Literature DB >> 23271929

Constitutional and somatic methylation status of DMRH19 and KvDMR in Wilms tumor patients.

Leila C A Cardoso1, Jair A Tenorio Castaño, Hanna S Pereira, Maria Angélica de F D Lima, Anna Cláudia E Dos Santos, Paulo S de Faria, Sima Ferman, Héctor N Seuánez, Julián B Nevado, José Carlos Cabral de Almeida, Pablo Lapunzina, Fernando R Vargas.   

Abstract

The most frequent epigenetic alterations in Wilms tumor (WT) occur at WT2, assigned to 11p15. WT2 consists of two domains: telomeric domain 1 (DMRH19) that contains the IGF2 gene and an imprinted maternally expressed transcript (H19) and centromeric domain 2 (KvDMR) that contains the genes KCNQ1, KCNQ1OT1 and CDKN1C. In this work, we used pyrosequencing and MS-MLPA to compare the methylation patterns of DMRH19/KvDMR in blood and tumor samples from 40 WT patients. Normal constitutional KvDMR methylation indicated that most of the epigenetic alterations in WT occur at DMRH19. Constitutional DMRH19 hypermethylation (HM DMRH19) was observed in two patients with Beckwith-Wiedemann syndrome. Pyrosequencing and MS-MLPA showed HM DMRH19 in 28/34 tumor samples: 16/34 with isolated HM DMRH19 and 12/34 with concomitant HM DMRH19 and KvDMR hypomethylation, indicating paternal uniparental disomy. With the exception of one blood sample, the MS-MLPA and pyrosequencing findings were concordant. Diffuse or focal anaplasia was present in five tumor samples and was associated with isolated somatic HM DMRH19 in four of them. Constitutional 11p15 methylation abnormalities were present in 5% of the samples and somatic abnormalities in the majority of tumors. Combined analysis of DMRH19/KvDMR by pyrosequencing and MS-MLPA is beneficial for characterizing epigenetic anomalies in WT, and MS-MLPA is useful and reliable for estimation of DNA methylation in a clinical setting.

Entities:  

Keywords:  MS-MLPA; epigenetic; histopathology; methylation; pyrosequencing

Year:  2012        PMID: 23271929      PMCID: PMC3526076          DOI: 10.1590/S1415-47572012005000073

Source DB:  PubMed          Journal:  Genet Mol Biol        ISSN: 1415-4757            Impact factor:   1.771


Introduction

Wilms tumor (WT) is the most frequent extra-cranial solid cancer in childhood, accounting for 6–7% of all childhood neoplasias (Miller ). In 80% of cases, WT is diagnosed in children less than five years old. In Brazil, the age-adjusted incidence for WT in children up to 14 years old varies from five to 18 cases per million (De Camargo ). Bilateral presentation is observed in 5–10% of affected individuals (Dome and Huff, 2011). In most cases, WT is present as a sporadic, isolated disorder, although it may sometimes be a component of complex, congenital clinical entities such as WAGR (Wilms, Aniridia, Genitourinary congenital anomalies, Retarded development) syndrome, Denys-Drash syndrome (DDS: male pseudohermaphroditism, renal mesangial sclerosis) and Beckwith-Wiedemann syndrome (BWS: overgrowth, omphalocele and hemihypertrophy), among others (Scott ; Nakamura and Ritchey, 2010). The most frequent epigenetic alterations in WT occur at the WT2 region in 11p15, secondary to either imprinting center mutations that result in isolated epigenetic defects or paternal uniparental disomies (UPD) (Scott ). WT2 consists of two domains that contain several genes: the telomeric domain 1 contains the insulin-like growth factor 2 (IGF2) gene and an imprinted maternally expressed transcript (H19), while the centromeric domain 2 contains the potassium voltage-gated channel gene (KCNQ1), the KCNQ1 opposite strand/antisense transcript 1 gene (KCNQ1OT1) and the dependent kinase inhibitor 1C gene (CDKN1C) (Smith ; Scott ). In domain 1, IGF2 is normally expressed only by the paternal allele, in contrast to H19 that transcribes an untranslated messenger RNA that is only maternally expressed. The expression of these genes is regulated by the differentially methylated region H19 (DMRH19) located upstream of the H19 promoter; this region is normally methylated only in the paternal allele. Abnormal methylation of DMRH19 leads to loss of IGF2 imprinting control and abnormal IGF2 expression by the maternal allele; expression of the latter gene is normally inhibited by ligation to the zinc-finger CCCTC-binding factor known as CTCF. The centromeric (domain 2) differentially methylated region (KvDMR) is located in exon 10 of KCNQ1OT1, along with the promotor region of this gene that is expressed in a tissue-specific manner normally only from the paternal allele. The KCNQ1OT1 transcript apparently cis-regulates the expression of other genes in domain 2. Loss of methylation (LOM) in KCNQ10T1 results in abnormal expression of the maternal allele, observed in 50–60% of BWS cases (Smith ; Nativio ; Romanelli ). Previous studies on the methylation status of DMRH19 and KvDMR in WT patients were based on time-consuming protocols (von Kanel ) such as restriction fragment length polymorphism (RFLP) (Brown ), combined bisulfite restriction analysis (COBRA) (Satoh ; Brown ; Cerrato ), blotting analysis with a methylation-sensitive restriction enzyme assay (Schneid ; Moulton ; Taniguchi ; Squire ), real-time PCR coupled with a methylation-sensitive restriction assay (Bruce ; Gomes ) and reverse transcriptase-PCR coupled to a methylation-sensitive restriction enzyme (Okamoto ; Squire ). In this work, we used a novel, rapid method of pyrosequencing, a technique that enables high resolution quantitative analysis of DNA methylation, and methylation sensitive-multiplex ligation-dependent probe amplification (MS-MLPA), a technique that allows the identification of changes in methylation patterns, to compare the constitutional and somatic methylation patterns of DMRH19 and KvDMR in 40 WT patients.

Material and Methods

Subjects

Forty patients (24 males, 16 females) with documented WT, treated at the Instituto Nacional de Câncer (Rio de Janeiro, Brazil), were included in this study. Peripheral blood DNA samples from 31/40 patients and 34 fresh tumor DNA samples (from 29/40 patients) were used. All tumor samples were derived from primary tumors. For five patients more than one fresh tumor sample per patient (obtained at different times) was included: in two cases the first tumor sample was obtained from a biopsy while in three patients the samples were obtained from partial nephrectomies. All of the patients received with the same neoadjuvant chemotherapy treatment based on the International Society of Paediatric Oncology (SIOP) WT 2001 trial protocol (Bhatnagar, 2009). The patients were examined by a medical geneticist trained in dysmorphology. This study was approved by the Instituto Nacional de Câncer Ethics Committee (protocol number 87/08). All of the patients provided informed consent that was signed by parents or tutors.

Methods

DNA was extracted from peripheral blood and fresh tumor samples, essentially as described by Miller and Sambrook . Pyrosequencing reactions were done with 2 μg of DNA previously modified with bisulfite (EZ DNA Methylation kit, Zymo Research, CA, USA) according to the manufacturer’s instructions. Primers complementary to the bisulfite-modified CpG islands in DMRH19 and KvDMR domains were designed with PSQ Assay Design Software v. 1.0.6 (Pyrosequencing AB, Uppsala, Sweden). Fragments spanning both domains were amplified with the following primers: DMRH19-F: GGGGTTATTTGGGAATAGGATAT; DMRH19-R: TAACTTAAATCCCAAACCATAACA; KvDMR-F: TGTTTAGGTTAGGTTGTATTGTTG; KvDMR-R: CCCATCTCTCTAAAAAAATTT. Reverse primers were biotinylated. The PCR mixtures contained 30 ng of modified DNA, 7.5 pmol of forward and reverse primers (Roche Applied Science®, Spain), 7.5 mM dNTPs, 3 μL of PCR buffer (Roche Applied Science®) and 0.5 U of Taq DNA polymerase (Roche Applied Science®) in a final volume of 30 μL. The PCR conditions for the DMRH19 assay consisted of 95 ºC for 5 min, 45 cycles at 95 ºC for 30 s, 60 ºC for 30 s, 72 ºC for 30 s and 72 ºC for 10 min. The corresponding conditions for the KvDMR assay were 95 ºC for 5 min, 45 cycles at 95 ºC for 30 s, 54 ºC for 30 s, 72 ºC for 30 s and 72 ºC for 10 min. Single-stranded DNA templates and pyrosequencing were prepared and run according to the Biotage AB® protocol (Uppsala, Sweden) in a PSQHS96A system (Pyrosequencing AB®, Uppsala, Sweden). Pyrosequencing was done with sequencing primers for each PCR product: GAATAGGATATTTATGGGAG for DMRH19-SF and GGGTATATAGTTTATTTTAGTA for KvDMR-SF (Roche Applied Science®). The CpG peaks were analyzed and the final methylation index (MI) was calculated from the average of the percentage for each CpG peak in the pyrogram. The data were analyzed with Pyro Q-CpG software v. 1.0.9 (Pyrosequencing AB). Standard deviations (SD) were calculated based on the average MI and the distribution of MI values for the patients and healthy controls. The MS-MLPA 11p15 region kit SALSA ME030-B2 BWS/SRS (MRC-Holland, Amsterdam, Holland) contains 45 probes, 27 of which are specific for the BWS/SRS (Silver Russel Syndrome) region in 11p15. This kit was used with 300 ng of genomic DNA and the methylation-sensitive restriction enzyme HhaI (Promega Corporation, Spain) according to the manufacturer’s protocol. The MS-MLPA PCR products were analyzed in an ABI 3130 automated platform (Applied Biosystems®, Foster City, CA, USA). The raw data were analyzed with Excel-based in-house software (Meth-HULP v. 1.1) developed by INGEMM (Instituto de Genética Médica y Molecular, Hospital Universitario La Paz, Madrid, Spain) (Romanelli ). Normalization of the peak areas of undigested and digested samples from patients and controls (blood and kidney DNA samples) allowed visualization of the MI for each locus and sample. Methylation analysis was done by comparing restriction digested aliquots with paired undigested aliquots. Standard deviations were calculated based on the average MI and the distribution of MI values for the patients and healthy controls for each region (DMRH19 and KvDMR) analyzed.

Results

In this study, we investigated the constitutional and somatic 11p15 methylation patterns in 24 males and 16 females with WT. There were four cases of bilateral tumor. The age at diagnosis ranged from five months to 137 months, with an average age at diagnosis of 43 months for all 40 patients and 44 months for patients with unilateral tumor. Diffuse or focal anaplasia was observed in five tumors (Table 1) and four of them also presented DMRH19 hypermethylation (Table 2). Perilobar nephrogenic rests (PLNR) were observed in two patients and intralobar rests (ILNR) in one patient. One patient with PLNR (P38) had macrosomia since birth and mild indentations on the ear lobes, but no other findings compatible with the clinical features of BWS. Eight patients had phenotypic abnormalities: one had WAGR syndrome (P1), two had BWS (P2 and P35), two had macrosomia defined by stature and weight above the 97th centile for age and sex (P22 and P38), two had hemihypertrophy (P7 and P26), one of whom (P26) also presented with Moebius sequence (bilateral VII cranial nerve paralysis), and the eighth patient (P6) had an undiagnosed dysmorphic syndrome (Table 1).
Table 1

Clinical and histopathological data for 40 patients with Wilms tumor.

SubjectGenderLateralityAge dxHistopathologyPhenotype
P1FU25TriWAGR
P2MB13Tri (+) Bl.BWS
P4MU5Tri ILNR
P5FB9Tri (+) Bl.
P6MU30Triuds
P7FU45TriHH
P9FU47Tri
P10FU10Tri
P11MU136Bl
P12MU90Bl
P13FU62Ep
P14MU59Ep
P15FU62Tri
P16MU28DA
P17MB50Ep (FTS A)FA (FTS B)
P18MU36FA
P19FU48Tri (FTS A and B)
P20MU137Tri
P21FU5Bl (FTS A)Tri (FTS B)
P22FU29Tri (FTS B and C)macr
P23MU57FA
P24FU13Tri
P25MU42Tri
P26MU57TriHH Moe
P27MB61Ep PLNR (FTS B)Tri PLNR (FTS C)
P28MU67Tri
P29FU49Ep
P31FU34Tri
P32FU6Bl
P33MU54Bl
P34FU35Tri
P35MU46TriBWS
P36MU32Bl; DA
P37MU48Tri
P38FU19Bl/Ep PLNRmacr
P39MU48Tri
P40MU28Tri
P41MU26Bl
P42MU56St
P43MU13Tri
Total (P): 4043*

(A), (B) and (C) – tumor samples A, B and C, respectively. Age dx – age at diagnosis (months), B – bilateral, Bl – blastemal, Ep – epithelial, DA – diffuse anaplasia, F – female, FA – focal anaplasia, FTS – fresh tumor sample, HH – hemihypertrophy, ILNR – intralobar nephrogenic rests, M – male, macr –macrosomia, P – patient, PLNR – perilobar nephrogenic rests, Tri – triphasic, St – stromal, U – unilateral, uds – undiagnosed dysmorphic syndrome.

Average age at diagnosis.

Table 2

Pyrosequencing and MS-MLPA for 11p15.

SubjectDMRH19/KvDMR pyrosequencing and MS-MLPA

Peripheral blood DNA samples
Fresh tumor DNA samples
PyrosequencingMS-MLPAPyrosequencingMS-MLPA
P1NNNANA
P2HM DMRH19HM DMRH19NANA
P4NNNANA
P5NNNANA
P6NNNANA
P7NNNANA
P9NNNANA
P10NNNANA
P11NNHM DMRH19HM DMRH19
P12NNHM DMRH19HM DMRH19
P13NANUPDUPD
P14NNNN
P15NNNLOM DMRH19
P16NNHM DMRH19HM DMRH19
P17NNHM DMRH19 (A)HM DMRH19 (B)HM DMRH19 (A)HM DMRH19 (B)
P18NNHM DMRH19HM DMRH19
P19NNUPD (A)UPD (B)UPD (A)UPD (B)
P20NNNN
P21NANAUPD (FTS A) DMRH19 MI = 79%*UPD (A)
N (FTS B) DMRH19 MI = 42%*N (B)
P22NNHM DMRH19 (B)HM DMRH19 (C)HM DMRH19 (B)HM DMRH19 (C)
P23NANAHM DMRH19HM DMRH19
P24NANAUPDUPD
P25NNHM DMRH19HM DMRH19
P26NNNANA
P27NNHM DMRH19 (B)HM DMRH19 (C)HM DMRH19 (B)HM DMRH19 (C)
P28NNUPDUPD
P29NANAUPDUPD
P31NNUPDUPD
P32NANAUPDUPD
P33NNNANA
P34NNHM DMRH19HM DMRH19
P35HM DMRH19NAUPDUPD
P36NANANN
P37NANAHM DMRH19HM DMRH19
P38NNHM DMRH19HM DMRH19
P39NNNANA
P40NNUPDUPD
P41NNNN
P42NNUPDUPD
P43NANAHM DMRH19HM DMRH19
Total (P): 4031/4031/4034/4034/40

(A), (B) and (C), tumor samples A, B and C, respectively. FTS – fresh tumor sample, HM – hypermethylation, LOM – loss of methylation, N – normal, NA – not available, P – patient, UPD – uniparental disomy.

P21 MI: DMRH19 methylation index for tumor samples from patient 21.

Pyrosequencing of DMRH19 in 31 blood DNA samples detected hypermethylation in the two BWS patients (Table 2), with MI of 71% and 57%, respectively; these values were higher than in healthy blood controls (MI = 45.4 ± 6.2%) (Figure 1). Pyrosequencing of KvDMR in 31 blood samples yielded normal MI estimates (Table 2, Figure 2), with the corresponding MI for healthy blood (control) being 38.9 ± 3.1%.
Figure 1

Pyrogram showing DMRH19 hypermethylation in blood DNA samples from patients P2 (A) and P35 (B). The average methylation index (MI) for DMRH19 in patients P2 and P35 was 71% and 57%, respectively. Panel (C) shows DMRH19 methylation in blood from healthy controls (average MI = 41.7%). The average MI of all blood samples from healthy controls used in DMRH19 pyrosequencing was 45.4 ± 6.2%. The MI is indicated above peaks (gray columns) corresponding to the CpG islands in this region.

Figure 2

Pyrogram showing normal methylation of KvDMR. (A) P2 blood sample (average MI = 41%), (B) P35 blood sample (average MI = 34.2%) and (C) healthy control blood sample (average MI = 37.6%). The average MI of all blood samples from healthy controls used in KvDMR pyrosequencing was 38.9 ± 3.1%. The MI is indicated above peaks (gray columns) corresponding to the CpG islands in this region.

Pyrosequencing of DMRH19 in 34 fresh tumor samples detected hypermethylation in 28 samples (Table 2). In five patients with more than one tumor sample, analysis of the two samples obtained at different times yielded similar estimates of MI, except for one patient (p21) with an MI of 79% in sample A and 42% in sample B (Table 2, Figure 3). The corresponding MI for healthy renal tissue (control) was 42.6 ± 15.3%.
Figure 3

Pyrogram showing DMRH19 hypermethylation in renal tumor samples from patient P21. (A) Tumor sample A (average MI = 79%). (B) Tumor sample B (average MI = 42%). (C) Control sample from healthy kidney (average MI = 40%). The average of all healthy control renal samples used in DMRH19 pyrosequencing was 42.6 ± 15.3%. The MI is indicated above peaks (gray columns) corresponding to the CpG islands in this region.

KvDMR pyrosequencing in 34 fresh tumor DNA samples detected LOM in 12 samples (Table 2). The MI in healthy renal tissue (control) was 39.2 ± 10.8%. Pyrosequencing showed that these 12 tumor samples with KvDMR LOM also had DMRH19 hypermethylation that was characteristic of paternal uniparental disomy (UPD) (Table 2). MS-MLPA was done in 31 peripheral blood samples and in all 34 tumor samples (Table 2). DMRH19 hypermethylation was observed in only one peripheral blood sample (P2); the remaining blood samples were normal (Figure 4A,B). MS-MLPA analysis of tumor samples showed isolated DMRH19 hypermethylation in 16/34 cases and in 12/34 samples a characteristic pattern of paternal UPD was observed (Table 2, Figure 4C). Isolated DMRH19 LOM was detected in one tumor sample (P15) while a normal methylation pattern was observed in the remaining 5/34 samples (Table 2).
Figure 4

MS-MLPA methylation indices. (A) Peripheral blood DNA from patient P2 showing isolated hypermethylation of DMRH19 (average MI = 84 ± 6%) and normal methylation of KvDMR (average MI = 64 ± 8%). (B) Peripheral blood DNA from patient P42 showing normal methylation of DMRH19 (average MI = 47 ± 6%) and KvDMR (average MI = 51 ± 8%). (C) Fresh tumor DNA (sample A) from patient P19 showing paternal uniparental disomy (average MI for DMRH19 and KvDMR was 70 ± 27% and 22 ± 19%, respectively). Dark gray columns: expected ratios; light gray columns: observed ratios. Each pair of columns corresponds to one of the DMRH19 and KvDMR probes included in the MS-MLPA kit (five probes for DMRH19 and four for KvDMR).

Discussion

In this study, we used pyrosequencing and MS-MLPA to analyze the constitutional and somatic methylation patterns in the DMRH19 and KvDMR regions of 40 WT patients. Data from tumor histopathology and physical examination were compared with the methylation status in 11p15. The comparison of peripheral blood and fresh tumor samples confirmed that the epigenetic changes associated with WT were mostly somatic. Phenotypic abnormalities characteristic of a syndromic form of WT were observed in 20% of patients (8/40). The average age at diagnosis in our cohort was 43 months, which was similar to the 38 months reported by Scott . Four patients had bilateral WT and tumor samples were available from two of them (P17 and P27). Two tumor samples from each of these patients were studied, one from each kidney (left and right). Sample A from patient P17 had a predominantly epithelial histology while sample B, which was collected from a subsequent nephrectomy on the contralateral kidney, showed focal anaplasia that probably reflected evolution of the WT. Both samples had DMRH19 hypermethylation and the DNA methylation indices were similar in the two samples from each of these patients. Constitutional DMRH19 hypermethylation was observed in only two patients (P2 and P35), both with the BWS phenotype. These patients fit into a small group (5–7%) of BWS patients with isolated DMRH19 hypermethylation reported by Bliek . Interestingly, these authors found that two of the four BWS patients who showed isolated DMRH19 hypermethylation also developed WT (Bliek ). The normal constitutional methylation profiles shown by KvDMR pyrosequencing in the present study confirmed that most epigenetic alterations associated with WT involve DMRH19 but not KvDMR, as also reported by Priolo . Eight of our patients also had major phenotypic abnormalities, including two patients with BWS (P2 and P35), two patients with hemihypertrophy (P7 and P26), two with isolated macrosomia (P22 and P38), one patient with WAGR complex (P1) and one patient with an undiagnosed dysmorphic syndrome (P6). Except for Moebius syndrome, the occurrence of which in patient P26 may have been fortuitous, all of the other pathogenic conditions have been re-currently described in association with WT, indicating the heterogeneous etiology of this neoplasia (Dome and Huff, 2011). As already described in a proportion of these patients, constitutive DMRH19 hypermethylation was observed in both BWS patients and somatic UPD was present in patient P35. Perilobar nephrogenic rests were observed in one of the patients with macrosomia (P38), as described above, and her tumor sample showed DMRH19 hypermethylation. DMRH19 pyrosequencing showed isolated hypermethylation in 47% (16/34) of tumor samples, which was lower than the 71% previously reported with the COBRA assay in 28 WT samples (Brown ). However, another study based on COBRA analysis (Cerrato ) detected isolated somatic DMRH19 hypermethylation in 10/40 WT patients (25%). Contrary to our study, in which 12 patients showed somatic LOM of KvDMR, Brown observed no differences in the extent of KvDMR methylation between normal and tumor samples. Scott reported that the proportion of isolated DMRH19 hypermethylation observed with MS-MLPA was 31%, a value similar to our results. One of our patients (P21) showed a difference in the extent of methylation between tumor samples A (79%) and B (42%). This discrepancy may reflect the fact that sample B was collected after successful chemotherapy with 90% tumor regression. DNA methylation levels are known to be influenced by various chemotherapeutic regimens. Among our patients, with exception of two biopsy samples, the remaining tumor samples were obtained from patients who had been submitted to the same chemotherapeutic SIOP protocol (Bhatnagar, 2009). Variations in the rate of tumor regression in response to chemotherapy may have an impact on DNA methylation levels, as observed in patient P21. Isolated DMRH19 hypermethylation and paternal UPD result in IGF2 biallelic expression and, subsequently, tumor development (Beckwith, 1998). The pyrosequencing of KvDMR in tumor samples revealed LOM in 12/34 samples, concomitant with DMRH19 hypermethylation, indicating paternal UPD in 11 out of 29 patients (38%). This proportion was similar to a previous UPD estimate (45%) in 40 WT patients (Cerrato ). We used MS-MLPA as a complementary procedure to analyze DMRH19 and KvDMR methylation. This assay yielded findings consistent with those obtained by pyrosequencing, except for one tumor sample (P15) that showed DMRH19 LOM, probably because of a technical artefact. In addition, MS-MLPA confirmed the somatic, paternal UPD in 12 tumor samples. Few studies have compared constitutional and somatic 11p15 epigenetic alterations in WT patients. One of these used MS-MLPA to analyze blood DNA samples from 437 children with non-syndromic WT and identified constitutional defects in 13 patients (3%), including six patients with DMRH19 hypermethylation and six with paternal UPD (Scott ). Constitutional 11p15 defects were observed in 5% (2/40) of our patients. The concomitant finding of macrosomia and somatic isolated DMRH19 hypermethylation in two patients (P22 and P38; Tables 1 and 2) indicated that these patients may represent somatic mosaics for this epigenetic disturbance. Additionally, patient P38 also had PLNR, a condition previously reported to be associated with this phenotype (Dome and Huff, 2011). To the best of our knowledge, this is the first study to compare constitutional and somatic DMRH19 and KvDMR epigenetic alterations in WT patients by pyrosequencing and MS-MLPA. Our findings highlight the benefits of the combined analysis of the DMRH19 and KvDMR regions. The MS-MLPA and pyrosequencing findings were highly consistent. MS-MLPA is a rapid, reliable technique that is less expensive than pyrosequencing and is adequate for accurate quantitative estimation of DNA methylation in a clinical setting.
  25 in total

Review 1.  Current management of wilms' tumor.

Authors:  Leah Nakamura; Michael Ritchey
Journal:  Curr Urol Rep       Date:  2010-02       Impact factor: 3.092

2.  Quantitative 1-step DNA methylation analysis with native genomic DNA as template.

Authors:  Thomas von Kanel; Dominik Gerber; André Schaller; Alessandra Baumer; Eva Wey; Christopher B Jackson; Franziska M Gisler; Karl Heinimann; Sabina Gallati
Journal:  Clin Chem       Date:  2010-05-14       Impact factor: 8.327

3.  Beckwith-Wiedemann syndrome and uniparental disomy 11p: fine mapping of the recombination breakpoints and evaluation of several techniques.

Authors:  Valeria Romanelli; Heloisa N M Meneses; Luis Fernández; Victor Martínez-Glez; Ricardo Gracia-Bouthelier; Mario F Fraga; Encarna Guillén; Julián Nevado; Esther Gean; Loreto Martorell; Victoria Esteban Marfil; Sixto García-Miñaur; Pablo Lapunzina
Journal:  Eur J Hum Genet       Date:  2011-01-19       Impact factor: 4.246

4.  Management of Wilms' tumor: NWTS vs SIOP.

Authors:  Sushmita Bhatnagar
Journal:  J Indian Assoc Pediatr Surg       Date:  2009-01

5.  Abnormal methylation at the KvDMR1 imprinting control region in clinically normal children conceived by assisted reproductive technologies.

Authors:  M V Gomes; J Huber; R A Ferriani; A M Amaral Neto; E S Ramos
Journal:  Mol Hum Reprod       Date:  2009-06-03       Impact factor: 4.025

6.  Frequency and timing of loss of imprinting at 11p13 and 11p15 in Wilms' tumor development.

Authors:  Keith W Brown; Frances Power; Beth Moore; Adrian K Charles; Karim T A Malik
Journal:  Mol Cancer Res       Date:  2008-07       Impact factor: 5.852

7.  Different mechanisms cause imprinting defects at the IGF2/H19 locus in Beckwith-Wiedemann syndrome and Wilms' tumour.

Authors:  Flavia Cerrato; Angela Sparago; Gaetano Verde; Agostina De Crescenzo; Valentina Citro; Maria Vittoria Cubellis; Maria Michela Rinaldi; Luigi Boccuto; Giovanni Neri; Cinzia Magnani; Paolo D'Angelo; Paola Collini; Daniela Perotti; Gianfranco Sebastio; Eamonn R Maher; Andrea Riccio
Journal:  Hum Mol Genet       Date:  2008-02-01       Impact factor: 6.150

8.  Stratification of Wilms tumor by genetic and epigenetic analysis.

Authors:  Richard H Scott; Anne Murray; Linda Baskcomb; Clare Turnbull; Chey Loveday; Reem Al-Saadi; Richard Williams; Fin Breatnach; Mary Gerrard; Juliet Hale; Janice Kohler; Pablo Lapunzina; Gill A Levitt; Sue Picton; Barry Pizer; Milind D Ronghe; Heidi Traunecker; Denise Williams; Anna Kelsey; Gordan M Vujanic; Neil J Sebire; Paul Grundy; Charles A Stiller; Kathy Pritchard-Jones; Jenny Douglas; Nazneen Rahman
Journal:  Oncotarget       Date:  2012-03

9.  Disruption of genomic neighbourhood at the imprinted IGF2-H19 locus in Beckwith-Wiedemann syndrome and Silver-Russell syndrome.

Authors:  Raffaella Nativio; Angela Sparago; Yoko Ito; Rosanna Weksberg; Andrea Riccio; Adele Murrell
Journal:  Hum Mol Genet       Date:  2011-01-31       Impact factor: 6.150

10.  Socioeconomic status and the incidence of non-central nervous system childhood embryonic tumours in Brazil.

Authors:  Beatriz de Camargo; Juliana Moreira de Oliveira Ferreira; Rejane de Souza Reis; Sima Ferman; Marceli de Oliveira Santos; Maria S Pombo-de-Oliveira
Journal:  BMC Cancer       Date:  2011-05-05       Impact factor: 4.430

View more
  5 in total

1.  Promoter hypermethylation using 24-gene array in early head and neck cancer: better outcome in oral than in oropharyngeal cancer.

Authors:  Rob Noorlag; Pauline M W van Kempen; Cathy B Moelans; Rick de Jong; Laura E R Blok; Ronald Koole; Wilko Grolman; Paul J van Diest; Robert J J van Es; Stefan M Willems
Journal:  Epigenetics       Date:  2014-07-08       Impact factor: 4.528

2.  Analysis of the Transcriptome: Regulation of Cancer Stemness in Breast Ductal Carcinoma In Situ by Vitamin D Compounds.

Authors:  Naing Lin Shan; Audrey Minden; Philip Furmanski; Min Ji Bak; Li Cai; Roman Wernyj; Davit Sargsyan; David Cheng; Renyi Wu; Hsiao-Chen D Kuo; Shanyi N Li; Mingzhu Fang; Hubert Maehr; Ah-Ng Kong; Nanjoo Suh
Journal:  Cancer Prev Res (Phila)       Date:  2020-05-28

3.  The effectiveness of Wilms tumor screening in Beckwith-Wiedemann spectrum.

Authors:  Alessandro Mussa; Kelly A Duffy; Diana Carli; Jessica R Griff; Riccardo Fagiano; Jonida Kupa; Garrett M Brodeur; Giovanni Battista Ferrero; Jennifer M Kalish
Journal:  J Cancer Res Clin Oncol       Date:  2019-10-04       Impact factor: 4.553

4.  Promoter hypermethylation profiling of distant breast cancer metastases.

Authors:  Willemijne A M E Schrijver; Laura S Jiwa; Paul J van Diest; Cathy B Moelans
Journal:  Breast Cancer Res Treat       Date:  2015-04-05       Impact factor: 4.872

5.  Performance of Different Analytical Software Packages in Quantification of DNA Methylation by Pyrosequencing.

Authors:  Chiara Grasso; Morena Trevisan; Valentina Fiano; Valentina Tarallo; Laura De Marco; Carlotta Sacerdote; Lorenzo Richiardi; Franco Merletti; Anna Gillio-Tos
Journal:  PLoS One       Date:  2016-03-02       Impact factor: 3.240

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.