Literature DB >> 23222682

Isolation and characterization of eleven polymorphic microsatellite loci for the valuable medicinal plant Dendrobium huoshanense and cross-species amplification.

Hui Wang1, Nai-Fu Chen, Ji-Yang Zheng, Wen-Cai Wang, Yun-Yun Pei, Guo-Ping Zhu.   

Abstract

Dendrobium huoshanense (Orchidaceae) is a perennial herb and a widely used medicinal plant in Traditional Chinese medicine (TCM) endemic to Huoshan County town in Anhui province in Southeast China. A microsatellite-enriched genomic DNA library of D. huoshanense was developed and screened to identify marker loci. Eleven polymorphic loci were isolated and analyzed by screening 25 individuals collected from a natural population. The number of alleles per locus ranged from 2 to 5. The observed and expected heterozygosities ranged from 0.227 to 0.818 and from 0.317 to 0.757, respectively. Two loci showed significant deviations from Hardy-Weinberg equilibrium and four of the pairwise comparisons of loci revealed linkage disequilibrium (p < 0.05). These microsatellite loci were cross-amplified for five congeneric species and seven loci can be amplified in all species. These simple sequence repeats (SSR) markers are useful in genetic studies of D. huoshanense and other related species and in conservation decision-making.

Entities:  

Mesh:

Year:  2012        PMID: 23222682      PMCID: PMC3546720          DOI: 10.3390/ijms131216779

Source DB:  PubMed          Journal:  Int J Mol Sci        ISSN: 1422-0067            Impact factor:   5.923


1. Introduction

Dendrobium huoshanense, a perennial epiphytic orchid herb, is endemic to Huoshan County town in Anhui province in southeast China. It is a widely used medicinal plant in traditional Chinese medicine (TCM), whose stems have been used for centuries in China and Southeast Asia as a therapeutic agent for treatment of cataract, throat inflammation, fever, chronic superficial gastritis, and as a tonic to improve health, mentality and to delay aging [1]. Recent researches revealed that the pharmacological activity of D. huoshanense was due to several active components, such as alkaloids, stilbenoid, glycosides and polysaccharides [2-4]. Moreover, D. huoshanense is of great horticultural interest due to the delicate lime flowers that bloom from May [4]. However, human activities have brought this species to the brink of extinction in the last few decades. Extensive deforestation and increased utilization in TCM have caused a dramatic decline in the natural populations. Although the morphology and pharmacology of D. huoshanense has been extensively studied, information on molecular phylogeny and population genetics is largely unknown. During recent decades, SSRs (simple sequence repeats), also known as microsatellites, have become the most popular source of genetic markers owing to their high reproducibility, multi-allelic nature, codominant inheritance, high abundance, and wide genome coverage [5,6]. They are an ideal tool for genome mapping, population genetics, conservation biology, marker-assisted selection and other studies [7-10]. Previous work by Lu et al. showed the development and characterization of SSR markers for Dendrobium officinale[11]. In addition, Ding et al. reported that 13 of the 15 tested D. officinale SSR primer pairs were successful in amplifying corresponding products in D. huoshanense[12]. Here, we report the isolation and characterization of eleven polymorphic microsatellite loci from D. huoshanense using a modified biotin-capture method for the first time [13].

2. Results and Discussion

Eleven polymorphic microsatellite loci were isolated and deposited in GenBank (JQ400190–JQ400200; Table 1). Polymorphism at each locus was determined using 25 D. huoshanense individuals from a natural population. The number of alleles per locus ranged from two to five. The largest number of alleles (five) was found at Hs48 locus (Table 1). The observed heterozygosity (Ho) ranged from 0.227 to 0.818 and the expected heterozygosity (He) ranged from 0.317 to 0.757 (Table 1).
Table 1

Eleven microsatellite loci isolated for D. huoshanense collected from Huoshan County town: locus name, repeat motif, primer sequences, annealing temperature (Ta), allele size range, number of alleles (Na), observed (Ho) and expected (He) heterozygosities and GenBank accession number.

LocusRepeat motifPrimer sequence (5′-3′)Ta (°C)Allele size range (bp)NaHoHeGenBank Accession No.
Hs39 *(TC)26F: CACCGCTTGTCCATCAAACTTCR: CGCAATGGTTGAGCGTGTAAAT61313–35740.2270.582JQ400190
Hs40(TC)20F: AAGATTGAGGCGATGTTGTR: ACTTGCTGGAATTTGTGGT61285–32330.6360.595JQ400191
Hs41(AG)26F: CAGGCGGCAGAGTTACAGR: GCCAAAGCAAAACAAAGTAGAG55262–29630.5000.621JQ400192
Hs42(GA)22F: TCCATCTATCCATCAACTAAGCR: GACGAGTATGTTCAGCAGATTG61340–36020.3640.488JQ400193
Hs44(CT)16F: ATGGCATAAAACCTCCCCGR: GAGCGGACAATCGCATCTAAGT55215–28740.8180.757JQ400194
Hs47(TG)10(AG)9F: TGAAATAGCCATCCTGAAGAGR: GGAGAAGATTATTGGGTTTGAGT59258–28430.2730.317JQ400195
Hs48(TG)39(AG)30(TG)10F: AGGGAAAGGCCGTAATGATGATR: AGAGTTGTAATGTTGGCTCCGCTA61294–38250.6360.719JQ400196
Hs50 *(TC)28F: CCAAGCAAACCTCAAGAACTCR: CGAAAGGACCGACCTAATACT52283–30530.4550.671JQ400197
Hs54(TC)18C3(TC)17F: CAGCCAACAGCCACTCTTCTTCR: CGCCGTCAAATAGTTTATCGTAG59227–29330.5000.515JQ400198
Hs56(AG)6A3(GA)16F: GCAGAAGCAAGAATAAAAGTCGR: ATAAGATTAGATGAGCCCCAGA59212–24020.5450.495JQ400199
Hs57(TC)22F: CCTTGAATTTGCATGGAGTTR: TTTTGGGGCATTTTGCTGTT52280–29020.6820.502JQ400200

indicates significant deviation from Hardy-Weinberg equilibrium (p < 0.05).

Deviations from Hardy-Weinberg expectation (HWE) were detected for each locus, nine loci conformed to HWE and two loci (Hs39, Hs50) significantly deviated from HWE in the sampled population after Bonferroni’s correction (p < 0.05). Linkage disequilibrium (LD) is important for evolutionary and population genetics and so LD between pairs of loci was calculated. Four of the pairwise comparisons (Hs40 and Hs47, Hs41 and Hs54, Hs50 and Hs57, Hs48 and Hs54) exhibited significant linkage disequilibrium (p < 0.05). The cross-species amplification was carried out. The results of the screen are summarized in Table 2. Notably, seven loci (Hs39, Hs41, Hs44, Hs47, Hs48, Hs56, Hs57) can be amplified in all five species, while three loci (Hs40, Hs50, Hs54) can be amplified in four species and one loci (Hs42) can be amplified in two species. These results suggest that the identified microsatellite markers are useful in genetic studies of D. huoshanense and other Dendrobium species.
Table 2

Cross-species amplification of eleven microsatellite loci in five Dendrobium species.

LocusD. aduncumD. henanenseD. moniliformeD. nobileD. officinale
Hs39226–279190–279310–369238–268190–226
Hs40230–287287–341189–230230
Hs41322–380323–395359–395322–380323–359
Hs42235–265340–361
Hs44279–316279–320300268268–314
Hs47235–257244–258258–284258240–290
Hs48310–380240–290300–375240286
Hs50216–243293220–243258–280
Hs54193–211220230–301193–230
Hs56211–249240–285211–240211–240220–240
Hs57225210–225280–300210–280230–268

The meaning of the provided values is the size range of PCR products and minus sign (–) denotes no visible PCR product.

3. Experimental Section

3.1. Plant Materials and DNA Extraction

The leaves of D. huoshanense from a natural population in Huoshan (31°0′35″N, 115°0′53″E, Anhui, China) were collected, dried in silica gel in sealed polyethylene bags and stored at room temperature until use. The total genomic DNA of 25 individuals was extracted using the standard cetyltrimethyl ammonium bromide (CTAB) method [14].

3.2. Isolation of Microsatellite Markers

About 500 ng genomic DNA from a single individual were digested by Sau3AI (TaKaRa), and the fragments ranging from 400 to 900 bp were purified and ligated to the Sau3AI adaptors oligoA (5′-GGCCAGAGACCCCAAGCTTCG-3′) and oligoB (5′-PO4-GATCCGAAGCTTGGGGTCTCTGG CC-3′) [13]. The products were then hybridized to the single-stranded 3′-biotinylated (CT)15 oligonucleotide probes and captured by streptavidin-coated beads (Promega). Captured fragments were amplified and ligated to pMD18-T vector (TaKaRa). The recombinant plasmid was transformed into Escherichia coli DH5α and the transformants were distinguished by blue-white screening. The insert-positive clones were identified by PCR using oligo(A) and (CT)15 oligonucleotides as the primers. The clones that yielded two or more bands contained microsatellite fractions. In total, fifty-one positive colonies were sequenced on the ABI-PRISM 3730 automated sequencer, and thirty-six contained microsatellites. Thirty-six pairs of primers were then designed using PRIMER PREMIER 5.0 software [15] and synthesized. Eleven sets of primers that gave consistent and specific PCR products were tested for allelic polymorphism in 25 individuals from a natural population. PCR amplifications (15 μL) contained 6.25 μL GoTaq® Green Master Mix (Promega, Nanjing, China), 0.5–1.0 μmol of each primer and 10–20 ng DNA, and were performed in an iCycler thermocycler (Bio-Rad). PCR conditions were 4 min at 94 °C followed by 35 cycles of 45 s at 94 °C, 35 s at optimized annealing temperature (Table 1) and 30 s at 72 °C, with a final extension time of 8 min at 72 °C. PCR products were separated on an 8% denaturing polyacrylamide gel using a LI-COR 4200 automated DNA sequencer and analyzed using LI-COR SAGAGT software.

3.3. Data Analysis

The number of alleles (Na) per locus, observed heterozygosity (Ho) and expected heterozygosity (He), Hardy-Weinberg equilibrium (HWE) and linkage disequilibrium (LD) were tested using GENEPOP version 4.0 [16]. MICRO-CHECKER version 2.2.3 was used to determine the presence of null alleles [17]. All results for multiple tests were corrected using Bonferroni’s correction [18].

3.4. Cross-Species Transferability

Cross-species amplification of microsatellite markers was performed for five congeneric species, D. aduncum, D. henanense, D. moniliforme, D. nobile and D. officinale. DNA extraction and PCR amplification were performed as described for D. huoshanense except that the annealing temperature was re-optimized for each locus. Five individuals from each species were screened at 11 microsatellite loci.

4. Conclusions

We report the isolation and characterization of eleven polymorphic microsatellite loci for D. huoshanense and cross-amplification in five congeneric species. The low level of polymorphism here was possibly caused by heterozygote deficiency resulting from inbreeding or sampling related individuals. These eleven microsatellite markers are considered useful for population genetic studies and conservation decision-making for this medicinal plant.
  7 in total

Review 1.  Microsatellites: genomic distribution, putative functions and mutational mechanisms: a review.

Authors:  You-Chun Li; Abraham B Korol; Tzion Fahima; Avigdor Beiles; Eviatar Nevo
Journal:  Mol Ecol       Date:  2002-12       Impact factor: 6.185

Review 2.  Microsatellites: simple sequences with complex evolution.

Authors:  Hans Ellegren
Journal:  Nat Rev Genet       Date:  2004-06       Impact factor: 53.242

Review 3.  Mining microsatellites in eukaryotic genomes.

Authors:  Prakash C Sharma; Atul Grover; Günter Kahl
Journal:  Trends Biotechnol       Date:  2007-10-22       Impact factor: 19.536

4.  ANALYZING TABLES OF STATISTICAL TESTS.

Authors:  William R Rice
Journal:  Evolution       Date:  1989-01       Impact factor: 3.694

5.  Development and characterization of 110 novel EST-SSR markers for Dendrobium officinale (Orchidaceae).

Authors:  Jiang-Jie Lu; Na-Na Suo; Xu Hu; Shang Wang; Jun-Jun Liu; Hui-Zhong Wang
Journal:  Am J Bot       Date:  2012-10-01       Impact factor: 3.844

6.  [Development of microsatellites of Dendrobium officinale and its application in purity identification of germplasm].

Authors:  Ming-Lu Xie; Bei-Wei Hou; Li Han; Yan-Hong Ma; Xiao-Yu Ding
Journal:  Yao Xue Xue Bao       Date:  2010-05

7.  Conversion of protocorm-like bodies of Dendrobium huoshanense to shoots: the role of polyamines in relation to the ratio of total cytokinins and indole-3-acetic acid.

Authors:  Ying Wang; Jian-Ping Luo; Hu-Qi Wu; Hong Jin
Journal:  J Plant Physiol       Date:  2009-07-21       Impact factor: 3.549

  7 in total
  5 in total

Review 1.  Dendrobium huoshanense C.Z.Tang et S.J.Cheng: A Review of Its Traditional Uses, Phytochemistry, and Pharmacology.

Authors:  Leilei Gao; Fang Wang; Tingting Hou; Chunye Geng; Tao Xu; Bangxing Han; Dong Liu
Journal:  Front Pharmacol       Date:  2022-07-12       Impact factor: 5.988

2.  ICP-MS based metallomics and GC-MS based metabolomics reveals the physiological and metabolic responses of Dendrobium huoshanense plants exposed to Fe3O4 nanoparticles.

Authors:  Zhaojian Wang; Jing Wu; Zongping Sun; Weimin Jiang; Yingying Liu; Jun Tang; Xiaoxi Meng; Xinglong Su; Liping Wu; Longhai Wang; Xiaohu Guo; Daiyin Peng; Shihai Xing
Journal:  Front Nutr       Date:  2022-09-23

3.  A molecular genetic linkage map of Eucommia ulmoides and quantitative trait loci (QTL) analysis for growth traits.

Authors:  Yu Li; Dawei Wang; Zhouqi Li; Junkun Wei; Cangfu Jin; Minhao Liu
Journal:  Int J Mol Sci       Date:  2014-01-28       Impact factor: 5.923

4.  Analysis of microsatellites in the vulnerable orchid Gastrodia flavilabella: the development of microsatellite markers, and cross-species amplification in Gastrodia.

Authors:  Chi-Chu Tsai; Pei-Yin Wu; Chia-Chi Kuo; Min-Chun Huang; Sheng-Kun Yu; Tsai-Wen Hsu; Tzen-Yuh Chiang; Yu-Chung Chiang
Journal:  Bot Stud       Date:  2014-10-09       Impact factor: 2.787

5.  Development and characterization of 16 novel microsatellite markers by Transcriptome sequencing for Angelica dahurica and test for cross-species amplification.

Authors:  Qianqian Liu; Zuyu Lu; Wei He; Fang Li; Wenna Chen; Chan Li; Zhi Chao; Enwei Tian
Journal:  BMC Plant Biol       Date:  2020-04-08       Impact factor: 4.215

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.