| Literature DB >> 23341750 |
Moriyuki Shoda1, Naoya Urasaki, Sumisu Sakiyama, Shingo Terakami, Fumiko Hosaka, Narumi Shigeta, Chikako Nishitani, Toshiya Yamamoto.
Abstract
We developed 18 polymorphic simple sequence repeat (SSR) markers in pineapple (Ananas comosus) by using genomic libraries enriched for GA and CA motifs. The markers were used to genotype 31 pineapple accessions, including seven cultivars and 11 breeding lines from Okinawa Prefecture, 12 foreign accessions and one from a related species. These SSR loci were highly polymorphic: the 31 accessions contained three to seven alleles per locus, with an average of 4.1. The values of expected heterozygosity ranged from 0.09 to 0.76, with an average of 0.52. All 31 accessions could be successfully differentiated by the 18 SSR markers, with the exception of 'N67-10' and 'Hawaiian Smooth Cayenne'. A single combination of three markers TsuAC004, TsuAC010 and TsuAC041, was enough to distinguish all accessions with one exception. A phenogram based on the SSR genotypes did not show any distinct groups, but it suggested that pineapples bred in Japan are genetically diversed. We reconfirmed the parentage of 14 pineapple accessions by comparing the SSR alleles at 17 SSR loci in each accession and its reported parents. The obtained information will contribute substantially to protecting plant breeders' rights.Entities:
Keywords: Ananas comosus; genetic diversity; parentage; simple sequence repeat
Year: 2012 PMID: 23341750 PMCID: PMC3528333 DOI: 10.1270/jsbbs.62.352
Source DB: PubMed Journal: Breed Sci ISSN: 1344-7610 Impact factor: 2.086
Pineapple accessions used in this study
| Accession name | Parentage | Origin and type | Parentage assessed by SSR markers |
|---|---|---|---|
| Gold Barrel | Cream Pineapple × McGregor ST-1 | cultivar, bred by OPARC-Nago | parentage confirmed except for TsuAC018 |
| Haney Bright | Mitsubishi Smooth Cayenne × I-43-908 | cultivar, bred by OPARC-Nago | |
| Julio Star | N67-10 × Cream Pineapple | cultivar, bred by OPARC-Nago | parentage confirmed |
| N67-10 | selection from Hawaiian Smooth Cayenne | cultivar, bred by OPARC-Nago | identical genotype to Hawaiian Smooth Cayenne |
| Soft Touch | Hawaiian Smooth Cayenne × I-43-880 | cultivar, bred by OPARC-Nago | parentage confirmed |
| Summer Gold | Cream Pineapple × McGregor ST-1 | cultivar, bred by OPARC-Nago | parentage confirmed |
| Yugafu | Cream Pineapple × HI101 | cultivar, bred by OPARC-Nago | parentage confirmed |
| Okinawa No. 2 | Mitsubishi Smooth Cayenne × I-43-908 | breeding line, bred by OPARC-Nago | |
| Okinawa No. 3 | Mitsubishi Smooth Cayenne × I-43-908 | breeding line, bred by OPARC-Nago | |
| Okinawa No. 9 | N67-10 × Cream Pineapple | breeding line, bred by OPARC-Nago | parentage confirmed |
| Okinawa No. 13 | Cream Pineapple × Okinawa No. 2 | breeding line, bred by OPARC-Nago | parentage confirmed |
| Okinawa No. 17 | Yugafu × Summer Gold | breeding line, bred by OPARC-Nago | parentage confirmed |
| Okinawa No. 19 | Yugafu × Soft Touch | breeding line, bred by OPARC-Nago | parentage confirmed |
| Okinawa No. 20 | Yugafu × Summer Gold | breeding line, bred by OPARC-Nago | parentage not confirmed, candidate parentage of Yugafu × N67-10 |
| Okinawa No. 21 | Yugafu × A1031 | breeding line, bred by OPARC-Nago | parentage between Okinawa No. 21 and Yugafu confirmed |
| Okinawa No. 22 | A882 × Soft Touch | breeding line, bred by OPARC-Nago | parentage confirmed |
| Okinawa No. 23 | Julio Star × Okinawa No. 12 | breeding line, bred by OPARC-Nago | parentage between Okinawa No. 23 and Julio Star confirmed |
| Okinawa No. 24 | Soft Touch × Summer Gold | breeding line, bred by OPARC-Nago | parentage confirmed |
| A. ananasoides | indigenous, introduced from Brazil, | ||
| A882 | Ripely Queen × Puerto Rico | breeding line | |
| Bogor | Smooth Cayenne × Singapore Spanish | breeding line | |
| Cream Pineapple | indigenous, introduced from USA, Maipure type | ||
| Hawaiian Smooth Cayenne | indigenous, introduced from USA, Cayenne type | identical genotype to N67-10 | |
| HI101 | breeding line, introduced from USA | ||
| I-43-880 | unknown, introduced from Brazil | ||
| McGregor ST-1 | indigenous, introduced from Australia, Queen type | ||
| MD2 | 58-1184 × 59-443 | cultivar, introduced from USA | |
| Red Spanish | indigenous, intoroduced from Brazil, Spanish type | ||
| Seijyo Cayenne | indigenous, introduced from Taiwan, Cayenne type | ||
| Tainung No. 11 | (Smooth Cayenne × Mouritius) × Smooth Cayenne | cultivar, introduced from Taiwan | |
| Tainung No. 17 | Smooth Cayenne × Rough | cultivar, introduced from Taiwan |
OPARC-Nago: Okinawa Prefectural Agricultural Research Center Nago Branch
Characteristics of 18 nelwly developed SSR markers in pineapple
| SSR locus | Primer sequence (5′-3′) | Repeat motif | Target size (bp) | No. of allels | ( |
|---|---|---|---|---|---|
| TsuAC004 | F: ATGTTGGTCAAAGGGCTGTT | (AG)16 | 144 | 5 | 0.67 |
| TsuAC007 | F: GCAGCGGTAAGATCTGCTTT | (GA)21 | 102 | 4 | – |
| TsuAC008 | F: GAAATGGTACTGCTTCACTGTTC | (GA)16 | 173 | 5 | 0.71 |
| TsuAC010 | F: TGAGTTGTGTCATTGTGTGTCA | (GT)14A(AG)12 | 207 | 7 | 0.76 |
| TsuAC013 | F: TTATGCAGGAAAATAGGGGG | (AGAGAT)3(AG)12 | 139 | 4 | 0.55 |
| TsuAC018 | F: GCATCGATCTCCATGCAAAC | (CA)10A(AC)9 | 120 | 5 | 0.59 |
| TsuAC019 | F: TTCATCCTATGGTTTCCCCA | (AC)13 | 177 | 4 | 0.09 |
| TsuAC021 | F: AATCAAAGTGATTCCCCTTCC | (CA)21 | 141 | 4 | 0.50 |
| TsuAC023 | F: TCGAAAAGAGGATGCTGGAT | (CA)10(TA)11 | 143 | 5 | 0.73 |
| TsuAC024 | F: GTCGCCAATCAAATTCCAGT | (AC)9 | 126 | 3 | 0.52 |
| TsuAC026 | F: GGGATTAACTTTTCCAGGGG | (AC)8 | 200 | 4 | 0.09 |
| TsuAC028 | F: TGACACCATAGAGGAGGGGT | (AC)8 | 220 | 3 | 0.57 |
| TsuAC030 | F: GAGAGAGAAAAGAGTTTCGACAG | (AG)27 | 149 | 4 | 0.43 |
| TsuAC035 | F: TTCCTAGCCAACACTACTACAGA | (GA)9 | 96 | 3 | 0.45 |
| TsuAC038 | F: TTGCAGCAAACCAAGTCAT | (AC)11 | 327 | 3 | 0.48 |
| TsuAC039 | F: CCCTGTATGGGTAGCATTGAA | (AC)8 | 91 | 3 | 0.54 |
| TsuAC040 | F: AAATTCTCTTCATGCACACG | (AC)8 | 99 | 4 | 0.61 |
| TsuAC041 | F: CTCTCTTATGGCACAACCCTG | (AC)11 | 279 | 4 | 0.58 |
| Average | 4.1 | 0.52 |
DDBJ accession numbers
Heterozygosity not evaluated because of the existence of null allele
Genotypes of 18 SSR markers in pineapple accessions used in this study
| Cultivar name | SSR genotypes | |||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| ||||||||||||||||||
| TsuAC004 | TsuAC007 | TsuAC008 | TsuAC010 | TsuAC013 | TsuAC018 | TsuAC019 | TsuAC021 | TsuAC023 | TsuAC024 | TsuAC026 | TsuAC028 | TsuAC030 | TsuAC035 | TsuAC038 | TsuAC039 | TsuAC040 | TsuAC041 | |
| Gold Barrel | 135/143 | 101/101 | 178/180 | 212/232 | 139/139 | 109/109 | 177/177 | 118/118 | 138/168 | 126/131 | 203/203 | 217/223 | 145/158 | 88/95 | 330/330 | 93/95 | 95/95 | 276/276 |
| Haney Bright | 135/137 | 101/101 | 176/186 | 207/232 | 126/135 | 121/121 | 177/177 | 118/118 | 132/132 | 126/126 | 203/203 | 223/223 | 145/158 | 95/95 | 330/336 | 95/95 | 95/95 | 275/279 |
| Julio Star | 137/143 | 101/101 | 176/180 | 212/212 | 139/139 | 109/121 | 177/177 | 143/143 | 132/168 | 126/131 | 203/203 | 217/223 | 145/145 | 88/95 | 330/336 | 93/95 | 95/97 | 276/276 |
| N67-10 | 137/143 | 101/101 | 176/186 | 207/212 | 135/139 | 121/121 | 177/177 | 118/143 | 132/144 | 126/131 | 203/203 | 217/223 | 145/145 | 88/95 | 330/336 | 93/95 | 95/99 | 276/279 |
| Soft Touch | 137/143 | 101/101 | 176/186 | 212/214 | 139/151 | 111/121 | 177/177 | 118/143 | 138/144 | 126/131 | 203/203 | 223/223 | 145/158 | 95/95 | 336/336 | 91/93 | 95/103 | 276/276 |
| Summer Gold | 135/135 | 101/101 | 180/186 | 212/232 | 139/139 | 109/121 | 177/177 | 118/118 | 138/168 | 126/131 | 203/203 | 217/223 | 145/158 | 88/95 | 330/336 | 95/95 | 97/99 | 276/279 |
| Yugafu | 135/135 | 101/101 | 186/186 | 207/207 | 139/139 | 121/121 | 177/177 | 118/118 | 132/144 | 126/131 | 203/203 | 217/217 | 145/145 | 88/95 | 336/336 | 93/95 | 95/95 | 276/279 |
| Okinawa No. 2 | 135/143 | 101/101 | 176/186 | 207/232 | 126/135 | 121/121 | 177/177 | 118/118 | 132/132 | 126/126 | 203/203 | 219/223 | 145/158 | 95/95 | 330/336 | 93/95 | 95/95 | 275/279 |
| Okinawa No. 3 | 135/143 | 101/101 | 176/186 | 207/232 | 126/135 | 121/121 | 177/177 | 118/118 | 132/132 | 126/126 | 203/203 | 219/223 | 145/145 | 88/95 | 330/336 | 93/95 | 95/95 | 275/276 |
| Okinawa No. 9 | 135/137 | 101/101 | 180/186 | 212/212 | 139/139 | 109/121 | 177/177 | 143/143 | 132/168 | 126/131 | 203/203 | 217/223 | 145/145 | 95/95 | 336/336 | 95/95 | 95/97 | 276/279 |
| Okinawa No. 13 | 135/143 | 101/101 | 186/186 | 207/232 | 126/139 | 121/121 | 177/177 | 118/143 | 132/144 | 126/131 | 203/203 | 217/223 | 145/145 | 95/95 | 336/336 | 93/93 | 95/97 | 275/275 |
| Okinawa No. 17 | 135/135 | 101/101 | 186/186 | 207/232 | 139/139 | 109/121 | 177/177 | 118/118 | 138/144 | 126/131 | 203/203 | 217/223 | 145/145 | 88/95 | 336/336 | 95/95 | 95/97 | 276/279 |
| Okinawa No. 19 | 135/143 | 101/101 | 176/186 | 207/212 | 139/139 | 111/121 | 177/177 | 118/143 | 138/144 | 126/131 | 203/203 | 217/223 | 145/158 | 88/95 | 336/336 | 93/93 | 95/103 | 276/276 |
| Okinawa No. 20 | 135/137 | 101/101 | 186/186 | 207/212 | 135/139 | 121/121 | 177/177 | 118/118 | 132/144 | 126/131 | 203/203 | 217/217 | 145/145 | 95/95 | 330/336 | 95/95 | 95/95 | 276/279 |
| Okinawa No. 21 | 135/135 | 101/101 | 186/186 | 207/232 | 139/139 | 109/121 | 177/177 | 118/118 | 138/144 | 126/131 | 203/203 | 217/223 | 145/145 | 95/95 | 330/336 | 93/93 | 95/95 | 279/279 |
| Okinawa No. 22 | 137/143 | 101/101 | 178/186 | 214/214 | 135/139 | 117/121 | 177/177 | 143/143 | 138/138 | 126/131 | 203/203 | 223/223 | 145/158 | 88/95 | 336/336 | 93/93 | 97/103 | 276/276 |
| Okinawa No. 23 | 135/143 | 101/101 | 180/180 | 212/232 | 139/139 | 109/109 | 177/177 | 143/143 | 138/168 | 131/131 | 203/203 | 217/217 | 145/145 | 88/95 | 330/330 | 95/95 | 97/97 | 276/279 |
| Okinawa No. 24 | 135/143 | 101/101 | 180/186 | 214/232 | 139/151 | 109/121 | 177/177 | 118/118 | 138/168 | 126/131 | 203/203 | 223/223 | 145/158 | 95/95 | 336/336 | 91/95 | 95/99 | 276/276 |
| A. ananasoides | 145/153 | 86/110 | 178/184 | 216/226 | 126/126 | 118/118 | 189/204 | 155/163 | 158/158 | 129/129 | 199/203 | 219/219 | 151/156 | 88/88 | 324/324 | 93/93 | 97/97 | 277/277 |
| A882 | 137/137 | 101/101 | 178/178 | 207/214 | 135/135 | 117/121 | 177/177 | 143/143 | 132/138 | 126/126 | 203/203 | 223/223 | 145/145 | 88/89 | 336/336 | 93/95 | 97/97 | 276/276 |
| Bogor | 135/143 | 101/101 | 176/178 | 207/232 | 135/139 | 121/121 | 177/177 | 118/143 | 138/144 | 131/131 | 203/203 | 223/223 | 145/158 | 95/95 | 330/336 | 93/95 | 95/99 | 276/279 |
| Cream Pineapple | 135/137 | 101/101 | 180/186 | 207/212 | 139/139 | 109/121 | 177/177 | 118/143 | 144/168 | 131/131 | 203/203 | 217/217 | 145/145 | 88/95 | 330/336 | 93/95 | 95/97 | 275/276 |
| Hawaiian Smooth Cayenne | 137/143 | 101/101 | 176/186 | 207/212 | 135/139 | 121/121 | 177/177 | 118/143 | 132/144 | 126/131 | 203/203 | 217/223 | 145/145 | 88/95 | 330/336 | 93/95 | 95/99 | 276/279 |
| HI101 | 135/143 | null/null | 178/186 | 207/214 | 139/139 | 117/121 | 177/177 | 118/143 | 132/132 | 126/131 | 203/203 | 217/217 | 145/145 | 88/95 | 336/336 | 93/95 | 95/95 | 276/279 |
| I-43-880 | 137/137 | 101/101 | 176/176 | 212/214 | 139/151 | 111/111 | 177/177 | 118/143 | 138/138 | 126/126 | 203/203 | 223/223 | 158/158 | 95/95 | 336/336 | 91/95 | 97/103 | 276/276 |
| McGregor ST-1 | 135/143 | null/null | 178/186 | 232/232 | 135/139 | 121/121 | 177/177 | 118/118 | 138/138 | 126/131 | 203/203 | 223/223 | 145/158 | 95/95 | 330/336 | 93/95 | 95/99 | 276/279 |
| MD2 | 135/137 | 101/101 | 178/178 | 207/232 | 135/139 | 117/117 | 177/177 | 143/143 | 132/138 | 126/126 | 203/203 | 217/223 | 145/145 | 88/95 | 330/336 | 93/95 | 95/103 | 275/276 |
| Red Spanish | 135/137 | 101/101 | 178/178 | 233/233 | 135/139 | 117/117 | 175/177 | 118/143 | 132/132 | 126/126 | 207/209 | 217/219 | 145/158 | 95/95 | 330/336 | 95/95 | 95/95 | 276/279 |
| Seijyo Cayenne | 137/137 | 101/101 | 176/178 | 207/233 | 135/139 | 117/121 | 177/177 | 118/118 | 132/132 | 126/126 | 203/203 | 217/217 | 145/158 | 88/95 | 330/336 | 95/95 | 95/99 | 276/279 |
| Tainung No. 11 | 135/143 | 101/101 | 186/186 | 207/232 | 139/139 | 121/121 | 177/177 | 118/118 | 138/144 | 126/131 | 203/203 | 217/223 | 145/158 | 95/95 | 336/336 | 95/95 | 95/99 | 276/276 |
| Tainung No. 17 | 135/137 | 101/101 | 176/186 | 207/232 | 135/139 | 121/121 | 177/177 | 118/118 | 132/138 | 126/131 | 203/203 | 217/223 | 145/158 | 88/95 | 330/336 | 93/93 | 95/95 | 276/279 |
Fig. 1Phenogram of the 31 pineapple accessions evaluated in this study. The phenogram was produced using the UPGMA method based on Dice’s coefficient.