Literature DB >> 23240007

A novel target of IscS in Escherichia coli: participating in DNA phosphorothioation.

Xianhui An1, Wei Xiong, Yan Yang, Fuhou Li, Xiufen Zhou, Zhijun Wang, Zixin Deng, Jingdan Liang.   

Abstract

Many bacterial species modify their DNA with the addition of sulfur to phosphate groups, a modification known as DNA phosphorothioation. DndA is known to act as a cysteine desulfurase, catalyzing a key biochemical step in phosphorothioation. However, bioinformatic analysis revealed that 19 out of the 31 known dnd gene clusters, contain only four genes (dndB-E), lacking a key cysteine desulfurase corresponding gene. There are multiple cysteine desulfurase genes in Escherichia coli, but which one of them participates into DNA phosphorothioation is unknown. Here, by employing heterologous expression of the Salmonella enterica dnd gene cluster named dptBCDE in three E. coli mutants, each of which lacked a different cysteine desulfurase gene, we show that IscS is the only cysteine desulfurase that collaborates with dptB-E, resulting in DNA phosphorothioation. Using a bacterial two-hybrid system, protein interactions between IscS and DptC, and IscS and DptE were identified. Our findings revealed IscS as a key participant in DNA phosphorothioation and lay the basis for in-depth analysis of the DNA phosphorothioation biochemical pathway.

Entities:  

Mesh:

Substances:

Year:  2012        PMID: 23240007      PMCID: PMC3519819          DOI: 10.1371/journal.pone.0051265

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Sequence and stereo specific physiological DNA phosphorothioation occurs in many bacteria [1]–[4]. In Streptomyces lividans 1326, a five-gene cluster, dndA–E, determines the modification [1]. Orthologs of these genes were found in 30 bacterial species and one Archaea [2]. The dnd genes are usually located on genomic islands that were probably acquired by horizontal gene transfer [3]. Several of these gene clusters contain dndB-E homologues, but lack a dndA homologue [2], [3]. In-frame deletion of dndA in S. lividans showed that the gene is essential for DNA phosphorothioation [1], [4]. DndA was then shown to be a cysteine desulfurase involved in the iron-sulfur cluster assembly for apo-Fe DndC [5]. Salmonella. enterica serovar cerro 87 contains dndB-E orthologs that are called dptB-E [6]. There is, however, no dndA ortholog in the entire 20 kb genomic island that contains the dpt genes (Fig. 1A) [2]. Heterologous expression of dptB-E in E. coli DH10B [7] resulted in DNA phosphorothioation [8]. Since DndA is essential for DNA phosphorothioation in S. lividans, we hypothesized that there should be one or more genes in the E. coli genome that could provide the cysteine desulfurase activity known to be necessary for the modification. Searching for a putative dndA orthologue in E. coli BW25113 was easier than in S. enterica because of the availability of a comprehensive library of knockout mutants of all nonessential genes [9]. In E.coli, there are at least three different cysteine desulfurases: IscS, SufS and CsdA [10], . Here we show that only one of them, IscS, supports DNA phosphorothioation in E. coli expressing the S. enterica dptB-E gene cluster. Protein interactions, which are likely necessary for DNA phosphorothioation, were detected between IscS and both DptC and DptE.
Figure 1

Heterologous expression of the S. enterica serovar cerro 87 dptBCDE genes in E. coli BW25113.

A. Orthologous DNA phosphorothioation gene clusters from S. lividans (dndABCDE) and S. enterica (dptBCDE). The cysteine desulfurase gene dndA of S. lividans is required for DNA phosphorothioation. The S. enterica dptBCDE gene cluster lacks a dndA ortholog. The dndA function may be performed by an unknown, unlinked gene in S. enterica and also in E. coli expressing dptBCDE. B. The three cysteine desulfurases in the E. coli genome. C. E. coli BW25113 DNA becomes phosphorothioated when expressing dptBCDE of S. enterica. Ethidium bromide-stained agarose gels containing total genomic DNA, separated in Tris-acetate EDTA (TAE) buffer. TAE (top panel), untreated samples; PAA (bottom panel), identical DNA samples after incubation in TAE containing 1% per-acetic acid (PAA). Lane 1, E. coli BW25113 (wild-type, not S-modified); lane 2, S. enterica serovar 87 (wild-type, containing phosphorothioate DNA); lane 3, E. coli BW25113 expressing the S. enterica serovar cerro 87 dptBCDE gene cluster. The fluorescent smear in lanes 2 and 3 of the lower gel indicates that the DNA was phosphorothioate modified.

Heterologous expression of the S. enterica serovar cerro 87 dptBCDE genes in E. coli BW25113.

A. Orthologous DNA phosphorothioation gene clusters from S. lividans (dndABCDE) and S. enterica (dptBCDE). The cysteine desulfurase gene dndA of S. lividans is required for DNA phosphorothioation. The S. enterica dptBCDE gene cluster lacks a dndA ortholog. The dndA function may be performed by an unknown, unlinked gene in S. enterica and also in E. coli expressing dptBCDE. B. The three cysteine desulfurases in the E. coli genome. C. E. coli BW25113 DNA becomes phosphorothioated when expressing dptBCDE of S. enterica. Ethidium bromide-stained agarose gels containing total genomic DNA, separated in Tris-acetate EDTA (TAE) buffer. TAE (top panel), untreated samples; PAA (bottom panel), identical DNA samples after incubation in TAE containing 1% per-acetic acid (PAA). Lane 1, E. coli BW25113 (wild-type, not S-modified); lane 2, S. enterica serovar 87 (wild-type, containing phosphorothioate DNA); lane 3, E. coli BW25113 expressing the S. enterica serovar cerro 87 dptBCDE gene cluster. The fluorescent smear in lanes 2 and 3 of the lower gel indicates that the DNA was phosphorothioate modified.

Materials and Methods

Bacterial strains, plasmids and primers

Bacterial strains, plasmids, and primers are listed in Table 1, 2 and 3.
Table 1

Strains that are used in this study.

STRAINSCHARACTERISTICSREFERENCE
Salmonella enterica Cerro 87Strain containing naturally S-modified DNA, source of the dptB-E gene cluster [6]
E. coli DH10BNon-restricting host strain for gene cloning [7]
E. coli BW25113 acI q rrnB T14 ΔlacZ WJ16 hsdR514 ΔaraBAD AH33 ΔrhaBADLD78, strain used for creating gene knockouts [12]
BL21(DE3)pLysSLacks lon and ompT proteases Cmlr Novagen
JW2514-4 E.coli F-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), &lambda, ΔiscS776::kan, rph-1, Δ(rhaD-rhaB)568, hsdR514 Yale Coli Genetic Stock Center [9]
JW1670-1 E.coli F-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), &lambda, ΔsufS755::kan, rph-1, Δ(rhaD-rhaB)568, hsdR514 Yale Coli Genetic Stock Center [9]
JW2781-1 E.coli F-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), &lambda, ΔcsdA738::kan, rph-1, Δ(rhaD-rhaB)568, hsdR514 Yale Coli Genetic Stock Center [9]
JW2513-1 E.coli F-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), &lambda, ΔiscU775::kan, rph-1, Δ(rhaD-rhaB)568, hsdR514 Yale Coli Genetic Stock Center [9]
JW3955-2 E.coli F-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), &lambda, rph-1, Δ(rhaD-rhaB)568, ΔthiS762::kan, hsdR514 Yale Coli Genetic Stock Center [9]
JW3956-1 E.coli F-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), &lambda, rph-1, Δ(rhaD-rhaB)568, ΔthiF763::kan, hsdR514 Yale Coli Genetic Stock Center [9]
JW2512-1 E.coli F-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), &lambda, ΔiscA774::kan, rph-1, Δ(rhaD-rhaB)568, hsdR514 Yale Coli Genetic Stock Center [9]
JW2508-1 E.coli F-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), &lambda, ΔiscX770::kan, rph-1, Δ(rhaD-rhaB)568, hsdR514 Yale Coli Genetic Stock Center [9]
JW0810-2 E.coli F-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), &lambda, ΔmoeB726::kan, rph-1, Δ(rhaD-rhaB)568, hsdR514 Yale Coli Genetic Stock Center [9]
JW3779-3 E.coli F-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), &lambda, rph-1, ΔcyaY752::kan, Δ(rhaD-rhaB)568, hsdR514 Yale Coli Genetic Stock Center [9]
JW3435-1 E.coli F-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), &lambda, ΔyhhP(tusA)725::kan, rph-1, Δ(rhaD-rhaB)568, hsdR514 Yale Coli Genetic Stock Center [9]
JW0413-1 E.coli F-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), ΔthiI780::kan, λ-, rph-1, Δ(rhaD-rhaB)568, hsdR514 Yale Coli Genetic Stock Center [9]
AXH034 E.coli F-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), &lambda, ΔiscS1191::kan, rph-1, Δ(rhaD-rhaB)568, hsdR514 This study
E. coli XL1-Blue MRHost strain for propagating pBT and pTRG recombinants Δ(mcrA)183 Δ(mcrCB-hsdSMR-mrr)173 endA1 supE44 thi-1 recA1 gyrA96; relA1 lac BacterioMatch II Kit (Agilent)
E. coli XL1-Blue MRF′ KanDerivative of XL1-Blue MR. Reporter strain for two-hybird test using pBT and pTRG derivatives Δ(mcrA)183 Δ(mcrCB-hsdSMR-mrr)173 endA1 supE44 thi-1 recA1 gyrA96 relA1 lac [F′ proAB lacI q ZΔM15 Tn5 (Kan r)]BacterioMatch II Kit (Agilent)
Table 2

Plasmids that are used in this study.

PLASMIDSCHARACTERISTICSREFERENCE
pKD46 amp repts (30° for replication, 42° for curing) [7]
pJTU3510 dptB-E from S. enterica Cerro 87, p15A origin of replication, Cmlr This study
pJTU3523 dptC from S. enterica Cerro 87, cloned in pSJ7 expression vectorThis study
pJTU3525 dptE from S. enterica Cerro 87, cloned in pSJ7 expression vectorThis study
pBTBait plasmid, λcI Cmlr, cloning between NotI and XhoIbacterioMatch II Two-Hybrid System Vector Kit (Agilent)
pTRGTarget plasmid, Tetr, cloning between BamHI and XhoIbacterioMatch II Two-Hybrid System Vector Kit (Agilent)
pBT-LGF2Control plasmid λcI LGF2 Cmlr bacterioMatch II Two-Hybrid System Vector Kit (Agilent)
pTRG-GAL11PControl plasmid RNAP-α GAL11Pr bacterioMatch II Two-Hybrid System Vector Kit (Agilent)
pJTU3609 dptB cloned in pTRG with site BamHI and XhoIThis study
pJTU3610 dptC cloned in pTRG with site BamHI and XhoIThis study
pJTU3611 dptDcloned in pTRG with site BamHI and XhoIThis study
pJTU3612 dptE cloned in pTRG with site BamHI and XhoIThis study
pJTU3618 iscS cloned in pBT with site NotI and XhoIThis study
pET15bExpression vector with His6-tag Ampr Novagen
pJTU3619Expressing E. coli iscS (amplified using primers iscS exU/exD) in pET15b NdeI and BamHIThis study
pJTU3625pJTU3619 derivative site mutant with C111AThis study
pJTU3626pJTU3619 derivative site mutant with C170AThis study
pJTU3627pJTU3619 derivative site mutant with C328AThis study
pJTU3622 dptC with TEV site insert into pGEX-6P-1 between SmaI and XhoIThis study
pJTU3624 dptE with TEV site insert into pGEX-6P-1 between SmaI and XhoIThis study
Table 3

Primers that are used in this study.

PRIMERSSEQUENCEUSE
P1 ATTCCGGGGATCCGTCGACC Amplification of neo FRT
P2 TGTAGGCTGGAGCTGCTTC Amplification of neo FRT
H1P1 GGTAGCCTGATTCCTTGCATTGAGTGATGTACGGAGTTTATAGAGCAATGATTCCGGGGATCCGTCGACC Replacement of iscS
H2P2 ATTATAAATTCTCCTGATTCCGATACCGATTAATGATGAGCCCATTCGATTGTAGGCTGGAGCTGCTTC Replacement of iscS
U AAGTGCTGGATGTGTCTG Verification of iscS deletion
D GACGTTCTCGTCGTTGTT Verification of iscS deletion
iscS exU GGGAATTCCATATGAAATTACCGATTTATC To clone iscS with NdeI site
iscS exD CCGGGATCCAGCCATTATAAATTCTCC To clone iscS with BamHI site
GST-dptC F TGATTACGATATCCCAACGAC To clone dptC
GST-dptC R CCGCTCGAGTGTAATACCAGTTG To clone dptC with XhoI site
GST-dptE F TGATTACGATATCCCAACGAC To clone dptE
GST-dptE R CCGCTCGAGGTTGATGCTGCCGT To clone dptC with XhoI site
C111A F GCGGTACTGGATACCGCACGTCAGCTGGAGCGC Mutated site in IscS
C111A R GCGCTCCAGCTGACGTGCGGTATCCAGTACCGC Mutated site in IscS
C170A F GCTATCGGCGAAATGGCACGTGCTCGTGGCATT Mutated site in IscS
C170A R AATGCCACGAGCACGTGCCATTTCGCCGATAGC Mutated site in IscS
C328A F TCTTCAGGTTCCGCCGCAACGTCAGCAAGCCTC Mutated site in IscS
C328A R GAGGCTTGCTGACGTTGCGGCGGAACCTGAAGA Mutated site in IscS
IscS-CMu F ATCTGACAACCTGGCGATCA To verify IscS mutantions
IscS-CMu R CTTCAGTAGTAAAACGACCT To verify IscS mutantions
dptBTRG U CCGGGATCCATGGCTAGTGTTGATGCAG To clone dptB to pTRG with BamHI
dptBTRG D CCGCTCGAGAAATCGTAGGCCTGAACT To clone dptB to pTRG with XhoI
dptCTRG U CCGGGATCCATGAGTAAATTAGTTCAGG To clone dptC to pTRG with BamHI
dptCTRG D CCGCTCGAGTTATGTAATACCAGTTGC To clone dptC to pTRG with XhoI
dptDTRG U CCGGGATCCATGCGGGCGAATCGTCTG To clone dptD to pTRG with BamHI
dptDTRG D CCGCTCGAGCCATTCGATTCGGGAGCA To clone dptD to pTRG with XhoI
dptETRG U CCGGGATCCATGCTCCCGAATCGAATG To clone dptEto pTRG with BamHI
dptETRG D CCGCTCGAGTTGATGCTGCCGTAAAAG To clone dptE to pTRG with XhoI
iscS BT U ATAAGAATGCGGCCGCAATGAAATTACCGATTTAT To clone iscS to pBT with NotI
iscS BT D CCGCTCGAGCCATTATAAATTCTCC To clone iscS to pBT with XhoI
The E. coli BW25113 gene replacement mutants listed in Table 1 were obtained from Yale Coli Genetic Stock Center [9]. Among these, the iscS mutant JW2514 was not viable, and was recreated by using the gene knockout method described by Datsenko [12]. For this, the neo-FRT (FLP, recombinase recognition target) cassette was amplified using primer P1 and P2, then H1P1 and H2P2. Successful iscS deletion was confirmed by PCR using the flanking primers U and D ( ).
Figure 2

E.coli iscS is required for DNA phosphorothioation.

Ethidium bromide-stained agarose gels containing E. coli total genomic DNA, separated in Tris-acetate EDTA (TAE) buffer. Top gel (TAE), untreated samples; bottom gel (PAA), identical DNA samples after incubation in TAE containing 1% per-acetic acid (PAA). A fluorescent smear in the lower gel indicates that the DNA was S-modified. Lanes 1–8, Dnd (DNA degradation) phenotypes of E. coli cysteine desulfurase deletion mutants (ΔiscS, ΔsufS, ΔcsdA) containing the S. enterica dptBCDE gene cluster cloned on pJTU3510 (lane 1–8); lanes 9–12, trans complementation of the chromosomal ΔiscS mutation by pJTU3619 containing mutant derivatives of iscS (lanes 9–12). E. coli hosts: wt, wild type. The mutations ΔiscS, ΔsufS and ΔcsdA are in the E. coli chromosome. pJTU3510: −, no plasmid; +, pJTU3510 expressing dptBCDE. pJTU3619 (compatible with pJTU3510) containing the following genes: S+, wild-type E. coli iscS; 111, 170, 328, mutant iscS genes containing the aa changes Cys111Ala, Cys170Ala or Cys328Ala, respectively. −, no plasmid. TAE, gel running buffer; PAA, TAE containing per-acetic acid.

E.coli iscS is required for DNA phosphorothioation.

Ethidium bromide-stained agarose gels containing E. coli total genomic DNA, separated in Tris-acetate EDTA (TAE) buffer. Top gel (TAE), untreated samples; bottom gel (PAA), identical DNA samples after incubation in TAE containing 1% per-acetic acid (PAA). A fluorescent smear in the lower gel indicates that the DNA was S-modified. Lanes 1–8, Dnd (DNA degradation) phenotypes of E. coli cysteine desulfurase deletion mutants (ΔiscS, ΔsufS, ΔcsdA) containing the S. enterica dptBCDE gene cluster cloned on pJTU3510 (lane 1–8); lanes 9–12, trans complementation of the chromosomal ΔiscS mutation by pJTU3619 containing mutant derivatives of iscS (lanes 9–12). E. coli hosts: wt, wild type. The mutations ΔiscS, ΔsufS and ΔcsdA are in the E. coli chromosome. pJTU3510: −, no plasmid; +, pJTU3510 expressing dptBCDE. pJTU3619 (compatible with pJTU3510) containing the following genes: S+, wild-type E. coli iscS; 111, 170, 328, mutant iscS genes containing the aa changes Cys111Ala, Cys170Ala or Cys328Ala, respectively. −, no plasmid. TAE, gel running buffer; PAA, TAE containing per-acetic acid.

Detection of DNA phoshorothioation

Phosphorothioate DNA is sensitive to double-strand cleavage by Tris-peracetic acid (TPA) [13]. The phosphorothioation was detected by incubating DNA samples for 30 min at 25°C in TAE buffer (40 mM Tris, 20 mM sodium acetate, 0.8 mM EDTA pH 7.5) supplemented with 1.0% peracetic acid. Phosphorothioate DNA, but not normal DNA, shows Dnd phenotype, producing a smear of DNA fragments in an agarose gel. To prevent DNA degradation during electrophoresis, 50 mM thiourea was added to the TAE electrophoresis buffer [13], [14].

Bacterial two-hybrid analysis

Protein-protein interactions were investigated using the BacterioMatch II two-hybrid system (Stratagene), according to the manual [15] with some modifications. The system features a HIS3-aadA reporter cassette, whose expression allows E. coli growth in the presence of 3-AT (3-amino-1,2,4-triazole), which is a competitive inhibitor of His3 (imidazoleglycerol-phosphate dehydratase), and in the presence of streptomycin. To test protein-protein interactions, in-frame gene fusions were created in the pBT (bait) or pTRG (target) vectors. PCR primers with suitable restriction sites were constructed and are listed in Table 1. IscS was fused with a bait protein, generating pBT-IscS; DndB-E were fused with target protein, generating pTRG-DptB, pTRG-DptC, pTRG-DptD and pTRG-DptE respectively. The resulting bait and target clones were co-transformed into the reporter strain E. coli XL1-Blue MRF′ Kan (Stratagene/Agilent) and selected on LB agar containing 25 µg/ml chloramphenicol (to select for pBT derivatives), 12.5 µg/ml tetracycline (to select for pTRG derivatives), and 50 µg/ml kanamycin (to maintain F′proAB lacI q ZΔM15 Tn5). To test for resistance to 3-AT, single colonies were inoculated into 1 mL LB containing the three above antibiotics, and kept shaking overnight at 30°C. 500 µl of this overnight culture was then inoculated into 5 mL SOC medium and incubated for 90 min at 37°C. The cells were then spun down at 3500 rpm for 5 min at room temperature, and the supernatant was carefully removed. The cells were then re-suspended in 2 ml M9+ His-drop out broth, collected by centrifugation as described above, and re-suspended in 3 mL M9+ His-drop out broth [15]. After incubation for 2 hours at 37°C, three parallel ten-fold dilutions 10−1–10−7 were prepared and plated 100, 10−1, 10−2 and 10−3 on Selective Screening Medium (SSM) containing 5 mM 3-AT and 10−4, 10−5, 10−6 and 10−7 on Nonselective Screening Medium (NSM) without 3-AT. Colonies were counted after 24 h incubation at 37°C. If there were no visible colonies, the plates were incubated in dark at 25°C for another 16 hours. Putative positive interactions were verified using Dual Selective Screening Medium containing 5 mM 3-AT + 12.5 µg mL−1 streptomycin.

Strep and GST Pull-down

Ten milliliters of E. coli BL21 (DE3) strain (harboring Strep-iscS, or GST-DptC, or GST-DptE) was inoculated to 1 L and grow at 37°C for 3 hours with shaking (220 rpm). IPTG was then added to a final concentration of 0.2 mM (from 1000 folds stock). The culture was then moved to 16°C and grew for another 24 hours. The cells were collected by centrifuge for 10 minutes at 4°C. Cell pellet was re-suspended using Buffer S (25 mM Hepes pH7.6, 100 mM KCl, 10% glycerol, 1 to 10 folds (w/w)) and sonicated for 30 minutes. Cell debris was removed by centrifugation at 15000 g for 20 minutes. Equal volume of the extract was mixed (IscS-GSTDptC or IscS-GSTDptE). Two milliliter of the mixture was incubated with 0.1 ml Streptactin resin (Qiagen) or GST resin (Qiagen) pre-equilibrated using Buffer S. After 1 hour, the resin was spin down (400 g, 3 minutes). Supernatant was removed. The resin was wash 5 times using 2 ml Buffer S. The protein was eluted using 0.3 ml Buffer S supplemented with 2.5 mM Desthiobiotin or 20 mM Glutathione. Western blot was done using antibodies from Abcam (ab58626 for GST, or ab76949 for StreptagII).

Results

Expression of S. enterica dptB-E in E. coli BW25113 results in DNA phosphorothioation

Owing to the observation that in Streptomyces lividans, dndA is essential for DNA phosphorothioation, we sought to find the cysteine desulfurase gene in E. coli. The E.coli genome was searched for orthologs of a cysteine desulfurase gene. Fig. 1B shows that there are at least three cysteine desulfurase genes in the E. coli genome [10], [11]. Fig. 1C shows that introducing pJTU3510 carrying dptB-E four genes, a low-copy plasmid, into E. coli BW25113 resulted in DNA S-modification (lane 3). We speculated that dptB-E, in cooperation with one or more E. coli desulfurase gene, leads to DNA phosphorothioation.

IscS is responsible for the DNA phosphorothioation in E.coli

For DNA phosphorothioation in E.coli BW25113, it seemed likely that a protein similar to the cysteine desulfurase DndA was needed in addition to the S. enterica dptB-E gene cluster. Individual E.coli BW25113 knockout mutants, ΔiscS, ΔsufS and ΔcsdA were available from the Yale Coli Genetic Stock Center. The iscS mutant did not survive the transport and was reconstructed (Fig. S1). E. coli BW25113 and the three cysteine desulfurase mutants were transformed with pJTU3510 expressing dptB-E, and tested for the phosphorothioation status by Dnd phenotypic assay (DNA smear, an indicator of DNA phosphorothioate modification) (Fig. 2). Only the iscS mutant failed to modify its DNA (lane 4), suggesting that only E. coli IscS, but not SufS or CsdA, was responsible for DNA phosphorothioation in E. coli. To confirm that iscS is responsible for DNA phosphorothioation, iscS was cloned into pET15b, and co-transformed with a dpt gene cluster harboring low copy number plasmid pJTU3510 into the E. coli iscS deletion mutant. Fig. 2 lane 9 shows that DNA phosphorothioation was restored in the strain, proving that IscS, in cooperation with DptB-E, restored DNA phosphorothioation in E. coli. Involvement of IscS in DNA phosphorothioation in E. coli was further confirmed by site-directed mutagenesis. Three conserved cysteine residues in IscS, were mutated to Ala, generating three iscS cysteine mutants (C111A, C170A, and C328A). These mutants were again co-transformed with pJTU3510 (harboring the dpt gene cluster) into the iscS deletion mutant. Fig. 2 lane 10–12 shows that only C328A abolished DNA phosphorothioation.

IscS might participate in DNA phosphorothioation directly

The cysteine desulfurase IscS is a highly conserved master enzyme initiating sulfur transfer via persulfide to a range of acceptor proteins. IscS is involved in various physiological processes, including Fe-S cluster assembly, tRNA modification, and sulfur-containing cofactor biosynthesis. IscS-interacting partners, including IscU, TusA, ThiI, ThiF and MoeB are sulfur acceptors. Other proteins, such as CyaY, IscA and IscX, also bind to IscS, but their functional roles are not directly related to sulfur transfer [16]. Mutants of cyaY, iscA, iscU, iscX, moeB, tusA, thiF, thiI and thiS, proteins known to interact with IscS in E. coli, were tested for their possibility to participate into DNA phosphorothioation. Fig. 3 shows that none of these genes was required for the modification, as assayed by Dnd phenotype. This suggested that IscS in E. coli might participate directly into the modification process.
Figure 3

IscS might participate DNA phosphorothioation directly.

Ethidium bromide-stained agarose gels. TAE (top gel), samples run in normal TAE buffer; PAA (bottom gel), samples run in TAE containing PAA. Expression of S. enterica dptB-E resulted in DNA S-modification and a fluorescent smear in all samples, except for E. coli ΔiscS. IscS was therefore the only gene that was required for DNA S-modification among the tested deletions.

IscS might participate DNA phosphorothioation directly.

Ethidium bromide-stained agarose gels. TAE (top gel), samples run in normal TAE buffer; PAA (bottom gel), samples run in TAE containing PAA. Expression of S. enterica dptB-E resulted in DNA S-modification and a fluorescent smear in all samples, except for E. coli ΔiscS. IscS was therefore the only gene that was required for DNA S-modification among the tested deletions.

Protein-protein interactions between IscS and Dpt proteins

The bacterial two-hybrid system was used to detect interactions between E. coli IscS and DptB, C, D and E. IscS was fused with the bait protein, while DptB, C, D, and E were fused with the target protein. Strong protein-protein interactions were immediately detected between IscS and DptC (2% surviving cells on 3AT), IscS and DptE (2% surviving cells on 3AT), but not between IscS and DptB and DptD (Fig. 4A). These protein interactions were confirmed further by plating the co-transformed strains on medium containing streptomycin (Fig. 4B).
Figure 4

Protein interactions between IscS and Dpt proteins.

A.The bar graph shows protein interactions that enable the E. coli cells to survive on medium containing 3AT (3-amino-1,2,4-triazole). F, pBT-LGF2; P, pTRG-Gal11P; S, pBT-IscS; B, pTRG-DptB; C, pTRG-DptC; D, pTRG-DptD; E, pTRG-DptE; G, pTRG only. F and P were co-expressed as positive control; S and G were co-expressed as negative control. E. coli can grow on 3-AT selective screening medium only when there is a binding interaction between the fusion proteins expressed from the bait and target plasmids. B. Dual selection plate containing 3-amino-1,2,4-triazole and streptomycin. F+P, LGF2+GallP (growth, positive control); S+B, IscS+DptB (no growth, no interaction); S+C, IscS+DptC (growth indicating protein interaction); S+D, IscS+DptD (no growth, no interaction); S+E, IscS+DptE (growth indicating protein interaction); S+G, IscS+pTRG (no growth, negative control). C. Interactions between IscS and DptC as well as IscS and DptE confirmed by pull-down experiments. Left panel: IscS (N terminus Strep tagged) extraction was mixed with GSTDptC or GSTDptE extraction and then purified by Streptactin affinity purification. Western blot was done using antibody against GST. Right panel: the mixture was purified by GST affinity purification. Western blotting was done using antibody against StreptagII.

Protein interactions between IscS and Dpt proteins.

A.The bar graph shows protein interactions that enable the E. coli cells to survive on medium containing 3AT (3-amino-1,2,4-triazole). F, pBT-LGF2; P, pTRG-Gal11P; S, pBT-IscS; B, pTRG-DptB; C, pTRG-DptC; D, pTRG-DptD; E, pTRG-DptE; G, pTRG only. F and P were co-expressed as positive control; S and G were co-expressed as negative control. E. coli can grow on 3-AT selective screening medium only when there is a binding interaction between the fusion proteins expressed from the bait and target plasmids. B. Dual selection plate containing 3-amino-1,2,4-triazole and streptomycin. F+P, LGF2+GallP (growth, positive control); S+B, IscS+DptB (no growth, no interaction); S+C, IscS+DptC (growth indicating protein interaction); S+D, IscS+DptD (no growth, no interaction); S+E, IscS+DptE (growth indicating protein interaction); S+G, IscS+pTRG (no growth, negative control). C. Interactions between IscS and DptC as well as IscS and DptE confirmed by pull-down experiments. Left panel: IscS (N terminus Strep tagged) extraction was mixed with GSTDptC or GSTDptE extraction and then purified by Streptactin affinity purification. Western blot was done using antibody against GST. Right panel: the mixture was purified by GST affinity purification. Western blotting was done using antibody against StreptagII. Protein-protein interaction between IscS and DptC as well as IscS and DptE were further confirmed by pull-down experiments. Fig. 4C shows that Strep tagged IscS can pull-down both GST tagged DptC and DptE. Reciprocally, GST tagged DptC and DptE can also pull-down Strep tagged IscS.

Discussion

IscS is a highly conserved, but functionally versatile pyridoxal-5′-phosphate (PLP)-dependent enzyme. It delivers sulfur to players within various metabolic pathways, including iron-sulfur cluster assembly, thiamine and biotin synthesis, tRNA modifications, and molybdopterin biosynthesis [16], [17]. We show here that IscS can also participate in DNA phosphorothioation. The involvement of IscS in DNA phosphorothioation could be direct or indirect. By analyzing the Dnd phenotype and the mutants (Fig. 3), we were able to rule out the possibility that IscS participates indirectly via other pathways. We hypothesized that if IscS is involved in the DNA phosphorothioation process directly, we might be able to detect protein-protein interaction between IscS and the Dnd proteins. In keeping with this hypothesis, protein interaction between IscS and DndE and DndC were detected using the bacterial two hybrid system. There are two potential functions of IscS in the process of DNA phosphorothioation. One is Fe-S cluster assembly for the DndC protein. It is known that DndA can catalyze apo-Fe DndC to its Fe-S cluster form [5]. Another function might be to transfer sulfur from cysteine to the target DNA via protein interactions with the Dnd proteins, which is reminiscent of tRNA modification [18], [19]. These hypothesises are currently under intensive investigation. Disruption of iscS gene. A. Replacement of iscS by PCR targeting using a neo cassette flanked by 50 bp homologous E. coli sequences. B. Ethidium bromide-stained agarose gel showing PCR products obtained from E. coli ΔiscS and wild-type E. coli, using flanking primers. (TIF) Click here for additional data file.
  17 in total

1.  Cysteine sulfinate desulfinase, a NIFS-like protein of Escherichia coli with selenocysteine lyase and cysteine desulfurase activities. Gene cloning, purification, and characterization of a novel pyridoxal enzyme.

Authors:  H Mihara; T Kurihara; T Yoshimura; K Soda; N Esaki
Journal:  J Biol Chem       Date:  1997-09-05       Impact factor: 5.157

2.  Phosphorothioation of DNA in bacteria by dnd genes.

Authors:  Lianrong Wang; Shi Chen; Tiegang Xu; Koli Taghizadeh; John S Wishnok; Xiufen Zhou; Delin You; Zixin Deng; Peter C Dedon
Journal:  Nat Chem Biol       Date:  2007-10-14       Impact factor: 15.040

Review 3.  Transfer RNA modification.

Authors:  G R Björk; J U Ericson; C E Gustafsson; T G Hagervall; Y H Jönsson; P M Wikström
Journal:  Annu Rev Biochem       Date:  1987       Impact factor: 23.643

4.  A nifS-like gene, csdB, encodes an Escherichia coli counterpart of mammalian selenocysteine lyase. Gene cloning, purification, characterization and preliminary x-ray crystallographic studies.

Authors:  H Mihara; M Maeda; T Fujii; T Kurihara; Y Hata; N Esaki
Journal:  J Biol Chem       Date:  1999-05-21       Impact factor: 5.157

5.  Structural basis for Fe-S cluster assembly and tRNA thiolation mediated by IscS protein-protein interactions.

Authors:  Rong Shi; Ariane Proteau; Magda Villarroya; Ismaïl Moukadiri; Linhua Zhang; Jean-François Trempe; Allan Matte; M Eugenia Armengod; Miroslaw Cygler
Journal:  PLoS Biol       Date:  2010-04-13       Impact factor: 8.029

6.  IscS functions as a primary sulfur-donating enzyme by interacting specifically with MoeB and MoaD in the biosynthesis of molybdopterin in Escherichia coli.

Authors:  Wanjiao Zhang; Alexander Urban; Hisaaki Mihara; Silke Leimkühler; Tatsuo Kurihara; Nobuyoshi Esaki
Journal:  J Biol Chem       Date:  2009-11-29       Impact factor: 5.157

7.  A novel DNA modification by sulfur: DndA is a NifS-like cysteine desulfurase capable of assembling DndC as an iron-sulfur cluster protein in Streptomyces lividans.

Authors:  Delin You; Lianrong Wang; Fen Yao; Xiufen Zhou; Zixin Deng
Journal:  Biochemistry       Date:  2007-05-01       Impact factor: 3.162

8.  Analysis of a genomic island housing genes for DNA S-modification system in Streptomyces lividans 66 and its counterparts in other distantly related bacteria.

Authors:  Xinyi He; Hong-Yu Ou; Qing Yu; Xiufen Zhou; Jun Wu; Jingdan Liang; Wei Zhang; Kumar Rajakumar; Zixin Deng
Journal:  Mol Microbiol       Date:  2007-07-19       Impact factor: 3.501

9.  Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.

Authors:  Tomoya Baba; Takeshi Ara; Miki Hasegawa; Yuki Takai; Yoshiko Okumura; Miki Baba; Kirill A Datsenko; Masaru Tomita; Barry L Wanner; Hirotada Mori
Journal:  Mol Syst Biol       Date:  2006-02-21       Impact factor: 11.429

10.  dndDB: a database focused on phosphorothioation of the DNA backbone.

Authors:  Hong-Yu Ou; Xinyi He; Yucheng Shao; Cui Tai; Kumar Rajakumar; Zixin Deng
Journal:  PLoS One       Date:  2009-04-09       Impact factor: 3.240

View more
  26 in total

1.  Deletion of the Proposed Iron Chaperones IscA/SufA Results in Accumulation of a Red Intermediate Cysteine Desulfurase IscS in Escherichia coli.

Authors:  Jing Yang; Guoqiang Tan; Ting Zhang; Robert H White; Jianxin Lu; Huangen Ding
Journal:  J Biol Chem       Date:  2015-04-23       Impact factor: 5.157

2.  Pathological phenotypes and in vivo DNA cleavage by unrestrained activity of a phosphorothioate-based restriction system in Salmonella.

Authors:  Bo Cao; Qiuxiang Cheng; Chen Gu; Fen Yao; Michael S DeMott; Xiaoqing Zheng; Zixin Deng; Peter C Dedon; Delin You
Journal:  Mol Microbiol       Date:  2014-07-23       Impact factor: 3.501

3.  Occurrence, evolution, and functions of DNA phosphorothioate epigenetics in bacteria.

Authors:  Tong Tong; Si Chen; Lianrong Wang; You Tang; Jae Yong Ryu; Susu Jiang; Xiaolin Wu; Chao Chen; Jie Luo; Zixin Deng; Zhiqiang Li; Sang Yup Lee; Shi Chen
Journal:  Proc Natl Acad Sci U S A       Date:  2018-03-12       Impact factor: 11.205

4.  Genomic mapping of phosphorothioates reveals partial modification of short consensus sequences.

Authors:  Bo Cao; Chao Chen; Michael S DeMott; Qiuxiang Cheng; Tyson A Clark; Xiaolin Xiong; Xiaoqing Zheng; Vincent Butty; Stuart S Levine; George Yuan; Matthew Boitano; Khai Luong; Yi Song; Xiufen Zhou; Zixin Deng; Stephen W Turner; Jonas Korlach; Delin You; Lianrong Wang; Shi Chen; Peter C Dedon
Journal:  Nat Commun       Date:  2014-06-05       Impact factor: 14.919

5.  DndEi Exhibits Helicase Activity Essential for DNA Phosphorothioate Modification and ATPase Activity Strongly Stimulated by DNA Substrate with a GAAC/GTTC Motif.

Authors:  Tao Zheng; Pan Jiang; Bo Cao; Qiuxiang Cheng; Lingxin Kong; Xiaoqing Zheng; Qinghai Hu; Delin You
Journal:  J Biol Chem       Date:  2015-12-02       Impact factor: 5.157

6.  Mitochondrial and nucleolar localization of cysteine desulfurase Nfs and the scaffold protein Isu in Trypanosoma brucei.

Authors:  Julie Kovárová; Eva Horáková; Piya Changmai; Marie Vancová; Julius Lukeš
Journal:  Eukaryot Cell       Date:  2013-11-15

7.  Structural and Functional Analysis of DndE Involved in DNA Phosphorothioation in the Haloalkaliphilic Archaea Natronorubrum bangense JCM10635.

Authors:  Wei He; Haiyan Gao; Dan Wu; Susu Jiang; Wanqiu Huang; Chao Chen; Zixin Deng; Lei Xiong; Geng Wu; Lianrong Wang
Journal:  mBio       Date:  2022-04-14       Impact factor: 7.786

8.  Regulation of DNA phosphorothioate modification in Salmonella enterica by DndB.

Authors:  Wei He; Teng Huang; You Tang; Yanhua Liu; Xiaolin Wu; Si Chen; Wan Chan; Yajie Wang; Xiaoyun Liu; Shi Chen; Lianrong Wang
Journal:  Sci Rep       Date:  2015-07-20       Impact factor: 4.379

9.  In vitro analysis of phosphorothioate modification of DNA reveals substrate recognition by a multiprotein complex.

Authors:  Bo Cao; Xiaoqing Zheng; Qiuxiang Cheng; Fen Yao; Tao Zheng; I Ramesh Babu; Huchen Zhou; Peter Dedon; Delin You
Journal:  Sci Rep       Date:  2015-07-27       Impact factor: 4.379

10.  Interactions of Dnd proteins involved in bacterial DNA phosphorothioate modification.

Authors:  Wei Xiong; Gong Zhao; Hao Yu; Xinyi He
Journal:  Front Microbiol       Date:  2015-10-20       Impact factor: 5.640

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.