR2 was produced and was shown to bind in vitro to the cel5D and glyR2 promoter regions, suggesting that besides regulating its own expression, GlyR2 may regulate cel5D expression. To test this hypothesis in vivo, an insertional glyR2 mutant was generated and the effect of this disruption on cel5D expression was evaluated. Levels of cel5D mRNAs in the mutant were 16 fold lower than that of the wild-type strain suggesting that GlyR2 acts as an activator of cel5D expression.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 23349658      PMCID: PMC3551867          DOI: 10.1371/journal.pone.0044708

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Clostridium cellulolyticum, an anaerobic mesophilic bacterium produces numerous enzymes that efficiently degrade cellulose and hemicelluloses, the major polymers of plant cell walls [1]. Most of the known enzymes are assembled into high molecular mass enzymatic complexes named cellulosomes [1], [2]. These extracellular complexes act very efficiently on crystalline cellulose [3], liberating soluble oligosaccharides which are used by the bacteria as carbon and energy sources [4]. Each complex is composed of up to eight enzymatic units bound to one scaffoldin (CipC) [5], [6]. This scaffoldin contains cohesin modules that serve as anchoring points for the enzymes via a strong interaction with enzyme-born dockerin modules [7]. Cellulosomes produced by C. cellulolyticum grown on cellulose contain at least thirty six dockerin-containing proteins [8]. The majority of these proteins are Glycoside Hydrolases belonging to families 5, 8, 9, 10, 11, 18, 26, 27, 44, 48 and 74 of the CAZy database (http://www.cazy.org) [8]. Sixty two ORFs that potentially encode dockerin-containing proteins were recently found in the genome sequence of Clostridium cellulolyticum strain ATCC 35319 (http://www.ncbi.nlm.nih.gov; GI: 220927459). All these genes are largely distributed on the chromosome, except two large clusters. The cip-cel cluster begins with the gene encoding the scaffolding protein CipC [9] followed by the gene encoding the major cellulosomal cellulase Cel48F and nine other dockerin-bearing enzymes. The xyl-doc cluster encodes 14 cellulosomal hemicellulases [10]. How the organism regulates the expression of such large number of genes for biomass degradation remains a standing question. It is also unknown how the bacteria sense the presence in their environment of plant cell wall polymers that are typically insoluble substrates [11] and incapable of diffusing into the cell, and what signaling mechanisms it uses to regulate gene expression accordingly. The cellulases encoded by the cip-cel cluster are essential for the building of efficient cellulose-degrading cellulosomes [12].Transcriptional analysis of the cip-cel cluster showed that it was an operon with a primary transcript processed in varying-size transcripts. The most stable secondary transcripts carry cipC, cel48F and cel9E [13]. Messenger processing thus appears to participate in the regulation of cellulolysis gene expression. The operon promoter is located at around – 650 bases upstream the cipC start codon and its activity is strongly influenced by surrounding sequences [13], [14]. These variations may be due to the sequence-dependent conformation of the region and/or to the binding of a combination of “regulators” upstream and/or downstream from the promoter site. A catabolite-responsive element (CRE) located 414 nucleotides downstream from the transcriptional start site was found to be involved in a carbon catabolite repression mechanism of regulation [14]. It is still unknown if the expression of the various individual cel genes is subject to any type of regulation. Among the well known cel genes from C. cellulolyticum, cel5A and cel5D encode cellulosomal family 5 endocellulases which exhibit similar substrate specificities [15], [16]. cel5I [17] encodes another family 5 cellulase which do not bear any dockerin-module; its three C-terminal S-Layer Homolog sequences highly suggest a cell surface location. The latter gene is preceded by another cel gene but in the opposite direction: cel44O [18], which codes for a cellulosomal protein. Here we characterize the transcripts of these genes and measure their expression levels in cellulose based media. Using promoter transcriptional fusions, we show that the cel44O promoter is stronger than those of cel5A, cel5D and cel5I and that the four genes appear to be subjected to diverse regulations: cel5A and cel5I are submitted to carbon catabolite repression, whereas cel44O does not. GlyR2, a novel transcriptional regulator belonging to the AraC/XylS family encoded by a gene upstream of cel5D [18] is shown to be involved in the regulation of cel5D.

Materials and Methods

Bacterial strains, plasmids and culture conditions

Escherichia coli DH5α and BL21 (DE3) Rosetta pLysS were used as the host strain for routine cloning and for GlyR2 production, respectively. Luria-Bertani (LB) broth, Turbo broth and LB agar were used for E. coli liquid and solid cultures, respectively. C. cellulolyticum ATCC 35319 and derivative strains were grown anaerobically at 32°C in basal medium (BM) or minimal medium (MM) supplemented with cellobiose (2 g liter−1; Sigma), MN300 cellulose (5 g liter−1; Serva), or MN300 cellulose (5 g liter−1) plus cellobiose at a concentration of 4 g liter−1 [3]. Colonies of C. cellulolyticum were isolated on solid medium (basal medium supplemented with 8 g liter−1 agar). pGEM-T Easy (Promega) was used as the PCR cloning vector in E. coli and pPSV as shuttle vector for the quantification of promoter activity in C. cellulolyticum [14]. pET22b+ was used as overproducing vector for GlyR2 production in E. coli. pMTL007 was used as described by John T. Heap et al for gene inactivation in C. cellulolyticum [19]. Competent cells of C. cellulolyticum were prepared and electrotransformed as previously described [20]. The concentrations of the antibiotics used for selection were as follows: ampicillin, 100 µg ml−1 and chloramphenicol, 34 µg ml−1 for E. coli; erythromycin, 10 µg ml−1 and thiamphenicol, 2.5 µg ml−1 for C. cellulolyticum.

RNA isolation

Total RNAs were isolated from cells grown on cellulose-containing BM (800 ml). The cells were collected at the end of the exponential phase of growth (6 days) by pipetting, taking care to not disturb the sedimented cellulose. After centrifugation, cells were resuspended in 2.5 ml of lysis buffer (30 mM Tris-HCl, pH 8, 100 mM NaCl, 5 mM EDTA, 1% SDS) and RNAs were purified as previously described [13], [21]. Total RNAs were quantified by spectrophotometric analysis at 260 nm using a Nanodrop 2000C apparatus (Thermo Scientific). PCRs were performed to check the absence of DNA.

Northern blot analysis

RNAs were denatured in RNA sample buffer (50% formamide, 40 mM MOPS [morpholinopropanesulfonic acid; pH 7], 10 mM sodium acetate, 1 mM EDTA, 2.2 M formaldehyde, 8.33% glycerol) at 65°C for 5 min and separated by electrophoresis through 0.8% agarose gel containing formaldehyde (0.22 M) in running buffer (40 mM MOPS [pH 7], 10 mM sodium acetate, 1 mM EDTA, 0.22 M formaldehyde). RNAs were transferred overnight to a positively charged nylon membrane (Roche Applied Science) by capillary transfer using 20× SSC buffer (1.5 M NaCl, 0.15 M sodium citrate [pH 7]; Promega), and hybridized with an excess of α 32P-labeled antisense RNA probes in the Ultra-Hyb hybridization solution (Ambion) at 68°C overnight [13]. Hyperfilm (Amersham Biosciences) were used for autoradiography. The different antisense RNA probes were synthesized from the linearized appropriate constructs [pSPT18celA, pSPT18celI (pSPT18 derivatives carrying a 1-kb fragment of cel5A and cel5I, respectively), pGEM-TcelO and pGEM-TcelD (pGEM-T Easy derivatives carrying a 1-kb fragment of cel44O and cel5D, respectively)] by in vitro runoff transcription using the SP6 or the T7 RNA polymerase (Roche Applied Science) as previously described [13].

RT-PCR

Analytic RT-PCRs were performed from 100 ng of total RNA with the Titan One Tube RT-PCR kit (Roche Applied Science) as previously described [13]. Products were displayed on a 2% agarose gel and visualized by staining with ethidium bromide. For quantitative RT-PCRs, 500 ng to 1 µg of total RNAs were reverse transcribed using Superscript III (Invitrogen) and 100 ng of random primers according to the manufacturer procedure. The cDNAs were mixed along with 150 nmoles of primers (Table 1) and were then subjected to qRT-PCR using an Eppendorf Mastercycler ep realplex and SYBR Premix Ex Taq, according to the manufacturer specifications (Takara). The rpoD gene target was used as an internal control. Data analysis and normalization were performed with the software supplied with the Mastercycler.
Table 1

Primers used in the study.

For construction of the His6-tagged GlyR2 protein
His6-GlyR2 Forward CCCTATACATATGATTAATGACAATCAATCAATATTTAAT
His6-GlyR2 Reverse GTGCTCGAGCAATTTGTATTTTGCTTTTGTGAAACCG
For catP gene reporter transcriptional fusions
PrA Forward TTAGTAAATCTTAAGCCAATAAAGC
PrA Reverse TAATAATAATAGTGGTAGCAGTAGAA
PrD Forward GGGATACAAGTAAGAGATTTAA
PrD Reverse GTATTAATTTTACATATTATCTAAT
PrO Forward/PrI Reverse GTATAAGGTTAAATAATTGGAAATCA
PrO Reverse./PrI Forward TTTATGTTTTTTACTCATTCGCTGG
For RT- PCR
AD1 GTAATTCTTTGGATAATCGG
AD2 GTAATTAACTGTAAAATTTGCAATT
AD3 CGAGGTCATTGGTACATCC
AR1 CCCTTGATTAATAATAATAGTGG
DD1 AATATGTAAAATTAATACAGGGG
DR1 AAGTGTATGCTGATCCCAACG
DD2 GTCATTAATCATACTATCTTCC
DR2 AATAATACTGCACGATATAATCAG
DD3 CGTTGATGCAATAAACCTC
GlyR1 CATTTGTAATCCAATAAGGGGAAG
GlyD1 AATTAGTACTATTTAAATCCTAGTAAGG
GlyD2 CATAGCACTCAATTGTAATATATTACTC
GlyD3 CCCTGTATTAATTTTACATATTATC
OR1 ATCAGTTATTACTACACCCGGTTC
OD1 GAATTAATTATCATTTGCCAACATTGG
OD2 TCAAATTTTTATAAATCGCCC
OR2 TCATTCGCTGGCATTTGAGATAAA
OD3 GTTTTATGGACAATTGATTTATGGTG
OD4 CCATTCTGATACTAAGGCAATCAATAC
ID1 CATATTAAATTGTAAATCAATCCTAC
ID2 GCATACATTATATATACAGTTCTCC
ID3 CACCATAAATCAATTGTCCATAAAAC
IR1 GAATTCTTTTATTGATGTTTCTA
For qRT-PCR
5’qtcel5D TTCGAAGGTGCTATGCAGTG
3’qtcel5D GCCATTTCTCCCAATCTTGA
5’qtrpoD TGGATGCCTTTGAGGAAATC
3’qtrpoD TTAAAAGGGGGACCTTACCG
For construction of GlyR2 mutant
GlyR2 IBS AAAAAAGCTTATAATTATCCTTAATTATCCTTTTGGTGCGCCCAGATAGGGTG
GlyR2 EBS1d CAGATTGTACAAATGTGGTGATAACAGATAAGTCCTTTTGAATAACTTACCTTTCTTTGT
GlyR2 EBS2 TGAACGCAAGTTTCTAATTTCGATTATAATTCGATAGAGGAAAGTGTCT
EBS univ CGAAATTAGAAACTTGCGTTCAGTAAAC
For primer extension
DR2 AATAATACTGCACGATATAATCAG
GlyR2 CAATTTCTAGTATTAATATAATGATAACAC
OR2 TCATTCGCTGGCATTTGAGATAAA
IR2 TATTGCATCACTTATATTTCGCTGT
AR2 CATAAAGTGCTGTATTTCTTAC
For probe synthesis (EMSA)
GlyR1 CATTTGTAATCCAATAAGGGGAAG
DR3 GGCGTCGAACTGGAAAGTG
GlyR2 CAATTTCTAGTATTAATATAATGATAACAC
DR1 AAGTGTATGCTGATCCCAACG

Primer extension

Total RNA was reverse transcribed using the Superscript III reverse transcriptase (Invitrogen) and a radioactive 5′-end-labeled primer as previously described [13]. Extension products were analyzed on a 6% polyacrylamide sequencing gel. To map the exact transcriptional start site, sequencing reaction mixtures were used as ladders. The sequencing reactions were performed on recombinant plasmids containing the C. cellulolyticum DNA region analyzed by primer extension. The Thermo Sequenase Cycle Sequencing kit (USB) was used for all sequencing reactions according to the supplier's protocol.

GlyR2 cloning and purification

To construct a His-tagged version of the GlyR2 protein, the coding region was amplified by PCR from C. cellulolyticum genomic DNA using the primers His6-GlyR2 Forward and His6-GlyR2 Reverse (Table 1) which incorporated the NdeI and XhoI restriction sites, respectively. The amplicon was digested with the appropriated enzymes and ligated with NdeI/XhoI-digested pET22b+. E. coli BL21 (DE3) Rosetta pLysS cells were transformed with the resulting plasmid named pETglyR2. The recombinant strain was grown at 37°C in Terrific Broth with ampicillin and chloramphenicol up to OD600 = 0.5 before induction by adding 50 µM IPTG and further incubation during 16 h at 17°C. The harvested cells were disrupted with a French press. The soluble extract in 30 mM Tris-HCl buffer (pH 8) was loaded onto a Nickel-nitrilotriacetic acid (Ni-NTA) column (Qiagen). His-tagged proteins were eluted with 30 mM Tris-HCl (pH 8) 250 mM imidazole (Fluka) buffer. The eluted fraction was dialyzed against 30 mM KH2PO4 buffer (pH 6.5) and concentrated using a microconcentator (10-kDa cutoff), (Vivaspin, Vivasciences) before loading onto the cation exchange chromatography-S Sepharose Fast Flow column (GE Health Care Life Sciences) equilibrated with the same buffer. The protein was eluted with a step gradient of NaCl and was found in the fraction containing 1 M NaCl. The 30 mM Tris-HCl buffer (pH 8) dialyzed protein was analyzed by SDS-PAGE for purity estimation. GlyR2 represented ∼20% of the enriched fraction. The protein concentration was estimated by the method of Lowry [22] at 1 g.L−1 (∼200 ng.L−1 of GlyR2).

Electrophoretic Mobility Shift Assays (EMSA)

The DNA fragments containing promoters glyR2 and cel5D were amplified by PCR using GlyR2/DR1 and GlyR1/DR3 primers, respectively (Table 1), purified on 1% agarose gel and 3′-end labeled with biotin using a Biotin 3′-End DNA Labeling Kit (PIERCE). All EMSA were performed on 6% polyacrylamide gels in 30 mM Tris-glycin (pH 8.3), 1 mM EDTA buffer. Each EMSA reaction mixture contained 10 µg of sonicated herring sperm DNA, 1× LightShift EMSA kit binding buffer (Pierce), 1× LightShift loading dye (Pierce), and appropriate amounts of the DNA probe and the protein preparation. For competitive inhibition of the binding reaction, 100× of unlabeled fragment was added to the mixture. EMSA gels were electro-blotted onto Whatman Biometra Fastblot. Signal development followed the LightShift Chemiluminescent EMSA kit protocol (Pierce) with BioMax films (Kodak) for luminescence detection.

Construction of catP transcriptional fusion and chloramphenicol acetyl-transferase (CAT) assays

The cel5A, cel5D, cel5I and cel44O promoter regions (−653 to −20, −797 to −15, −854 to −16, −856 to −18/ATG, respectively), were amplified by PCR from C. cellulolyticum genomic DNA using the primer pairs PrA Forward/PrA Reverse, PrD Forward/PrD Reverse, PrI Forward/PrI Reverse and PrO Forward/PrO Reverse, respectively (Table 1). The amplicons were inserted into the pGEM-T Easy vector. The pPSVcelA, pPSVcelD, pPSVcelI and pPSVcelO vectors containing transcriptional fusions were constructed by ligating the SphI-SacI fragments from recombinant pGEM-T Easy vectors with the pPSV promoter probe vector digested with the same enzymes. The pPSV derivatives were transferred to C. cellulolyticum by electrotransformation. Transformants were isolated on selective solid medium containing 10 µg mL−1 as previously described [14]. CAT activities, expressed in nanomoles per minute per mg of protein, were measured as previously described [14].

Mutant construction

C. cellulolyticum glyR2 was constructed as described by Heap et al [19], using a mutagenesis system based on the mobile group II intron from the ltrB gene of Lactococcus lactis (Ll.ltrB) adapted to function in clostridial hosts. The intron sequence was adapted to the target by replacing part of the intron carried by the pMTL007 shuttle plasmid by a PCR fragment. Primers used (Table 1) for the synthesis of the PCR fragments were designed using the TargeTron Design Site (sigma-aldrich.com/targetronaccess). Competent cells of C. cellulolyticum were prepared and electrotransformed as previously described [20]. Transformant selection was based on thiamphenicol resistance. Integrants were selected on erythromycin-containing medium after overnight induction with 3 mM IPTG. The absence of glyR2 transcript in the mutant strain was confirmed using quantitative RT-PCR.

Results

cel5A transcription

cel5A was found to be transcribed as a monocistronic transcription unit of approximately 1.8 kb (Fig. 1A). The length of the mRNA is consistent with the length of the cel5A ORF (1425 bases) located upstream a putative Rho independent transcription termination site [23]. The location of the transcription initiation site was investigated using three different methods with independent mRNA preparations from cells grown on cellulose containing medium. A RT-PCR analysis showed that it is located upstream position −381/ATG (Fig. 2A, Fig. 3B). A primer extension analysis, carried out using the radiolabeled primers A-R1 and A-R2 (Fig. 3A) showed that three products were obtained with A-R2, whereas no short elongation product was obtained with A-R1 (data not shown). This analysis revealed two main 5′ ends: one might correspond to a start located at −383/ATG (Fig. 3B), which is consistent with the result obtained by RT-PCR analysis, and the second is located at −327/−328/ATG. Two faint bands corresponding to minor mRNA species were observed. It can be noticed that these 5′ends are located upstream and downstream of a putative secondary structure which might interfere with the extension procedure. The longest mRNAs was detected by RACE (GeneRacer kit, Invitrogen), in addition to several shorter mRNAs corresponding to the mRNA species revealed by primer extension (data not shown).
Figure 1

Northern blot analysis of transcripts of cel5A (A), cel44O (B), cel5I (C) and cel5D (D).

Total RNAs purified from cells grown on cellulose-containing medium (ten micrograms in A, B, C and 40 micrograms in D) were separated by denaturing electrophoresis, transferred to nylon membrane and hybridized with gene-specific radioactive riboprobes.

Figure 2

RT-PCR analysis of transcripts of cel5A (A), cel44O and cel5I (B) and, cel5D and glyR2 (C).

The cDNAs reverse transcripts obtained from total RNAs purified from cells grown in cellulose-containing medium, were amplified with the indicated pairs of primers (see Fig. 3, 4 and 5 for their locations and Table 1 for their sequences). Amplicons were analyzed by electrophoresis in 0.7% agarose gel (lanes RT). −, PCRs performed on RNAs in the absence of RT; +, PCRs performed on genomic DNA.

Figure 3

Primer extension analysis (A) and promoter region sequence (B) of cel5A.

The A-R2 end-labeled primer was used to identify 5′ends of transcripts (lane PE in A, highlighted bold characters in B) and to generate the sequencing ladder on an 8% (wt/vol) sequencing gel. To allow direct comparison with the sequence of the strand corresponding to mRNA shown in part B, the lanes in part A are labeled with the complementary bases. The putative −35 and −10 sequences are indicated in bold italics, the putative promoter region is overlined (-----); the ORF and the putative CRE element are highlighted; the primers used for RT-PCR analysis (Fig. 2) are indicated by arrows, and inverted repeats by convergent arrows. Leader sequence starts at the +1 position of each gene and ends just before the start codon of the coding region.

Northern blot analysis of transcripts of cel5A (A), cel44O (B), cel5I (C) and cel5D (D).

Total RNAs purified from cells grown on cellulose-containing medium (ten micrograms in A, B, C and 40 micrograms in D) were separated by denaturing electrophoresis, transferred to nylon membrane and hybridized with gene-specific radioactive riboprobes.

RT-PCR analysis of transcripts of cel5A (A), cel44O and cel5I (B) and, cel5D and glyR2 (C).

The cDNAs reverse transcripts obtained from total RNAs purified from cells grown in cellulose-containing medium, were amplified with the indicated pairs of primers (see Fig. 3, 4 and 5 for their locations and Table 1 for their sequences). Amplicons were analyzed by electrophoresis in 0.7% agarose gel (lanes RT). −, PCRs performed on RNAs in the absence of RT; +, PCRs performed on genomic DNA.
Figure 4

Primer extension analyses of cel44O and cel5I (A and C) and the intergenic sequence (B).

The O-R2 and I-R2 end-labeled primers were used to identify 5′ends of transcripts (lane PE in A and C, respectively, highlighted bold characters in B) and to generate the sequencing ladders on an 8% (wt/vol) sequencing gel. The DNA strand shown in B corresponds to the mRNA strand of cel5I. The first base found at the 5′-end extremity of cel44O mRNA being an A (see part A), it corresponds to a bold highlighted T in the sequence shown in B. ORFs, putative promoter regions, CRE element, primers, leader sequences and inverted repeats are indicated as in Fig. 3.

Figure 5

Primer extension analyses of cel5D (A) and glyR2 (C) and the intergenic sequence between glyR2 and cel5D (B).

The D-R2 and Gly-R2 end-labeled primers were used to identify 5′ends of transcripts of cel5D (A) and glyR2 (C), respectively (lane PE in A and C, highlighted bases in B) and to generate the sequencing ladder on a 8% (wt/vol) sequencing gel. The DNA strand shown in B corresponds to the mRNA strand of cel5D. The first base found at the 5′-end extremity of glyR2 mRNA being an A (see part C), it corresponds to a bold highlighted T in the sequence shown in B. The lanes in parts A and C, ORF, putative promoter regions, primers, leader sequences and inverted repeats are indicated as in Fig. 3.

Primer extension analysis (A) and promoter region sequence (B) of cel5A.

The A-R2 end-labeled primer was used to identify 5′ends of transcripts (lane PE in A, highlighted bold characters in B) and to generate the sequencing ladder on an 8% (wt/vol) sequencing gel. To allow direct comparison with the sequence of the strand corresponding to mRNA shown in part B, the lanes in part A are labeled with the complementary bases. The putative −35 and −10 sequences are indicated in bold italics, the putative promoter region is overlined (-----); the ORF and the putative CRE element are highlighted; the primers used for RT-PCR analysis (Fig. 2) are indicated by arrows, and inverted repeats by convergent arrows. Leader sequence starts at the +1 position of each gene and ends just before the start codon of the coding region.

cel44O and cel5I transcription

cel44O and cel5I are adjacent divergent genes. Their ORFs (2586 and 2793 bases, respectively) are separated by 871 bp. They are both transcribed as monocistronic transcription units of 2.7 and 2.9 kb-long mRNAs, respectively (Fig. 1B and C) which end with a putative Rho-independent terminator 51 and 63 bases after the stop codon, respectively. The location of their transcription initiation sites was investigated using RT-PCR (Fig. 2B). As shown in figure 4B, the cel44O transcription initiation site is located upstream from the OD-3 and downstream from the OD-4 primers positions (−392 and −545/cel44O ATG, respectively). The cel5I transcription initiation site is located in the same area of the intergenic region upstream from position −505 and downstream from position −579/cel5I ATG. Low quantities of amplicons were obtained using RT-PCR on the 5′ extremity of the messengers. This result highly suggests that there are lower quantities of the 5′end-long messengers than of shorter ones, which might be explained by either the presence of two promoters, an in vivo processing event, or in vitro degradation of the mRNAs. The 5′-end extremities, detected using primer extension experiments on another set of mRNAs (Fig. 4A and C), are close to the promoter region located by RT-PCR in the case of cel44O whereas they are distant in the case of cel5I.

Primer extension analyses of cel44O and cel5I (A and C) and the intergenic sequence (B).

The O-R2 and I-R2 end-labeled primers were used to identify 5′ends of transcripts (lane PE in A and C, respectively, highlighted bold characters in B) and to generate the sequencing ladders on an 8% (wt/vol) sequencing gel. The DNA strand shown in B corresponds to the mRNA strand of cel5I. The first base found at the 5′-end extremity of cel44O mRNA being an A (see part A), it corresponds to a bold highlighted T in the sequence shown in B. ORFs, putative promoter regions, CRE element, primers, leader sequences and inverted repeats are indicated as in Fig. 3.

cel5D transcription and regulation

Several cel5D messengers were detected on Northern blot (Fig. 1D). The largest one of around 3 kb-long might carry cel5D (ORF of 1.75 kb) and the two genes located downstream from cel5D: a transferase (ORF of 0.33 kb) and an integrase gene (ORF of 0.66 kb). A Rho independent terminator with a low stability (ΔG = −11.2 kcal/mol, calculated with the program RNAfold) was found at 56 bases after the cel5D stop codon and might stop the transcription in a fraction of transcripts producing a shorter transcript (Fig. 1D). The transcription initiation site was localized using RT-PCR (Fig. 2C) upstream from position −344 and downstream from position −614/cel5D ATG. Primer extension experiments detected 5′-ends far away from the promoter region (Fig. 5A and B). These truncated mRNAs were also detected using RACE (data not shown).

Primer extension analyses of cel5D (A) and glyR2 (C) and the intergenic sequence between glyR2 and cel5D (B).

The D-R2 and Gly-R2 end-labeled primers were used to identify 5′ends of transcripts of cel5D (A) and glyR2 (C), respectively (lane PE in A and C, highlighted bases in B) and to generate the sequencing ladder on a 8% (wt/vol) sequencing gel. The DNA strand shown in B corresponds to the mRNA strand of cel5D. The first base found at the 5′-end extremity of glyR2 mRNA being an A (see part C), it corresponds to a bold highlighted T in the sequence shown in B. The lanes in parts A and C, ORF, putative promoter regions, primers, leader sequences and inverted repeats are indicated as in Fig. 3.

GlyR2 acts as an activator of cel5D

A gene, glyR2, encoding a transcriptional regulator belonging to the AraC/XylS family was found upstream from the cellulosomal cellulase cel5D gene in the opposite direction [18]. The AraC/XylS family of transcription regulators is one of the most common positive regulators [24], [25]. Members of the family have been categorized into three main common regulatory functions: carbon metabolism, stress response and pathogenesis. The 300 amino-acid GlyR2 polypeptide is predicted to be composed of an N-terminal binding module and a C-terminal 96 amino-acid AraC-type Helix-Turn-Helix DNA binding module. To study the function of GlyR2 and test its ability to regulate cel5D expression, we over-produced a C-terminal His-tagged protein in E. coli and partially purified it on Ni-NTA chromatography gel. Affinity of the recombinant protein to the cel5D and glyR2 promoter regions was tested using electrophoretic mobility shift assay (EMSA) (Fig. 6). The promoter region of glyR2 was located upstream from the +1 of transcription localized at −261/ATG using RT-PCR and primer extension (Figs. 2C, 5B and 5C). Two 3′-end biotin-labeled 411- and 425-bp Pcel5D and PglyR2 probes, respectively were prepared by PCR using primer pairs described in Table 1 and used for the EMSA. When GlyR2 was added to the mixture before running electrophoresis, a gel-shift of the Pcel5D and of the PglyR2 probes was observed (Fig. 6). No gel-shift was observed when GlyR2 was replaced by BSA, indicating that the effect is protein specific. The unlabeled probe at 100-fold concentration efficiently competed for binding to GlyR2 with the biotin-labeled corresponding probe. In contrast, an unrelated DNA probe failed to compete (data not shown), which indicated that GlyR2 binds specifically to the cel5D and to its own gene promoter regions.
Figure 6

Binding of GlyR2 to the cel5D and glyR2 promoter regions analysed by EMSA.

Reaction mixtures contained 30 fmoles (8 ng) of a biotin-labeled 411-bp cel5D probe or 25 fmoles (6.9 ng) of a biotin-labeled 425-bp glyR2 probe. Around 2 µg (57 pmoles) of GlyR2, 1 mg of BSA, 800 ng of unlabeled cel5D DNA probe or 690 ng of unlabeled glyR2 DNA probe was added in certain reaction mixtures.

Binding of GlyR2 to the cel5D and glyR2 promoter regions analysed by EMSA.

Reaction mixtures contained 30 fmoles (8 ng) of a biotin-labeled 411-bp cel5D probe or 25 fmoles (6.9 ng) of a biotin-labeled 425-bp glyR2 probe. Around 2 µg (57 pmoles) of GlyR2, 1 mg of BSA, 800 ng of unlabeled cel5D DNA probe or 690 ng of unlabeled glyR2 DNA probe was added in certain reaction mixtures. To determine whether in vivo, GlyR2 serves as a transcription regulator of cel5D, we constructed an insertional mutant of the glyR2 gene using the ClosTron method [19]. cel5D messengers were analyzed from the WT strain and the glyR2 mutant, using quantitative RT-PCR on total RNAs purified from cellulose-grown cells. As shown in figure 7, in the absence of GlyR2, the level of transcription of cel5D is about 16 times lower than in the WT strain. This suggests that GlyR2 acts as a transcriptional activator of cel5D.
Figure 7

Regulation of the expression of cel5D by GlyR2.

Wild-type (WT) and glyR2 strains were cultured in 5 g.L−1 cellulose-containing MM up to mid-exponential phase. The relative RNA amount (Arbitrary Unit) of cel5D in the two strains was determined by qRT-PCR. cDNAs from three biological independent experiments were used and the qRT-PCR assay was performed in duplicate on each sample. The rpoD gene target was used as an internal control. The lowest value was normalized to 1. Mean and standard deviation are presented in the graph.

Regulation of the expression of cel5D by GlyR2.

Wild-type (WT) and glyR2 strains were cultured in 5 g.L−1 cellulose-containing MM up to mid-exponential phase. The relative RNA amount (Arbitrary Unit) of cel5D in the two strains was determined by qRT-PCR. cDNAs from three biological independent experiments were used and the qRT-PCR assay was performed in duplicate on each sample. The rpoD gene target was used as an internal control. The lowest value was normalized to 1. Mean and standard deviation are presented in the graph.

Regulation by the carbon source

The cip-cel operon was shown to be regulated by carbon catabolite repression [14]. To investigate if the expression of the studied individual genes would be sensitive to the carbon sources, we constructed transcriptional fusions of their promoter regions with the catP gene (see construction details in the Material and Methods section). Corresponding promoter reporter plasmids were introduced into the C. cellulolyticum WT strain. Soluble cell-extracts of the transformants grown on cellulose, or cellulose plus cellobiose-containing MM up to mid exponential phase were assayed for CAT activity (Fig. 8). The transcription of cel5A and cel5I was found to be sensitive to the available soluble carbon source. With the transcriptional fusion used for cel5D, no effect of cellobiose was observed. The activity of cel44O promoter was found much higher than those of the other genes whatever the available carbon source(s). Nevertheless, as cel5D, it does not appear to be regulated by carbon catabolite repression.
Figure 8

Regulation of the expression of cel44O (A), cel5A, cel5I and cel5D (B) by the carbon source.

The CAT activities measured in soluble extracts of cells collected in the mid-exponential growth phase reflect the expression driven by the indicated promoters. Strains WT(pPSVPcelA), WT(pPSVPcelD), WT(pPSVcelI) and WT(pPSVcelO) were grown in 5 g.L−1 cellulose-containing MM (dark grey bars, Cel) or 5 g.L−1 cellulose+4 g.L−1 cellobiose-containing MM (light grey bars, Cel+Cb). The bars indicate the means of three experiments, and the error bars indicate the standard deviations.

Regulation of the expression of cel44O (A), cel5A, cel5I and cel5D (B) by the carbon source.

The CAT activities measured in soluble extracts of cells collected in the mid-exponential growth phase reflect the expression driven by the indicated promoters. Strains WT(pPSVPcelA), WT(pPSVPcelD), WT(pPSVcelI) and WT(pPSVcelO) were grown in 5 g.L−1 cellulose-containing MM (dark grey bars, Cel) or 5 g.L−1 cellulose+4 g.L−1 cellobiose-containing MM (light grey bars, Cel+Cb). The bars indicate the means of three experiments, and the error bars indicate the standard deviations.

Discussion

The goal of this work was to investigate the expression and regulation of various individual cel genes, namely cel5A, cel44O, cel5I and cel5D. Conversely to the cip-cel operon, these genes are transcribed as monocistronic units of transcription, except cel5D. It might be hypothesized that the transcription unit of the latter gene was disturbed by the insertion of a mobile element at its 3′ end; indeed the two genes co-transcribed with cel5D are predicted to encode an integrase gene and a transferase gene. As for the cip-cel operon, a large leader sequence was found in the 5′ end of messengers except for cel5A and cel44O. The leader sequences of cel5I and cel5D are assumed to be subjected to processing events as suggested by the results of the primer elongations and RT-PCR experiments. Such phenomenon has already been observed at the 5′-end of the cip-cel operon transcripts [13], [14]. cel5A and cel5I transcription levels are lower when a soluble carbon source is available cel5A and cel5I appear to be regulated by a carbon catabolite repression mechanism. One putative CRE sequence was found in the area of the cel5A promoter based on sequence comparison with the Bacillus subtilis consensus (WTGNNARCGNWWWCAW, [26]), This sequence shares 13 bases with the consensus (Fig. 3B). Four CRE sequences sharing also 13 bases with the B. subtilis consensus were found downstream from the promoter region of cel5I (data not shown). One of them shares also 12 bases with the consensus sequence of Clostridium difficile (RRGAAAANGTTTTCWW, [27])(Fig. 4B). The location of the CRE sequences found in the leader sequences of cel5A and cel5I is consistent with a road-block mechanism of transcription inhibition by a repressor located at the CRE site. Such a promoter-downstream location of a functional CRE sequence has been identified to regulate the cip-cel operon of C. cellulolyticum. It would be interesting to mutate these sequences and test the carbon catabolite repression sensitivity of these modified promoter regions. Putative CRE sequences were also found in the leader region of cel5D and cel44O (data not shown) but no catabolite repression could be observed using transcriptional fusions. These sequences may be dysfunctional. Further investigations would be necessary to prove it. One regulator gene (glyR2) was found upstream from cel5D, and the recombinant corresponding regulator was found to specifically interact with the cel5D promoter region and with the promoter of its own gene. In C. thermocellum, GlyR3 was the first transcriptional regulator of glycoside hydrolase genes identified. It binds specifically to a near perfect 18-bp palindrome in the celC promoter region and acts as a repressor in in vitro transcription assay [28]. No similar palindromic sequences could be found in the promoter regions of cel5D and glyR2. Footprint experiments would precisely identify the GlyR2 binding sites. GlyR2 belongs to the AraC/XylS family which mainly comprises activators. In glyR2 mutant cells grown in cellulose-containing medium, the cel5D transcription level was found much lower than in the control strain, indicating that GlyR2 acts as an activator. AraC/XylS regulators are known to be activated by an inducer [25]. The nature of its inducer is not yet known. Regulation of the expression of genes encoding the cellulolytic/hemicellulolytic system of Clostridium cellulolyticum appears to involve various mechanisms. Four different mechanisms have already been described: carbon catabolite repression regulates the expression of the cip-cel operon, cel5A and cel5I, mRNA processing coupled to secondary messengers differential stability contributes to fine tune the expression of individual genes of the cip-cel operon [13], a two component system might be involved in the regulation of the xyl-doc cluster [29], and finally an activator of the AraC/XylS family was demonstrated to regulate the expression of cel5D in this study.
  26 in total

Review 1.  The AraC transcriptional activators.

Authors:  R G Martin; J L Rosner
Journal:  Curr Opin Microbiol       Date:  2001-04       Impact factor: 7.934

2.  AraC-XylS database: a family of positive transcriptional regulators in bacteria.

Authors:  Raquel Tobes; Juan L Ramos
Journal:  Nucleic Acids Res       Date:  2002-01-01       Impact factor: 16.971

Review 3.  Cellulosomes: highly efficient nanomachines designed to deconstruct plant cell wall complex carbohydrates.

Authors:  Carlos M G A Fontes; Harry J Gilbert
Journal:  Annu Rev Biochem       Date:  2010       Impact factor: 23.643

4.  Cellulosome from Clostridium cellulolyticum: molecular study of the Dockerin/Cohesin interaction.

Authors:  H P Fierobe; S Pagès; A Bélaïch; S Champ; D Lexa; J P Bélaïch
Journal:  Biochemistry       Date:  1999-09-28       Impact factor: 3.162

5.  Sequence analysis of scaffolding protein CipC and ORFXp, a new cohesin-containing protein in Clostridium cellulolyticum: comparison of various cohesin domains and subcellular localization of ORFXp.

Authors:  S Pagès; A Bélaïch; H P Fierobe; C Tardif; C Gaudin; J P Bélaïch
Journal:  J Bacteriol       Date:  1999-03       Impact factor: 3.490

6.  Sequence analysis of the Clostridium cellulolyticum endoglucanase-A-encoding gene, celCCA.

Authors:  E Faure; A Belaich; C Bagnara; C Gaudin; J P Belaich
Journal:  Gene       Date:  1989-12-07       Impact factor: 3.688

7.  Modulation of cellulosome composition in Clostridium cellulolyticum: adaptation to the polysaccharide environment revealed by proteomic and carbohydrate-active enzyme analyses.

Authors:  Jean-Charles Blouzard; Pedro M Coutinho; Henri-Pierre Fierobe; Bernard Henrissat; Sabrina Lignon; Chantal Tardif; Sandrine Pagès; Pascale de Philip
Journal:  Proteomics       Date:  2010-02       Impact factor: 3.984

8.  Purification and properties of two truncated endoglucanases produced in Escherichia coli harbouring Clostridium cellulolyticum endoglucanase gene celCCD.

Authors:  S Shima; Y Igarashi; T Kodama
Journal:  Appl Microbiol Biotechnol       Date:  1993-03       Impact factor: 4.813

9.  The ClosTron: a universal gene knock-out system for the genus Clostridium.

Authors:  John T Heap; Oliver J Pennington; Stephen T Cartman; Glen P Carter; Nigel P Minton
Journal:  J Microbiol Methods       Date:  2007-06-18       Impact factor: 2.363

10.  Global transcriptional control by glucose and carbon regulator CcpA in Clostridium difficile.

Authors:  Ana Antunes; Emilie Camiade; Marc Monot; Emmanuelle Courtois; Frédéric Barbut; Natalia V Sernova; Dmitry A Rodionov; Isabelle Martin-Verstraete; Bruno Dupuy
Journal:  Nucleic Acids Res       Date:  2012-09-18       Impact factor: 16.971

View more
  3 in total

1.  Cellulosome stoichiometry in Clostridium cellulolyticum is regulated by selective RNA processing and stabilization.

Authors:  Chenggang Xu; Ranran Huang; Lin Teng; Xiaoyan Jing; Jianqiang Hu; Guzhen Cui; Yilin Wang; Qiu Cui; Jian Xu
Journal:  Nat Commun       Date:  2015-04-24       Impact factor: 14.919

2.  Biotechnological applications of mobile group II introns and their reverse transcriptases: gene targeting, RNA-seq, and non-coding RNA analysis.

Authors:  Peter J Enyeart; Georg Mohr; Andrew D Ellington; Alan M Lambowitz
Journal:  Mob DNA       Date:  2014-01-13

3.  Cel5I, a SLH-Containing Glycoside Hydrolase: Characterization and Investigation on Its Role in Ruminiclostridium cellulolyticum.

Authors:  Nathalie Franche; Chantal Tardif; Julie Ravachol; Seddik Harchouni; Pierre-Henri Ferdinand; Romain Borne; Henri-Pierre Fierobe; Stéphanie Perret
Journal:  PLoS One       Date:  2016-08-08       Impact factor: 3.240

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.