| Literature DB >> 23222682 |
Hui Wang1, Nai-Fu Chen, Ji-Yang Zheng, Wen-Cai Wang, Yun-Yun Pei, Guo-Ping Zhu.
Abstract
Dendrobium huoshanense (Orchidaceae) is a perennial herb and a widely used medicinal plant in Traditional Chinese medicine (TCM) endemic to Huoshan County town in Anhui province in Southeast China. A microsatellite-enriched genomic DNA library of D. huoshanense was developed and screened to identify marker loci. Eleven polymorphic loci were isolated and analyzed by screening 25 individuals collected from a natural population. The number of alleles per locus ranged from 2 to 5. The observed and expected heterozygosities ranged from 0.227 to 0.818 and from 0.317 to 0.757, respectively. Two loci showed significant deviations from Hardy-Weinberg equilibrium and four of the pairwise comparisons of loci revealed linkage disequilibrium (p < 0.05). These microsatellite loci were cross-amplified for five congeneric species and seven loci can be amplified in all species. These simple sequence repeats (SSR) markers are useful in genetic studies of D. huoshanense and other related species and in conservation decision-making.Entities:
Mesh:
Year: 2012 PMID: 23222682 PMCID: PMC3546720 DOI: 10.3390/ijms131216779
Source DB: PubMed Journal: Int J Mol Sci ISSN: 1422-0067 Impact factor: 5.923
Eleven microsatellite loci isolated for D. huoshanense collected from Huoshan County town: locus name, repeat motif, primer sequences, annealing temperature (Ta), allele size range, number of alleles (Na), observed (Ho) and expected (He) heterozygosities and GenBank accession number.
| Locus | Repeat motif | Primer sequence (5′-3′) | Allele size range (bp) | GenBank Accession No. | ||||
|---|---|---|---|---|---|---|---|---|
| Hs39 | (TC)26 | F: CACCGCTTGTCCATCAAACTTC | 61 | 313–357 | 4 | 0.227 | 0.582 | JQ400190 |
| Hs40 | (TC)20 | F: AAGATTGAGGCGATGTTGT | 61 | 285–323 | 3 | 0.636 | 0.595 | JQ400191 |
| Hs41 | (AG)26 | F: CAGGCGGCAGAGTTACAG | 55 | 262–296 | 3 | 0.500 | 0.621 | JQ400192 |
| Hs42 | (GA)22 | F: TCCATCTATCCATCAACTAAGC | 61 | 340–360 | 2 | 0.364 | 0.488 | JQ400193 |
| Hs44 | (CT)16 | F: ATGGCATAAAACCTCCCCG | 55 | 215–287 | 4 | 0.818 | 0.757 | JQ400194 |
| Hs47 | (TG)10(AG)9 | F: TGAAATAGCCATCCTGAAGAG | 59 | 258–284 | 3 | 0.273 | 0.317 | JQ400195 |
| Hs48 | (TG)39(AG)30(TG)10 | F: AGGGAAAGGCCGTAATGATGAT | 61 | 294–382 | 5 | 0.636 | 0.719 | JQ400196 |
| Hs50 | (TC)28 | F: CCAAGCAAACCTCAAGAACTC | 52 | 283–305 | 3 | 0.455 | 0.671 | JQ400197 |
| Hs54 | (TC)18C3(TC)17 | F: CAGCCAACAGCCACTCTTCTTC | 59 | 227–293 | 3 | 0.500 | 0.515 | JQ400198 |
| Hs56 | (AG)6A3(GA)16 | F: GCAGAAGCAAGAATAAAAGTCG | 59 | 212–240 | 2 | 0.545 | 0.495 | JQ400199 |
| Hs57 | (TC)22 | F: CCTTGAATTTGCATGGAGTT | 52 | 280–290 | 2 | 0.682 | 0.502 | JQ400200 |
indicates significant deviation from Hardy-Weinberg equilibrium (p < 0.05).
Cross-species amplification of eleven microsatellite loci in five Dendrobium species.
| Locus | |||||
|---|---|---|---|---|---|
| Hs39 | 226–279 | 190–279 | 310–369 | 238–268 | 190–226 |
| Hs40 | 230–287 | – | 287–341 | 189–230 | 230 |
| Hs41 | 322–380 | 323–395 | 359–395 | 322–380 | 323–359 |
| Hs42 | 235–265 | – | 340–361 | – | – |
| Hs44 | 279–316 | 279–320 | 300 | 268 | 268–314 |
| Hs47 | 235–257 | 244–258 | 258–284 | 258 | 240–290 |
| Hs48 | 310–380 | 240–290 | 300–375 | 240 | 286 |
| Hs50 | – | 216–243 | 293 | 220–243 | 258–280 |
| Hs54 | 193–211 | 220 | 230–301 | 193–230 | – |
| Hs56 | 211–249 | 240–285 | 211–240 | 211–240 | 220–240 |
| Hs57 | 225 | 210–225 | 280–300 | 210–280 | 230–268 |
The meaning of the provided values is the size range of PCR products and minus sign (–) denotes no visible PCR product.