Literature DB >> 23285066

Ectopic pregnancy-derived human trophoblastic stem cells regenerate dopaminergic nigrostriatal pathway to treat parkinsonian rats.

Tony Tung-Yin Lee1, Cheng-Fang Tsai, Tsung-Hsun Hsieh, Jia-Jin Jason Chen, Yu-Chih Wang, Mi-Chun Kao, Ruey-Meei Wu, Sher Singh, Eing-Mei Tsai, Jau-Nan Lee.   

Abstract

BACKGROUND: Stem cell therapy is a potential strategy to treat patients with Parkinson's disease (PD); however, several practical limitations remain. As such, finding the appropriate stem cell remains the primary issue in regenerative medicine today. We isolated a pre-placental pluripotent stem cell from the chorionic villi of women with early tubal ectopic pregnancies. Our objectives in this study were (i) to identify the characteristics of hTS cells as a potential cell source for therapy; and (ii) to test if hTS cells can be used as a potential therapeutic strategy for PD. METHODS AND
FINDINGS: hTS cells expressed gene markers of both the trophectoderm (TE) and the inner cell mass (ICM). hTS cells exhibited genetic and biological characteristics similar to that of hES cells, yet genetically distinct from placenta-derived mesenchymal stem cells. All-trans retinoic acid (RA) efficiently induced hTS cells into trophoblast neural stem cells (tNSCs) in 1-day. Overexpression of transcription factor Nanog was possibly achieved through a RA-induced non-genomic c-Src/Stat3/Nanog signaling pathway mediated by the subcellular c-Src mRNA localization for the maintenance of pluripotency in tNSCs. tNSC transplantation into the lesioned striatum of acute and chronic PD rats not only improved behavioral deficits but also regenerated dopaminergic neurons in the nigrostriatal pathway, evidenced by immunofluorescent and immunohistological analyses at 18-weeks. Furthermore, tNSCs showed immunological advantages for the application in regenerative medicine.
CONCLUSIONS: We successfully isolated and characterized the unique ectopic pregnancy-derived hTS cells. hTS cells are pluripotent stem cells that can be efficiently induced to tNSCs with positive results in PD rat models. Our data suggest that the hTS cell is a dynamic stem cell platform that is potentially suitable for use in disease models, drug discovery, and cell therapy such as PD.

Entities:  

Mesh:

Substances:

Year:  2012        PMID: 23285066      PMCID: PMC3528662          DOI: 10.1371/journal.pone.0052491

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Parkinson’s disease (PD) is caused by the dysfunction or the loss of dopaminergic neurons in the nigrostriatal pathway of the midbrain, making it the second most common neurodegenerative disorder in humans. Current pharmacological drugs only provide symptomatic relief but do not retard the disease progression. Consequently, cell replacement by using human fetal mesencephalic tissue [1], [2] or embryonic stem (ES) cell-derived dopaminergic neurons [3], [4], [5] remains an important therapeutic strategy; however, several practical limitations exist, such as shortage of cell sources, variations in outcomes, adverse effects, and socio-ethical issues [6]. Placenta-derived mesenchymal stem (PDMS) cells have also shown promise; but outcomes remain uncertain [7]. In the search for a suitable cell source, we isolated and identified the ectopic pregnancy-derived human trophoblast stem (hTS) cells from the early chorionic villi of a tubal ectopic pregnancy. The characteristics of hTS cells suggest it as a potential alternative source of pluripotent stem cells for the treatment of PD and of other neurodegenerative diseases. We investigated the microenvironmental factors that affect pluripotency and proliferation of hTS cells. In women, fertilization occurs in the fallopian tubes, where the distinction between the inner cell mass (ICM) and the trophectoderm (TE) [8] and the switch from totipotency to pluripotency takes place during embryogenesis [9]. When an ectopic pregnancy occurs in the fallopian tube, the cellular processes may continue until clinical intervention. Before intervention, however, the microenvironmental factors might affect cell differentiation. For example, the pleiotropic cytokine LIF expresses significantly higher levels in the fallopian tubes than that in the endometrium [10], descending from the ampulla to the isthmus [11]. LIF levels may elevate up to 2- to 4-fold in ectopic pregnancies [11]. Functionally, LIF activates transcription factors, Oct4 and Nanog, for the maintenance of pluripotency in ES cells [12], [13]. On withdrawal of LIF, cell proliferation continues but the caudal-related homeobox transcription factor Cdx2 is activated, driving ES cells differentiation into trophectoderm fate [14]. Nevertheless, the significance of LIF on trophoblastic development is largely unknown. In this study, we clarified the inter-relationships of LIF, Oct4, Nanog and Cdx2 on pluripotency and proliferation of hTS cells. Next, we investigated if retinoic acid (RA) can effectively induce hTS cell differentiation to a neural cell. RA is a well-recognized signaling molecule, involved in the development, regeneration, and maintenance of the nervous system [15]. RA promotes the generation of DA neurons and the enhancement of axon outgrowths of neurites in hES cells [16]. Conventionally, RA may function as a paracrine signal or an autocrine signal, entering the nucleus via retinaldehyde dehydrogenases (RALDHs) to bind RA receptors (RARs) or retinoid X receptors (RXRs) to activate the retinoic acid-response element (RARE) for gene transcription. Notably, the striatum expresses the highest endogenous levels of RA in the brain [17]. In our study, we found that RA efficiently induced differentiation of hTS cells into dopaminergic trophoblastic neural stem cells (tNSCs). We then investigated whether tNSCs were effective in a PD rat model. We found that intracranial transplantation of tNSCs substantially regenerated the dopaminergic nigrostriatal pathway and functionally alleviated parkinsonian motor deficits in both acute and chronic PD rats. Together, these results suggest that hTS cells are a viable pluripotent cell source that circumvents socio-ethical concerns for the treatment of PD.

Materials and Methods

hTS Cell Culture and Differentiation

Tiny villous tissues (Fig. S1A) were well-minced in serum-free α-MEM (Sigma-Aldrich, St. Louis, MO) followed by trypsinization with 0.025% trypsin/EDTA (Sigma-Aldrich) (15 min) that was halted by adding α-MEM containing 10% FBS. Adherent cells were cultured in α-MEM, 20% FBS, and 1% penicillin-streptomycin at 37°C in 5% CO2. Particularly, the doubling time of cell growth was 7.67 hr. Cell antibodies, primers, and differentiations used in this study are shown in Supporting Information (Table S1, Table S2).

Plasmids

Plasmid construct (F1B-GFP) used in this study is described in the Supporting Information (Text S1). hTS cells were co-transfected with a DNA mixture of F1B-GFP to yielded over 95% of transfection rate.

RT-PCR, Western Blots, Southern Blots, Immunoprecipitation, IP Assay, and Flow Cytometry

Methods performed in this work are described previously [18] and details are available in the Supporting Information (Text S1).

Chromatin Immunoprecipitation (ChIP)

Cells were serum-deprived for overnight and treated with RA (10 µM) for 30 min. The mixtures of protein G beads (Roche) and lysate were incubated with rocking at 4°C for 2 hr. After removing the beads by centrifugation, the lysate was added with IgG (Santa Cruz) and primary anti-Stat3 antibody (1∶1,000, Santa Cruz) in accompany with new protein G beads. The mixtures were incubated with rocking overnight at 4°C. The immunoprecipitation complex was washed by RIPA lysis buffer and subjected for polymerase chain reaction (PCR) using Nanog promoter primer: forward, GACAGCCCCCACTTAACAAA and reverse, GCTTTTTCCCTCTGGCTCTT).

Microarray Data Analysis

Cells, with or without treatment of RA (10 µM), were cultured overnight and total RNAs were extracted using TRIzol reagent (Invitrogen) and subjected for Affymetrix microarray by using Affymetrix Human Genome U133 plus 2.0 GeneChip according to the manufacturer’s guidance (Santa Clara, CA, http://www.affymetrix.com) performed at Genomic Medicine Center of National Taiwan University College of Medicine, Taipei, Taiwan). Data analysis was performed by using softwares of MetaCore, GeneSpring GX (version 7.3), and IPA Ingenuity System (version 8.8).

Immunofluorescence

For immunocytochemistry, after fixation with 4% paraformaldehyde in PBS (room temperature; 5 min) and washes, cells were permeabilized with 2% FBS/0.4% Triton X-100 in PBS (15 min), followed by 5% FBS blocking solution (2 hr) and rinsed three times. After incubation with specific primary antibody in PBS at 4°C overnight, appropriate FITC or PE or Texas Red or DyLight 488 or DyLight 594 conjugated secondary antibody was added for 1 hr at room temperature. By DAPI staining, nucleus (5 min) cells were subjected for microscopy. For immunohistochemistry, brain sections were fixed in 4% paraformaldehyde (2 hr) and dehydrated in 30% sucrose in 0.02 M PBS (2 days) followed by processes in a freezing microtome (Leica). Coronal sections (30 µm) were treated with 0.3% H2O2 and Ready-To–Use blocking solution (IHC-101b, Bethyl Laboratories, Montgomery, TX) for 15 min followed by incubation with primary anti-TH antibody (1∶1,000, Temecula, CA) at 4°C. Anti-rabbit second antibody (IHC-101d, Bethyl Laboratories) was used with DAB kit (Bethyl) for microscopic analysis.

Immunofluorescence Tissue Analysis

Coronal brain sections were immunostained with primary antibodies: TH (1∶250; H-196, sc-14007; Santa Cruz), NeuN (1∶100; MAB377; Millipore, Temecula, CA), and GFAP (1∶200; BSB 5566, Declere; Bio SB, Santa Barbara, CA) in accompany with FITC-anti-TH, Cy-3-anti-NeuN, or Cy-3-anti-GFAP. Data were analyzed by TissueGnostics (TissueGnostics GmbH, Vienna, Austria). Evaluation was made by comparison between the lesioned (or the cell-implanted) side and the normal side. Cells with bizarre size or intensity of GFAP outside the normal (e.g., artifact or unusually heavy stain area or intensity in cell overlapping with Wilson’s pencils) were excluded.

Animal Studies and Behavioral Assessments

Animal preparations were licensed and well-described previously [19], (Text S1). Before experiment, the apomorphine-induced rotation test after 6-OHDA injection was pre-evaluated weekly in PD rats to achieve a stable hemiparkinsonian status to avoid bias. In acute PD rats (body weight, 225–250 g), cells (3×106 cells/5 µl/5 min) were transplanted into the lesioned striatum at site (AP +1.0 mm, Lat +2.7 mm, Dep 6.4 mm) under anesthesia. The cell viability remained stable between 96% and 98% during the implantation procedures. In chronic PD rats, the body weight of rats was controlled between 560±65 g at pre-test and 548±46 g at post-test. Cells (1.5×106) were grafted at the same site. To obtain the brain sections, rats were anesthetized by sodium pentobarbitone (60 mg/kg i.p., Apoteksbolaget, Sweden) and trans-cardially perfused with saline (50 ml, 0.9% w/v) followed by ice-cold paraformaldehyde (200 ml, 10% w/v in 0.02 M PBS) were performed at 18- and 12-weeks in the acute and chronic PD rats, respectively. Brain sections were subjected for immunocytochemistry, and immunofluorescence tissue analysis as indicated. All behavioral assessments were performed as described previously [19], (Text S1).

Ethics Statement

Patient consent and sourcing of human tissue were approved by the Institutional Review Board on Human Subjects Research and Ethics Committees of Kaohsiung Medical University Hospital (KMUH-IRB-950140). The animal experiments were conducted according to the guideline and Approval of Animal Use Protocol of National Cheng Kung University (IACUC Approval No. 98010). The NCKU IACUC guidelines aim to reduce animal suffering by use of anesthesia, use of analgesics, and provide nutritional and fluid support.

Statistical Analysis

Data obtained from RT-PCR and flow cytometry were calculated by Student’s t-test. For behavioral assessments, data were expressed as mean ± SEM. In acute PD rats, data of apomorphine-induced rotation tests were analyzed by using repeated measure analysis of variance (ANOVA) tests (SPSS Release 12.0 software) and applied least significant difference test (LSD) post hoc comparisons after repeated measure ANOVA tests between two groups. In chronic PD rats, paired Student’s t-test was used to compare the two groups. p-value <0.05 was considered statistically significant.

Results

Ectopic Pregnancy Gives Rise to hTS Cells

A unique population of adherent cells was isolated from the early chorionic villi of embryos (gestational age: 5–7 weeks) in tubal ectopic pregnancies (Text S1). Neither feeder cells nor multiple inducers were used in the cell culture and the differentiation of hTS cells, as distinct from hES cells [3], [4], [5], circumventing potential side-effects and contaminations. After growth factor depletion, the main differentiated lineage of trophoblasts should be mature syncytial multinuclear trophoblasts. However, we only isolated mononuclear cytotrophoblast cells that adhered to the dish, as mature cells were removed in the isolation process. The population doubling time of hTS cells was 8 hr, which is distinct from the 48 hr population doubling time of the first trimester placenta-derived cytotrophoblast [20]. These cells expressed markers for hES cell-related specific stage embryonic antigen (SSEA)-1, −3 and −4 with immunolocalization identical to cytotrophoblasts in the villus (Fig. 1A). By immunocytochemistry, the cells expressed pluripotency transcription factors Oct4, Sox2, Nanog and Cdx2 in the nuclei at passage 9 and 17 (Fig. 1B, Fig. S1B).
Figure 1

Characteristics of hTS Cells.

(A) Histology of an ectopic pregnancy at fallopian tube by HE staining (left large panel). Bla: blastocyst, V: chorionic villi, FT: fallopian tube. Immunocytochemistry of SSEAs (red, arrow) showed SSEA-1 in the cytoplasm (left upper); SSEA-3 in the nucleus (middle upper); and SSEA-4 in both the cytoplasm and the membrane (right upper), corresponding to cytotrophoblasts in the ectopic chorionic villus (lower panel). (B) Immunofluorescent Oct4 and Cdx2 at passage 9 (P-9), Oct4 and Nanog expressed in the nuclei at passage 9 (P-9) and 17 (P-17) (left column). Scale bar: 20 µm. Expression of Cdx2, Oct4, Sox2, and Nanog in the nuclei in the amplified cells (middle and right columns). Scale bar: 10 µm. (C) Expression of specific genes of both trophectoderm (TE) and ICM by RT-PCR. (D) hTS cells expressed genes of three germ layers before induction (left column) and after appropriate induction (right column). (E) For cellular homogeneity, Oct4-positive cells in P-9 and P-17 with 100% and 97.3%, respectively, by TissueGnostics analysis. n = total cell number counted. (F) Flow cytometric analysis at passage 15, cells expressed positive Oct4, Nanog, Sox2, and Cdx2 were 97.9%, 98.7%, 95%, and 94%, respectively. (G) Southern blots showed no obvious change in telomere length at passages 3 (P-3) and 7 (P-7). (H) Distinction between hTS cells and PDMS cells in global gene expressions (total 54,675 genes; p<0.05 and fold change >2) with a homogenous histogram. (I) Different relative intensity values of genes (4,864 genes) between PDMS and hTS cells. Blue box indicating 50% of total genes and error bars indicating 25% and 75%. (J) Venn diagram illustrated the numbers of immue-related genes (upper panel) and mesenchymal genes (lower panel) in PDMS and hTS cells by microarray analysis. Overlap: common genes; Bilateral regions: unique genes.

Characteristics of hTS Cells.

(A) Histology of an ectopic pregnancy at fallopian tube by HE staining (left large panel). Bla: blastocyst, V: chorionic villi, FT: fallopian tube. Immunocytochemistry of SSEAs (red, arrow) showed SSEA-1 in the cytoplasm (left upper); SSEA-3 in the nucleus (middle upper); and SSEA-4 in both the cytoplasm and the membrane (right upper), corresponding to cytotrophoblasts in the ectopic chorionic villus (lower panel). (B) Immunofluorescent Oct4 and Cdx2 at passage 9 (P-9), Oct4 and Nanog expressed in the nuclei at passage 9 (P-9) and 17 (P-17) (left column). Scale bar: 20 µm. Expression of Cdx2, Oct4, Sox2, and Nanog in the nuclei in the amplified cells (middle and right columns). Scale bar: 10 µm. (C) Expression of specific genes of both trophectoderm (TE) and ICM by RT-PCR. (D) hTS cells expressed genes of three germ layers before induction (left column) and after appropriate induction (right column). (E) For cellular homogeneity, Oct4-positive cells in P-9 and P-17 with 100% and 97.3%, respectively, by TissueGnostics analysis. n = total cell number counted. (F) Flow cytometric analysis at passage 15, cells expressed positive Oct4, Nanog, Sox2, and Cdx2 were 97.9%, 98.7%, 95%, and 94%, respectively. (G) Southern blots showed no obvious change in telomere length at passages 3 (P-3) and 7 (P-7). (H) Distinction between hTS cells and PDMS cells in global gene expressions (total 54,675 genes; p<0.05 and fold change >2) with a homogenous histogram. (I) Different relative intensity values of genes (4,864 genes) between PDMS and hTS cells. Blue box indicating 50% of total genes and error bars indicating 25% and 75%. (J) Venn diagram illustrated the numbers of immue-related genes (upper panel) and mesenchymal genes (lower panel) in PDMS and hTS cells by microarray analysis. Overlap: common genes; Bilateral regions: unique genes. The hTS cells expressed specific genes of the TE (i.e., Cdx2, Fgfr-2, Eomes, and BMP4), the ICM (i.e., Oct4, Nanog, FGF4, and Sox2) (Fig. 1C), as well as the three primary germ layers (Fig. 1D). We then evaluated for cellular homogeneity. With TissueGnostics analysis, we found that these cells expressed 100% and 97.3% Oct4-positive cells at passages 9 and 17, respectively (Fig. 1E). Flow cytometry with Oct4, Sox2, Nanog and Cdx2 at passage 15 demonstrated 97.9%, 95.0%, 98.7%, and 94.0% positive cells, respectively (Fig. 1F). Flow cytometry with surface markers CD44, CD73, CD105 and HLA-ABC at passages 3 and 9 also demonstrated over 97% positive (Fig. S1C). These results show that hTS cells are a highly homogenous population. Flow cytometric analysis demonstrated that hTS cells expressed mesenchymal, but not hematopoietic, stem cell characteristics (Fig. S1D). Upon appropriate induction (Table S2), they gave rise to a variety of specific cell phenotypes such as osteoblasts, chondrocytes, myocytes, and adipocytes (Fig. S1E). Neither change in karyotype (46, XY) by chromosome analyses (Fig. S1F) nor in telomere length by Southern blots (Fig. 1G) was observed in a series of cell cultures. We defined these isolated cells as hTS cells. An important question is whether hTS cells are distinct from PDMS cells. To investigate, we utilized the Affymetrix platform to compare global gene expressions between them. The results showed that the gene distribution differed not only with their histogram patterns (Fig. 1H), but also with their intensity values (Fig. 1I). Of the total 54,675 genes, 4,864 genes (8.9%) were distinct between them, including molecular and cellular functions and physiological system development (Table S3). Furthermore, both exhibited unique genes with respect to immune and mesenchymal characteristics (Fig. 1J and Table S4). Therefore, we concluded that hTS cells represented a unique TE-derived stem cell population distinct from PDMS cells obtained from the uterus.

LIF Maintains the Proliferative Capability of hTS Cells

Previous studies show that gradient levels of LIF exist in the fallopian tube [11] and that in the absence of LIF, ES cells differentiate into the TE fate [14]. To mimic the environment, we investigated the effect of LIF on hTS cells. We treated hTS cells with different concentrations of LIF (i.e., 500, 250, and 125 IU/ml) for 3-days each. Of the pluripotency-associated transcription factors, LIF (500 IU/ml) induced overexpressions of Oct4 and Sox2, but not Nanog and Cdx2 by RT-PCR (Fig. 2A). By flow cytometry, withdrawal of LIF (500 IU/ml) overexpressed Nanog and Cdx2; however, it suppressed Oct4 and Sox2 in a dose-dependent manner (Fig. 2B, Fig. 2C, and Fig. S2A). As the hTS cells travel from a high LIF environment to a low LIF environment along the fallopian tube, the relative Nanog/Cdx2 ratio increases (>2-fold), but the Oct4/Cdx2 ratio decreases (Fig. 2D). By using siRNAs and shRNAs, we also show that knockout of Nanog promoted expressions of Cdx2, and knockout of Cdx2 promoted Nanog (Fig. 2E, Fig. 2F, and Fig. S2B). Similar to the reciprocal relationship between Oct4 and Cdx2 in ES cells [21], we showed the existence of a reciprocal relationship between Nanog and Cdx2 in hTS cells. Expression of Cdx2 is required for maintaining the trophoblastic phenotype. These results suggested that Oct4 is involved in the maintenance of pluripotency at the early TE cells and Nanog enhanced the pluripotent capability in hTS cells at a later stage during transportation in the tube.
Figure 2

Regulation of Pluripotency Transcription Factors by LIF.

(A) Expressions of Nanog, Cdx2, Sox2 and Oct4 mRNAs after treating different concentrations of LIF (B) By flow cytomery, withdrawal of LIF overexpressed Nanog and (C) enhanced expression of Nanog and Cdx2 but suppressed Oct4 and Sox2. (D) Physiological gradient of LIF levels from ampulla toward isthmus with an increased Nanog/Cdx2 ratio, but a decreased Oct4/Cdx2 ratio in a dose-dependent manner. (E) A reciprocal relationship between Nanog and Cdx2 evidenced by pretreatment with siRNAs (10−8 M, Sigma) and (F) with shRNAs (10−8 M, Sigma), respectively.

Regulation of Pluripotency Transcription Factors by LIF.

(A) Expressions of Nanog, Cdx2, Sox2 and Oct4 mRNAs after treating different concentrations of LIF (B) By flow cytomery, withdrawal of LIF overexpressed Nanog and (C) enhanced expression of Nanog and Cdx2 but suppressed Oct4 and Sox2. (D) Physiological gradient of LIF levels from ampulla toward isthmus with an increased Nanog/Cdx2 ratio, but a decreased Oct4/Cdx2 ratio in a dose-dependent manner. (E) A reciprocal relationship between Nanog and Cdx2 evidenced by pretreatment with siRNAs (10−8 M, Sigma) and (F) with shRNAs (10−8 M, Sigma), respectively.

RA Generates Trophoblast Neural Stem Cells in vitro

We then attempted to generate neural cells by treating hTS cells with RA over time (i.e., 1-, 3-, 5- and 7-days). A population of neural stem cells (NSCs) was generated with phenotypes similar to those neural restricted precursor subtypes described in previous studies [22], including glial restricted precursors (GRP), neuronal restricted precursors (NRP), multipotent neural stem cells (MNS), astrocytes (AST), and undefined trophoblast giant cells (TGC) (Fig. 3A, left panel). Notably, the composition of these phenotypes remained relatively stable within 5 days of RA treatment. However, at 7 days, most of the NSCs became undefined TGC (Fig. 3A, right panel), compatible with previous reports [23]. The precursor cells expressed neurofilament protein, nestin, and astrocyte-specific glial fibrillary acidic protein (GFAP) measured at day-3 and day-5 after treatment (Fig. 3C). Immunocytochemically, we found that they expressed NSC-specific markers, for example: GFAP and fibroblast growth factor receptor-1 (FGFR1) for GRP; βIII-tubulin and microtubule-associated protein 2 (MAP2) for NRP; and GFAP and vimentin for MNS (Fig. 3C). We found consistency in cellular characteristics of the RA-induced NSCs, hereby defined as trophoblast neural stem cells (tNSCs) in the following studies.
Figure 3

Biological Characteristics of tNSCs.

(A) Frequency of NSC sub-phenotypes after RA (10 µM) induction over time: 1-, 3-, 5- and 7-days at first, second, third, and fourth row, respectively. n: total cells counted. GRP: glial restricted precursors; NRP: neuronal restricted precursors; MNS: multipotent neural stem cells; and TGC: undetermined trophoblast giant cells. (B) Flow cytometric comparison of RA-induced nestin, GFAP, and neurofilament expressions between 3-day and 5-day. Data represent mean ± SD (n = 3). (C) Immunocytochemical identification of GRP, NRP and MNS with specific markers. (D) Expression of RA-associated genes before and after RA induction for 1-day by RT-PCR. (E) RA-induced overexpression of Nanog by flow cytomertic and (F) immunocytochemical analysis (n = 60 for each item) by Student t-test. (G) Withdrawal of LIF significantly promoted expression of Nanog induced by RA (10 µM) by flow cytometry. *: p<0.01 compared to the control. All data indicate mean ± SD (n = 3).

Biological Characteristics of tNSCs.

(A) Frequency of NSC sub-phenotypes after RA (10 µM) induction over time: 1-, 3-, 5- and 7-days at first, second, third, and fourth row, respectively. n: total cells counted. GRP: glial restricted precursors; NRP: neuronal restricted precursors; MNS: multipotent neural stem cells; and TGC: undetermined trophoblast giant cells. (B) Flow cytometric comparison of RA-induced nestin, GFAP, and neurofilament expressions between 3-day and 5-day. Data represent mean ± SD (n = 3). (C) Immunocytochemical identification of GRP, NRP and MNS with specific markers. (D) Expression of RA-associated genes before and after RA induction for 1-day by RT-PCR. (E) RA-induced overexpression of Nanog by flow cytomertic and (F) immunocytochemical analysis (n = 60 for each item) by Student t-test. (G) Withdrawal of LIF significantly promoted expression of Nanog induced by RA (10 µM) by flow cytometry. *: p<0.01 compared to the control. All data indicate mean ± SD (n = 3). In tNSCs, RA induction promoted expressions of NSC-related markers (e.g., nestin, neurofilament, Ngn3, MAP-2, NeuroD, CD133, and Oct4), of RA receptors (e.g., RARβ, RARγ, RXRα, and RXRβ), and most importantly, of RA-synthesizing enzymes RALDH-2 and -3 (Fig. 3D). The expression of RALDH-2 and -3 in hTS cells and tNSCs was unique because hES cells or even the retinol-treated ES cells do not express RALDH-2 [24]. By flow cytometry and immunocytochemistry, results showed that RA induced significant overexpression of Nanog and Oct4 but less so Cdx2 in hTS cells (Fig. 3E and Fig. 3F). To this end, we showed that RA efficiently induced hTS cells into tNSCs, maintaining a steady state within 5 days.

Withdrawal of LIF Promotes Nanog Expression for Pluripotency of tNSCs

Given that LIF can interplay with RA on neural differentiation of ES cells [25], we examined the effect of LIF on the RA-induced Nanog expression in tNSCs. To mimic the microenvironment of the fallopian tube, we first incubated hTS cells with LIF in variable concentrations (i.e., 500, 250, 125 IU/ml). On the 3rd day, we added RA (10 uM) for 1-day before analysis. Flow cytometry showed that a higher level of LIF significantly repressed the RA-induced Nanog (Fig. 3F and Fig. S3). These results suggested that as hTS cells move towards the isthmus, the better the RA’s ability to maintain cellular pluripotency by Nanog expression.

RA Induces Nanog through Non-genomic Signaling Pathway

How does RA induce Nanog expression? We explored the molecular mechanisms of RA-induced Nanog in hTS cells. Previous studies report that eukaryotic Initiation factor 4B (eIF4B) is involved in the initiation phase of eukaryotic translation [26] through binding to internal ribosome entry site (IRES) [27]. c-Src mRNA has also been reported to contain an IRES element [28]. Activation of eIF4B might also be associated with c-Src mRNA activity for translation initiation [26], [29]. In the developing striatum and hippocampus, an increased Src kinase activity coincides not only with the peak period of neuronal differentiation and growth [30], but also the characteristics of self-renewal [31]. We found that RA promoted production of eIF4B in between 1–4 hr of incubation but faded away at 24 hr (Fig. 4A). This action was inhibited with eIF4B siRNA (Fig. 4B). We found that RA induced a rapid and transient expression of c-Src mRNA, peaking at 15 min (Fig. 4C), followed by production of c-Src protein at 1 hr (Fig. 4D). Notably, RA failed to induce c-Src mRNA elevation by qPCR at 1-day treatment (Fig. 4E).
Figure 4

A Non-genomic RA Signaling Pathway.

(A) Time course of RA induced production of eIF4B. (B) Activation of c-Src was inhibited by using eIF4B siRNA. (C) RA (10 µM) induced a rapidly transient elevation of c-Src mRNA peaking at 15 min in hTS cells. Data represent mean ± SD (n = 3); *:p<0.01 in Student’s t test. (D) RA induced fast production of c-Src and phosphorylation of Stat3 in 1 hr by Western blots. β-actin: control. (E) qPCR assay showed that RA did not induce expression of c-Src mRNA at 1 day incubation and expression c-Src mRNA was not affected by using 2 different eIF4B siRNAs. (F) Stat3 directly interacted with c-Src by IP assay. (G) c-Src siRNA inhibited expression of Stat3. (H) c-Src inhibitor PP1 analog (4 µM) inhibited the RA-induced phosphorylation of Stat3 and RA induced overexpression of Nanog in hTS cells by Western blots. (I) RA induced binding interaction of Stat3 and Nanog promoter by ChIP assay. (J) Nanog expression was inhibited by Stat3 siRNA. (K) Schematic of the RA-induced c-Src/Stat3/Nanog pathway via subcellular c-Src mRNA localization in hTS cells. Dotted line indicates undetermined mechanism(s).

A Non-genomic RA Signaling Pathway.

(A) Time course of RA induced production of eIF4B. (B) Activation of c-Src was inhibited by using eIF4B siRNA. (C) RA (10 µM) induced a rapidly transient elevation of c-Src mRNA peaking at 15 min in hTS cells. Data represent mean ± SD (n = 3); *:p<0.01 in Student’s t test. (D) RA induced fast production of c-Src and phosphorylation of Stat3 in 1 hr by Western blots. β-actin: control. (E) qPCR assay showed that RA did not induce expression of c-Src mRNA at 1 day incubation and expression c-Src mRNA was not affected by using 2 different eIF4B siRNAs. (F) Stat3 directly interacted with c-Src by IP assay. (G) c-Src siRNA inhibited expression of Stat3. (H) c-Src inhibitor PP1 analog (4 µM) inhibited the RA-induced phosphorylation of Stat3 and RA induced overexpression of Nanog in hTS cells by Western blots. (I) RA induced binding interaction of Stat3 and Nanog promoter by ChIP assay. (J) Nanog expression was inhibited by Stat3 siRNA. (K) Schematic of the RA-induced c-Src/Stat3/Nanog pathway via subcellular c-Src mRNA localization in hTS cells. Dotted line indicates undetermined mechanism(s). Subsequently, we found that active c-Src bound directly to signal transducer and activator of transcription 3 (Stat3) (Fig. 4F) by phosphorylation at site Tyr705 to produce protein, which was inhibited by c-Src siRNA (Fig. 4G). This action was also inhibited by a selective c-Src inhibitor PP-1 analog (Fig. 4H). We identified a direct action of Stat3 on the Nanog gene promoter by chromatin immunoprecipitation (ChIP) assay (Fig. 4I). Nanog was produced in 4 hr, which was inhibited by PP1 analog (Fig. 4H) and by Stat3 siRNA (Fig. 4J). For hTS cells, we propose the possibility of an RA-activated non-genomic eIF4B/c-Src/Stat3/Nanog signaling pathway through subcellular c-Src mRNA localization (Fig. 4K). The mechanism of RA-induced activation of eIF4B and the direct relationship between eIF4B and c-Src will require further study. How the RA-activated Nanog maintains hTS cell pluripotency will also require further study.

Cell Therapy Regenerates Nigrostriatal Pathway and Improves Behavioral Deficits in Acute and Chronic PD Rats

To determine the efficacy of cell therapy and the cell fate potential of tNSCs in animal studies, we grafted the cells into the brain of PD rats. We produced 6-hydroxydopamine (6-OHDA)-caused PD rats (Text S1). In acute PD rats, we performed the apomorphine-induced rotation test every 3-weeks up to 12-weeks post-cell therapy. Then we examined GFP-tagged hTS cells for cell fate at 18-weeks post-cell therapy. In chronic PD rats, we bred PD rats for over one year (average 12.3 months) in order to mimic the pathologically progressive nature of PD. After cell therapy, behavioral tests and validation of regeneration of dopaminergic nigrostriatal pathway were performed.

In Acute PD Rats

We transfected hTS cells with F1B(-540)-GFP plasmid construct (kindly provided by Dr. I. M. Chiu) to yield a success rate of over 95%. For cell therapy, acute PD rats were divided into three groups: group (a) received the GFP-tagged 1-day RA-induced tNSCs (n = 4); group (b) received GFP-tagged 5-day RA-induced tNSCs (n = 4); and group (c) received PBS solution as control (n = 4). We transplanted the tNSCs into the lesioned striatum (STR) under anesthesia. We performed the apomorphine-induced rotation test every 3 weeks post-cell therapy (Fig. 5A). The results of group (a) showed a significant improvement in rotational behavior from 3-weeks to 12-weeks post-cell therapy. The results of group (b) showed significant improvement during the initial 6-weeks, but the improvement was gradually lost after the 6th week. No improvement was observed in control group (c).
Figure 5

Transplantation of tNSCs in Acute PD Rats.

(A) Apomorphine-induced rotation tests. Group (a) (blue line, n = 4) received 1-day RA-induced tNSCs. Group (b) (green line, n = 4) received 5-day RA-induced NSCs. Group (c) indicated control (red line, n = 4). Statistic analysis by repeated measure ANOVA: p-value = 0.001. LSD post hoc comparisons after repeated measure ANOVA in between two groups: *: p<0.05; **: p<0.01. (B) Regeneration of TH-positive cells at the STR (upper) and the SNC (lower) of lesioned side 18-week after cell therapy. Scale bar: 100 µm. (C). Amplified dopaminergic neuronal circuitry in the lesioned SNC (upper). A comparative normal feature shown in the lower panel. (D) No TH-positive immunoreactivity was found in the lesioned STR (upper panel) and subthalamic nucleus (STN, lower panel) of group (b) and (E) group (c). Arrow: needle track. (F) Presence of GFP-tagged tNSCs (arrow) at the STR (upper panel) and the SNC (lower panel) 18-weeks post-cell therapy.

Transplantation of tNSCs in Acute PD Rats.

(A) Apomorphine-induced rotation tests. Group (a) (blue line, n = 4) received 1-day RA-induced tNSCs. Group (b) (green line, n = 4) received 5-day RA-induced NSCs. Group (c) indicated control (red line, n = 4). Statistic analysis by repeated measure ANOVA: p-value = 0.001. LSD post hoc comparisons after repeated measure ANOVA in between two groups: *: p<0.05; **: p<0.01. (B) Regeneration of TH-positive cells at the STR (upper) and the SNC (lower) of lesioned side 18-week after cell therapy. Scale bar: 100 µm. (C). Amplified dopaminergic neuronal circuitry in the lesioned SNC (upper). A comparative normal feature shown in the lower panel. (D) No TH-positive immunoreactivity was found in the lesioned STR (upper panel) and subthalamic nucleus (STN, lower panel) of group (b) and (E) group (c). Arrow: needle track. (F) Presence of GFP-tagged tNSCs (arrow) at the STR (upper panel) and the SNC (lower panel) 18-weeks post-cell therapy. Next we verified the recovery of the nigrostriatal pathway by immunocytochemical studies. In group (a), abundant newly generated TH-positive neurons appeared in the lesioned substantia nigra pars compacta (SNC) with multiple outgrowths to form neural circuitries with the surrounding host tissues (Fig. 5B and Fig. 5C). We did not observe such phenomena in group (b) (Fig. 5D) and in control group (c) (Fig. 5E). No immuno-suppressive agent was used and no teratoma formation was found. To investigate the viability of those implanted GFP-tagged tNSCs in the brain, PD rats were sacrificed at 18-weeks post-implantation and their brain sections were examined by immunofluorescent analysis. The results revealed that the GFP-tagged tNSCs remained sporadically in clusters in the lesioned STR and SNC (Fig. 5F).

In Chronic PD Rats

During the breeding period, we performed the apomorphine-induced rotation test monthly to ascertain the ratsPD state until cell therapy. Behavioral assessments were performed every 3 weeks post-cell therapy, including the apomorphine-induced rotation test, the bar test for akinesia, the stepping test for rigidity, and the footprint analyses for postural imbalance and gait disorder as described previously [19]. Group I (n = 6) was the control, while Group II (n = 6) received 1-day RA-induced tNSCs. In group II, we observed a significant improvement of the apomorphine-induced rotations from 3 weeks to 12 weeks post-cell therapy (Fig. 6A), similar to the previous acute PD rats study. The bar test showed that the grasping time of the affected forelimb was significantly shortened at 3-weeks and continued to improve at 12-weeks (Fig. 6B). Assessments by step length (Fig. 6C), stride length (Fig. 6D), walking speed (Fig. 6E), and base of support (Fig. 6F) revealed significant improvement from 3-weeks to 12-weeks post-cell therapy. These studies were performed on a transparent walkway recorded by video camera (Fig. 6G). These results indicated that cell therapy with tNSCs was able to regenerate the dopaminergic nigrostriatal pathway and functionally improved the behavioral impairments in both acute and chronic PD rats.
Figure 6

Behavioral Assessments in Chronic PD Rats.

(A) Apomorphine-induced rotations analysis revealed a significant improvement in chronic PD rats that received tNSCs cell therapy (Group II, n = 6, black round line) compared to the control group (Group I, n = 6, blank round line). (B) Bar tests (sec) improved at 3-week post-cell therapy. (C) Shortened step length and (D) stride length were significantly improved after 3-week post-cell therapy in PD rats. (E) Significant improvement in walking speed (cm/sec) in PD rats at 3-week post-cell therapy. (F) Significant shortening in base of support (mm) was seen at 3-week post-cell therapy. (G) A well-designed cage with a video camera for footprint analyses. (a): in normal rats, (b): in PD rats pre-cell therapy, and (c): post-cell therapy. Asterisk: compared to the control. Student’s t test: *:p<0.05; **: p<0.01; and ***: p<0.001.

Behavioral Assessments in Chronic PD Rats.

(A) Apomorphine-induced rotations analysis revealed a significant improvement in chronic PD rats that received tNSCs cell therapy (Group II, n = 6, black round line) compared to the control group (Group I, n = 6, blank round line). (B) Bar tests (sec) improved at 3-week post-cell therapy. (C) Shortened step length and (D) stride length were significantly improved after 3-week post-cell therapy in PD rats. (E) Significant improvement in walking speed (cm/sec) in PD rats at 3-week post-cell therapy. (F) Significant shortening in base of support (mm) was seen at 3-week post-cell therapy. (G) A well-designed cage with a video camera for footprint analyses. (a): in normal rats, (b): in PD rats pre-cell therapy, and (c): post-cell therapy. Asterisk: compared to the control. Student’s t test: *:p<0.05; **: p<0.01; and ***: p<0.001.

tNSCs Regenerate the Dopaminergic Nigrostriatal Pathway in vivo

Next, we compared the regeneration of the dopaminergic nigrostriatal pathway after cell therapy with tNSCs by immunofluorescence tissue analysis between acute and chronic PD rats. We investigated brain sections of post-cell therapy acute PD rats (n = 2 at 1-week post-injury, n = 2 at 6-weeks post-injury, n = 2 as sham control for post-injury, n = 6 at 12-weeks post-cell therapy, and n = 2 as sham control for cell therapy) and post-cell therapy chronic PD rats (n = 2 at 12-weeks post-cell therapy and n = 2 as sham control for cell therapy). In the post-injury PD rats at 6-weeks, the 6-OHDA caused progressive neural degeneration in the SNC, resulting in various cavities immunohistochemically (Fig. 7A). Quantitative analysis showed that the number of DA neurons in the SNC reduced to 48% at 1-week post-injury and to 13% at 6-weeks post-injury compared to the intact side (Fig. 7B and Fig. S4). In the STR, DA neurons were reduced to 78% at 1-week post-injury and to 4% at 6-weeks post-injury (Fig. 7B). In acute PD rats at 12-weeks post-cell therapy, tNSCs generated numerous DA neurons at the cavity wall with TH-positive nervous terminals projecting into the cavity (Fig. 7A, insert). We found that DA neurons had regenerated to 67% in the SNC and to 73% in the STR.
Figure 7

in vivo Regeneration of TH(+) and GFAP(+) Cells with Less Immuno-responses.

(A) Immunohistofluoresence analysis. TH(+) and NeuN(+) motor neurons (arrow) in the SNC of control (left upper). Decreased TH(+) (arrow) at 1-week after 6-OHDA injury (right upper). Apparent reduction in TH(+) neurons with disarrangement of TH-positive neural terminals (green granules), and various degenerative cavity formation (red hollow circle) at 6-week post-injury (left lower). After transplantation at 12-weeks, TH(+) neurons (arrow) at wall of the degenerative cavity (red hollow circle; insert) with TH(+) neural terminals (green color) projecting into the cavity (right lower). (B) Number of TH(+) cells at 1- and 6-weeks reduced to 48% and 13% in the lesioned SNC (red) and 78% and 4% in the lesioned STR (light blue), respectively, post-injury. After transplantation, TH(+) cells re-grew up to 67% and 73% in the lesioned SNC and STR, respectively (right panel). Data analyzed by the software Tissuequest 2.0 (TissueGnostics Gmbh, Vienna, Austria). (C) Regeneration of dopaminergic neurons in the lesioned SNC (lower panel) with amplification (left upper, insert a) compared with the intact side (right upper, insert b). (D) Transplantation of tNSCs at 12-weeks yielded 78% of recovery rate in TH-positive neurons in the lesioned SNC compared to the intact side. Data represent mean ± SD (n = 3). (E) Degeneration of TH-FITC(+) and GFAP-Cy-3(+) Wilson’s pencils (blank arrow) at 6-week post-injury in the lesioned STR (left column). At 12-weeks post-cell therapy (right column), several GFAP(+) cells (arrow) appeared inside the fine fibers of re-established Wilson’s pencils (blank arrow). (F) For immunohistofluorescence imaging analysis, cells were counted in the gate (left scatter plots) determined by the location of cell size (8–10 µm in diameter) and its corresponding intensity of GFAP-Cy-3. Gate (red scatter plot): glial cells counted; black scatter plots: exclusive cells with bizarre size; blue scatter plots: cells with abnormal GFAP intensity. In the STR, the GFAP(+) cells were 65.5% in the lesioned side before treatment and became 93.9% after cell therapy compared to the intact side (right panel). Data represent mean ± SD (n = 3). Student t-test. (G) hTS cells implanted into the SCID mice (n = 6) raised only minor immunoreactions and without tumorigenesis observed. Myxoid-like bizarre cells (black arrow), muscle fibers (blank arrow), and needle track (NT). (H) Flow cytometric analysis of hTS cells, tNSCs, and hES cells. High expression of HLA-ABC in hTS cells and tNSCs, but less in hES cells. No HLA-DR expressed among them. Immune-related gene expressions, including CD14, CD44, CD33, CD34, CD105, and CD133, were compared among them.

in vivo Regeneration of TH(+) and GFAP(+) Cells with Less Immuno-responses.

(A) Immunohistofluoresence analysis. TH(+) and NeuN(+) motor neurons (arrow) in the SNC of control (left upper). Decreased TH(+) (arrow) at 1-week after 6-OHDA injury (right upper). Apparent reduction in TH(+) neurons with disarrangement of TH-positive neural terminals (green granules), and various degenerative cavity formation (red hollow circle) at 6-week post-injury (left lower). After transplantation at 12-weeks, TH(+) neurons (arrow) at wall of the degenerative cavity (red hollow circle; insert) with TH(+) neural terminals (green color) projecting into the cavity (right lower). (B) Number of TH(+) cells at 1- and 6-weeks reduced to 48% and 13% in the lesioned SNC (red) and 78% and 4% in the lesioned STR (light blue), respectively, post-injury. After transplantation, TH(+) cells re-grew up to 67% and 73% in the lesioned SNC and STR, respectively (right panel). Data analyzed by the software Tissuequest 2.0 (TissueGnostics Gmbh, Vienna, Austria). (C) Regeneration of dopaminergic neurons in the lesioned SNC (lower panel) with amplification (left upper, insert a) compared with the intact side (right upper, insert b). (D) Transplantation of tNSCs at 12-weeks yielded 78% of recovery rate in TH-positive neurons in the lesioned SNC compared to the intact side. Data represent mean ± SD (n = 3). (E) Degeneration of TH-FITC(+) and GFAP-Cy-3(+) Wilson’s pencils (blank arrow) at 6-week post-injury in the lesioned STR (left column). At 12-weeks post-cell therapy (right column), several GFAP(+) cells (arrow) appeared inside the fine fibers of re-established Wilson’s pencils (blank arrow). (F) For immunohistofluorescence imaging analysis, cells were counted in the gate (left scatter plots) determined by the location of cell size (8–10 µm in diameter) and its corresponding intensity of GFAP-Cy-3. Gate (red scatter plot): glial cells counted; black scatter plots: exclusive cells with bizarre size; blue scatter plots: cells with abnormal GFAP intensity. In the STR, the GFAP(+) cells were 65.5% in the lesioned side before treatment and became 93.9% after cell therapy compared to the intact side (right panel). Data represent mean ± SD (n = 3). Student t-test. (G) hTS cells implanted into the SCID mice (n = 6) raised only minor immunoreactions and without tumorigenesis observed. Myxoid-like bizarre cells (black arrow), muscle fibers (blank arrow), and needle track (NT). (H) Flow cytometric analysis of hTS cells, tNSCs, and hES cells. High expression of HLA-ABC in hTS cells and tNSCs, but less in hES cells. No HLA-DR expressed among them. Immune-related gene expressions, including CD14, CD44, CD33, CD34, CD105, and CD133, were compared among them. In chronic PD rats at 12-weeks post-cell therapy, immunohistochemical study revealed that DA neuronal circuitries were substantially regenerated in the therapeutic side of the SNC, mirroring the intact side (Fig. 7C), consistent with our previous studies. The recovery of DA neurons reached 78% in the SNC (Fig. 7D). Glial cells are known to play as mediators in guiding the migration of neurons to their destinations or as sources of neural regeneration [32]. We found that in the STR, 6-OHDA in chronic PD rats caused not only degeneration of both GFAP(+) cells and DA neurons, but also disarrangement of the striatopallidal fibers (pencils of Wilson) and nigral axons. These phenomena were improved after tNSC therapy, showing numerous GFAP(+) cells embedded in the fine myelinated fibers (Fig. 7E). The GFAP(+) cells regenerated from 66% at 6-weeks post-injury to 94% at 12-weeks post-cell therapy in the lesioned STR (Fig. 7F). These results indicated that transplantation of tNSCs regenerated the dopaminergic nigrostriatal pathway in chronic PD rats. No teratoma formation was found in both the acute and the chronic PD rats. Longer term studies beyond 18-weeks post-transplantation may be useful.

tNSCs Exhibit Immune Advantages for Transplantation

Translation of stem cells into cell therapies requires the understanding of their antigenicity and immunogenicity for any clinical application to be useful. We first implanted the hTS cells into male severe combined immunodeficient (SCID) mice intramuscularly for 6–8 weeks. Histologically, no teratoma was found; but we observed myxoid-like bizarre cells between the muscle fibers (Fig. 7G). hTS cells appear to indicate immune advantages compared to hES cells with respect to teratoma formation [33], [34]. We then compared the expressions of immune-related genes among hTS cells, tNSCs, and hES cells. In vitro, HLA-ABC (MHC-I) was expressed highly in hTS cells (99.4%) and in tNSCs (99.7%), but lower in hES cells (12.9%); however, no surface HLA-DR (MHC-II) was expressed among them (Fig. 7F). No major difference was found among the three cells for innate immune system marker CD14, for effector-memory T-cells marker CD44, and for human endothelial cell proliferation marker CD105. Surprisingly, hES cells and tNSCs expressed the immature hematopoietic and endothelial cell marker CD34, linked to neurogenesis and angiogenesis [35], while hTS cells expressed significantly less. Both hTS and hES cells expressed a myeloid leukemia-associated marker CD33 and cancer stem cell marker CD133, while tNSCs expressed significantly less.

Discussion

The search for an alternative cell source for treatment of PD has been challenging [1], [2], [3], [4], [5], [6]. Here, we isolated hTS cells from preimplantation embryos in women with ectopic pregnancy. hTS cells are not only distinct from PDMS cells, but also exhibit hES cell-like qualities in pluripotency and viability in proliferation. Given that hTS cells originate from the TE and not from the ICM of the blastocyst, hTS cells circumvent the socio-ethical issues that surround the use of hES cells. Furthermore, ectopic pregnancies account for 1 to 2% of all pregnancies in industrialized countries and even higher in developing countries; thus, providing a locally abundant source of stem cells with relatively closer genetic make-up for patients in need of cell therapy. It is interesting to note that hTS cells express both the markers of the ICM and TE. In murine embryos, Oct4 protein is detected in the ICM but not the TE. However, in porcine and bovine blastocysts, Oct4 protein is detected in both the ICM and the TE [36]. In human blastocysts, there is 31 times higher concentration of Oct4 mRNA in the ICM than that in the TE [37]. In hTS cells, we show co-expressions of pluripotent markers such as Oct4 and SSEA-4 along with TE-specific marker Cdx2. This may be specific to ectopic pregnancy-derived hTS cells and possibly due to the microenvironment of a tubal ectopic pregnancy. Further study of this microenvironment is required. At the preimplantation stage, extrinsic factors like LIF [9] may influence the epigenetic gene regulation in embryos. Not surprisingly, LIF affected the fate choice of hTS cells similar to its action on ES cells [9], [25]. Mimicking the microenvironment in the fallopian tube, we showed that withdrawal of LIF in hTS cells downregulated Oct4, but upregulated Nanog and Cdx2. This fact suggested that Oct4 was initially responsible for the pluripotent state. However, hTS cell pluripotency became dependent of Nanog at a later stage, consistent with the notion that Nanog plays a crucial role in cell fate specification following the formation of the blastocyst [38]. The elevation of both Nanog and Nanog/Cdx2 ratio maybe responsible for the maintenance of pluripotency in hTS cells. Further study of this direct relationship is required. The overexpression of Cdx2 indicates hTS cell’s trophoblastic phenotype as it enhances the formation of TS cells in ES cells [14]. RA was capable of determining the neuronal fate choice of hTS cells. hTS cells expressed RALDH-2 and -3, which enables the metabolism of retinol into RA [15], while ES cells did not [25]. We have found some evidence to suggest that RA-enabled hTS cell differentiation into stable tNSCs through a non-genomic eIF4B/c-Src/Stat3/Nanog signaling pathway via subcellular c-Src mRNA localization. The fast transient production of c-Src was possibly related to the RA-trigged machinery in local protein synthesis rather than conventional genetic processes. We suggest that the RA-activated eIF4B is possibly and indirectly associated with subcellular c-Src mRNA localization in hTS cells. How RA induced eIF4B activation remains to be further evaluated. Critical details of the regulatory mechanisms between eIF4B and c-Src will require further study. A more comprehensive knowledge of this pathway in tNSC proliferation may provide helpful insight to why Src-kinase activity increases at the peak period of neurogenesis in the developing striatum and hippocampus [30] and why the disruption of Stat3 signaling contributes significantly to neuronal death in PD [39]. A potential therapeutic advantage of tNSCs is its proliferation of a variety of restricted neural precursor subtypes. Of which, GRP and astrocytes may be attributed to the regeneration of both DA neurons and glial cells in the lesioned nigrostriatal pathway, substantially promoting dopaminergic neurogenesis [6]. Another advantage is that tNSCs facilitated more site-specific integration rather than regional incorporation, as we observed neural regeneration only in the lesioned sites. Application of tNSCs in other central nervous system diseases must be researched. Previous studies report that hES cell-derived DA neurons do not survive in the grafted striatum and fail to improve the behavioral deficits in PD rats [40]. Cell therapy with tNSCs regenerated the dopaminergic nigrostriatal pathway and functionally improved the behavioral impairments in both acute and chronic PD rats. It is interesting to note from our animal studies that 1-day RA-induced tNSCs maintain long term effectiveness while the 5-day RA-induced tNSCs showed behavioral improvement in the beginning, but failed to be effective after 6-weeks. We believe that the transplanted 5-day RA-induced tNSCs were near the end of their effective window; that is, when most of the tNSCs transition into undefined giant cells. Contrastingly, the 1-day RA-induced tNSCs were extremely viable and once transplanted, maintained its regenerative effect. It may be helpful that tNSCs were implanted into the striatum of the brain, where cells would favorably meet an RA-enriched microenvironment [17], facilitating continuous proliferation in vivo. Moreover, the implanted tNSCs increased glial cells in the striatum, which is compatible with previous reports that RA induces the expression of GFAP [41] and that GFAP(+) progenitor cells may give rise to neurons and oligodendrocytes throughout the CNS [42]. The use of hTS cells in cell therapy may be optimal within an efficacy window: 1-day after RA-induction to tNSCs. In chronic PD rats, tNSCs regenerated about two-thirds of the DA neurons in the nigrostriatal pathway at 12-weeks post-cell therapy. This positively suggests that tNSCs may also be effective for treatment of patients that have suffered PD symptoms over a long period of time. However, the appropriate dosage of tNSCs for treatment of PD remains to be evaluated. Our investigation of hTS cell immune characteristics began with the intramuscular transplantation of hTS cells in SCID mice. Although we observed bizarre cells, we did not observe any teratoma formation. In subsequent animal studies, we neither used immunosuppressed mice nor immunosuppressants and no teratoma formation appeared. It has been reported that neural progenitor stem cells have immune privilege and have survived rejection in allografts [43]. It is interesting to note that by differentiation of hTS cells to tNSCs, RA-induced changes in expression of immune-related markers. For example, while the expression of CD34(+) increased, expressions of CD133(+) decreased. The biological significance is unclear. Nevertheless, it has been shown that autologous transplantation with CD34(+) immune-selected grafts is feasible in children with high-risk neuroblastoma [44], linking positive expression to graft feasibility. Also consistent with a recent report [45], lower CD133 expression in tNSCs may decreased the probability of tumorigenesis, as CD133(+) cells possess the capacity for unlimited self-renewal and can trigger brain tumor initiation [34]. Although it is promising that hTS cells were successfully employed for graft acceptance without teratoma formation in SCID mice and tNSCs in PD rats, further studies are warranted to investigate the possible immune responses of hTS cells or their derivatives after transplantation. In conclusion, hTS cells are a promising cell source for regenerative medicine. The source from tubal ectopic pregnancies is abundant. The culture requires no feeder layer. The induction to tNSCs is not only simple (RA) but also fast (1-day). tNSCs also show early indications of immune-privilege. hTS cells and hTS cell-derived tNSCs may be remarkable candidates for shortening research timeframes, creating new disease models, and also for the treatment of patients with PD and other neurodegenerative diseases. (A) Microscopic feature of ectopic pregnancy-derived chorionic villi dissected. (B) At passage 9 and 17, hTS cells co-expressed Oct4 (red) and Nanog (green) in a homogeneous distribution. Scale bar: 20 µm. Nucleus: blue DAPI color. (C) Flow cytometry with Oct4, Sox2, Nanog and Cdx2 at passage 15 demonstrated 97.9%, 95.0%, 98.7%, and 94.0% positive cells, respectively. (D) Flow cytometric analyses revealed that hTS cells express markers of mesenchymal stem cells but not markers of hematopoietic stem cells. (E) Differentiation of hTS cells into specific phenotypes, including osteoblasts, chondrocytes, myocytes, and adipocytes by appropriate inductions. (F) Chromosome analyses revealed that normal karyotypes (44,XY) did not change at passages 3, 10, and 15 of cultivation in hTS cells. (TIF) Click here for additional data file. (A) Withdrawal of LIF suppressed Oct4 and Sox2, but overexpressed Cdx2 by flow cytometry in hTS cells. (B) A reciprocal relationship between Nanog and Cdx2 evidenced by pretreatment with siRNAs (10−8 M, Sigma) by flow cytometry. Data represent mean ± SD, n = 3. (TIF) Click here for additional data file. Flow cytometry showed that RA (10 µM) enhanced Nanog expression by withdrawal of LIF levels from 500, 250, 125, toward 0 IU/ml after 3-day incubation in hTS cells. (TIF) Click here for additional data file. To qualify the TH(+)NeuN(+) neurons in the SNC pre- and post-cell therapy, coefficient of determination between TH-FITC and NeuN-Cy-3 was measured by immunohistofluorescent scatter plots in the chronic PD rats. Normal SNC: R2 = 0.72 (left upper); 6-OHDA damaged SNC (1-week), R2 = 0.77 (right upper); 6-OHDA damaged SNC (6-weeks), R2 = 0.25 (left lower); SNC after tNSCs transplantation (12-weeks), R2 = 0.66 (right lower). Result shown represents the average of 2 rats. (TIF) Click here for additional data file. All antibodies, primers, and reagents used in this study. (DOC) Click here for additional data file. Recipes used for cell differentiations. (DOC) Click here for additional data file. Significant distinction in biological functions in 4,864 distinguishable genes (p<0.005, fold change >2) between hTS cells and PDMS cells. (DOC) Click here for additional data file. Comparison of immune-related gene expression in relative intensity value between hTS cells and PDMS cells from Metasearch. (DOC) Click here for additional data file. Detailed experimental procedures and supporting references. (DOC) Click here for additional data file.
  44 in total

1.  GFAP-positive progenitor cells produce neurons and oligodendrocytes throughout the CNS.

Authors:  Kristen B Casper; Ken D McCarthy
Journal:  Mol Cell Neurosci       Date:  2006-02-03       Impact factor: 4.314

2.  Interaction between Oct3/4 and Cdx2 determines trophectoderm differentiation.

Authors:  Hitoshi Niwa; Yayoi Toyooka; Daisuke Shimosato; Dan Strumpf; Kadue Takahashi; Rika Yagi; Janet Rossant
Journal:  Cell       Date:  2005-12-02       Impact factor: 41.582

3.  In vitro and in vivo analyses of human embryonic stem cell-derived dopamine neurons.

Authors:  Chang-Hwan Park; Yang-Ki Minn; Ji-Yeon Lee; Dong Ho Choi; Mi-Yoon Chang; Jae-Won Shim; Ji-Yun Ko; Hyun-Chul Koh; Min Jeong Kang; Jin Sun Kang; Duck-Joo Rhie; Yong-Sung Lee; Hyeon Son; Shin Yong Moon; Kwang-Soo Kim; Sang-Hun Lee
Journal:  J Neurochem       Date:  2005-03       Impact factor: 5.372

4.  Establishment and characterization of a cytotrophoblast cell line from normal placenta of human origin.

Authors:  L Rong-Hao; S Luo; L Z Zhuang
Journal:  Hum Reprod       Date:  1996-06       Impact factor: 6.918

5.  pp60c-src expression in the developing rat brain.

Authors:  C A Cartwright; R Simantov; W M Cowan; T Hunter; W Eckhart
Journal:  Proc Natl Acad Sci U S A       Date:  1988-05       Impact factor: 11.205

6.  Specification of motoneurons from human embryonic stem cells.

Authors:  Xue-Jun Li; Zhong-Wei Du; Ewa D Zarnowska; Matthew Pankratz; Lauren O Hansen; Robert A Pearce; Su-Chun Zhang
Journal:  Nat Biotechnol       Date:  2005-01-30       Impact factor: 54.908

7.  Quantification of endogenous retinoic acid in limited biological samples by LC/MS/MS.

Authors:  Maureen A Kane; Na Chen; Susan Sparks; Joseph L Napoli
Journal:  Biochem J       Date:  2005-05-15       Impact factor: 3.857

8.  Transplantation of human embryonic stem cell-derived neural progenitors improves behavioral deficit in Parkinsonian rats.

Authors:  Tamir Ben-Hur; Maria Idelson; Hanita Khaner; Martin Pera; Etti Reinhartz; Anna Itzik; Benjamin E Reubinoff
Journal:  Stem Cells       Date:  2004       Impact factor: 6.277

9.  Administration of CD34+ cells after stroke enhances neurogenesis via angiogenesis in a mouse model.

Authors:  Akihiko Taguchi; Toshihiro Soma; Hidekazu Tanaka; Takayoshi Kanda; Hiroyuki Nishimura; Hiroo Yoshikawa; Yoshitane Tsukamoto; Hiroyuki Iso; Yoshihiro Fujimori; David M Stern; Hiroaki Naritomi; Tomohiro Matsuyama
Journal:  J Clin Invest       Date:  2004-08       Impact factor: 14.808

10.  Identification of human brain tumour initiating cells.

Authors:  Sheila K Singh; Cynthia Hawkins; Ian D Clarke; Jeremy A Squire; Jane Bayani; Takuichiro Hide; R Mark Henkelman; Michael D Cusimano; Peter B Dirks
Journal:  Nature       Date:  2004-11-18       Impact factor: 49.962

View more
  3 in total

1.  Retraction: Ectopic Pregnancy-Derived Human Trophoblastic Stem Cells Regenerate Dopaminergic Nigrostriatal Pathway to Treat Parkinsonian Rats.

Authors: 
Journal:  PLoS One       Date:  2021-02-11       Impact factor: 3.240

2.  Dynamic Trk and G Protein Signalings Regulate Dopaminergic Neurodifferentiation in Human Trophoblast Stem Cells.

Authors:  Eing-Mei Tsai; Yu-Chih Wang; Tony Tung-Yin Lee; Cheng-Fang Tsai; Hung-Sheng Chen; Feng-Jie Lai; Kazunari K Yokoyama; Tsung-Hsun Hsieh; Ruey-Meei Wu; Jau-Nan Lee
Journal:  PLoS One       Date:  2015-11-25       Impact factor: 3.240

Review 3.  Spontaneous remission of membranous glomerulonephritis with successful fetal outcome: A case report and literature review.

Authors:  Yan-Mei Huang; Hui-Rong Zhou; Ling Zhang; Ke-Ke Yang; Jiang-Xi Luo; Hai-Lu Zhao
Journal:  Medicine (Baltimore)       Date:  2016-06       Impact factor: 1.889

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.