Literature DB >> 28510952

Analysis of microsatellites in the vulnerable orchid Gastrodia flavilabella: the development of microsatellite markers, and cross-species amplification in Gastrodia.

Chi-Chu Tsai1, Pei-Yin Wu2, Chia-Chi Kuo3, Min-Chun Huang4, Sheng-Kun Yu5, Tsai-Wen Hsu6, Tzen-Yuh Chiang7, Yu-Chung Chiang8.   

Abstract

BACKGROUND: Gastrodia flabilabella is a mycoheterotrophic orchid that obtains carbohydrates and nutrients from its symbiotic mycorrhizal fungi. The species is an endemic and vulnerable species enlisted in the "A Preliminary Red List of Taiwanese Vascular Plants" according to the IUCN Red List Categories and Criteria Version 3.1. G. flabilabella dwells the underground of broadleaf and coniferous forest with richness litter. Based on herbarium records, this species is distributed in central Taiwan. Twenty eight microsatellite loci were developed in G. flabilabella and were tested for cross-species amplification in additional taxa of G. confusoides, G. elata, and G. javanica. We estimated the genetic variation that is valuable for conservation management and the development of the molecular identification system for G. elata, a traditional Chinese medicine herb.
RESULTS: Microsatellite primer sets were developed from G. flabilabella using the modified AFLP and magnetic bead enrichment method. In total, 257 microsatellite loci were obtained from a magnetic bead enrichment SSR library. Of the 28 microsatellite loci, 16 were polymorphic, in which the number of alleles ranged from 2 to 15, with the observed heterozygosity ranging from 0.02 to 1.00. In total, 15, 13, and 7 of the loci were found to be interspecifically amplifiable to G. confusoides, G. elata, and G. javanica, respectively.
CONCLUSIONS: Amplifiable and transferable microsatellite loci are potentially useful for future studies in investigating intraspecific genetic variation, reconstructing phylogeographic patterns among closely related species, and establishing the standard operating system of molecular identification in Gastrodia.

Entities:  

Keywords:  Conservation; Gastrodia; Microsatellites; Mycoheterotrophic orchid; Population genetics; Simple sequence repeat markers

Year:  2014        PMID: 28510952      PMCID: PMC5430336          DOI: 10.1186/s40529-014-0072-4

Source DB:  PubMed          Journal:  Bot Stud        ISSN: 1817-406X            Impact factor:   2.787


Background

Gastrodia is the largest achlorophyllous and mycoheterotrophic genus in the Orchidaceae with 50 to 60 species in the world. Recent studies recognized 19 species, including 13 endemic species distributed in Taiwan (Hsu [2008]; Leou [2000]; Hsu and Kuo [2010]; Chung and Hsu [2006]). Species diversity in Taiwan Island is one of the hot spots of Gastrodia in the world. Gastrodia elata Blume is an important Chinese medicine that provides supplement to protect neuron and cardiovascular systems (Baek et al. [1999]). Ecologically, Gastrodia species are saprophyte (Leou [2000]), growing underground of forest or bamboo grove with richness litter and obtaining carbohydrates and nutrients from its symbiotic mycorrhizal fungi, including Armillaria mellea and other microbial species (Cha and Igarashi [1995]). Due to such a unique growth form, Gastrodia species are difficult to find except the flowering and fruiting seasons, generally 2 to 4 weeks after budding. Most Gastrodia species are vulnerable to the human destruction. As a result, 7 species recognized as threatened species, including one as critically endangered, three as endangered, and another three as vulnerable, are evaluated by the IUCN Red List Categories and Criteria Version 3.1 (IUCN [2012]) and listed in the “A Preliminary Red List of Taiwanese Vascular Plants” (Wang et al. [2012a]). Gastrodia flavilabella S.S. Ying is an endemic and vulnerable species with only few populations distributed at the edges of conifer plantation or natural broadleaf forests restricted to the central mountainous regions from 1,000 to 1,300 meters altitude (Leou [2000]). This taxon is characterized by tuberous horizontal rhizomes ca. 4 to 10 cm in length and 0.6–1.6 cm in width bearing many coral-like buds (Leou [2000]). Unique life form and habitat preference lead his species to be rare and vulnerable. However, no data for the genetic diversity in this species or genus are available, which is critical for evaluating the population dynamics and conservation genetics for conservation management. Microsatellite genotyping is the most popular molecular tool for evaluating the structure and genetic diversity of populations because of its high genetic variability (cf. Ho et al. [2014]). With co-dominant inheritance, the information of microsatellite genotyping can estimate the effective population sizes in ancestral and present populations (Ge et al. [2014]), Hardy-Weinberg Equilibrium (Ge et al. [2012]), and levels of introgression (Liao et al. [2012]). In addition, microsatellite genotyping technology was extended to molecular identification system for paternity testing and cultivar identification (Tsai et al. [2013]). In this study, we constructed a microsatellite enriched library and developed microsatellite loci for future estimating the population genetic diversity based on microsatellite genotyping. The application of the microsatellite primers developed in this study was tested in other taxa of Gastrodia, specifically three taxa for polymorphism test and 13 species for transferability test.

Methods

Sampling and DNA extractions

Twenty individuals from each of four taxa in Gastrodia, including G. flavilabella from Nantou, G. elata from China, G. javanica (Blume) Lindl. from Lanyu Islet, and G. confusoides T. C. Hsu, S. W. Chung & C. M. Kuo from Taichung (Table 1) were sampled for polymorphism test. One individual of G. flavilabella was used to construct a microsatellite enriched library and to develop microsatellite loci. To test the transferability of these newly designed microsatellite primers, two individuals of other 13 native taxa listed in Table 1, specifically 8 endemic species, were sampled from the field. The sample location, sample size, and deposited herbarium for the voucher specimens are listed in Table 1. To avoid the contamination from the symbiotic mycorrhizal fungi, we collected the flower buds or seed pods for extracting total genomic DNA. Total DNA was extracted from silica-dried plant materials using the Plant Genomic DNA Extraction Kit (RBC Bioscience, Taipei, Taiwan).
Table 1

Sample location for each species of the

SpeciesLocationSpecies codeSample sizeLatitudeLongitudeHerbarium
Gastrodia flavilabella Nantou, TaiwanGfl20N 23°39′43″E 120°47′41″TAIE
Gastrodia elata Yunan, ChinaGel20N 27°46′07″E 104°15′39″TAIE
Gastrodia javanica Lanyu, TaiwanGja20N 22°00′53″E 121°34′17″TAIE
Gastrodia confusoides Taichung, TaiwanGco20N 24°14′21″E 120°54′81″TAIE
Gastrodia albida Taipei, TaiwanGal2N 24°50′36″E 121°33′28″TAIE
Gastrodia appendiculata Nantou, TaiwanGap2N 23°41′17″E 120°47′26″TAIE
Gastrodia autumnalis Taoyuan, TaiwanGau2N 24°47′34″E 121°26′08″TAIE
Gastrodia clausa Taipei, TaiwanGcl2N 25°04′57″E 121°37′33″TAIE
Gastrodia fontinalis Taipei, TaiwanGfo2N 24°51′27″E 121°32′19″TAIE
Gastrodia gracilis Chaiyi, TaiwanGgr2N 23°29′28″E 120°43′42″TAIE
Gastrodia leoui Chaiyi, TaiwanGle2N 23°29′28″E 120°43′42″TAIE
Gastrodia nantoensis Nantou, TaiwanGna2N 23°41′17″E 120°47′27″TAIE
Gastrodia nipponica Taipei, TaiwanGni2N 24°51′05″E 121°32′11″TAIE
Gastrodia pubilabiata Nantou, TaiwanGpu2N 23°40′23″E 120°47′54″TAIE
Gastrodia shimizuana Pingtung, TaiwanGsh2N 22°12′12″E 120°47′16″TAIE
Gastrodia theana Nantou, TaiwanGth2N 23°51′57″E 120°55′42″TAIE
Gastrodia uraiensis Taipei, TaiwanGur2N 24°50′41″E 121°33′34″TAIE

Note: TAIE = the herbarium of the Taiwan Endemic Species Research Institute.

Sample size, location, coordinates, and voucher specimens are indicated.

Sample location for each species of the Note: TAIE = the herbarium of the Taiwan Endemic Species Research Institute. Sample size, location, coordinates, and voucher specimens are indicated.

Isolation of microsatellite DNA loci and identification

In order to develop the molecular markers for evaluating the genetic variation of populations and testing transferability in Gastrodia species, we selected one individual of G. flabilabella to build (AG)n, (AC)n, (TTG)n, (TCC)n, (ACG), (CCA)n, (AACT)n, and (AGAT)n enrich DNA library. Microsatellite loci were isolated following the magnetic bead enrichment method (Liao et al. [2009]; Hsu et al. [2013]), modified from the method proposed by Zane et al. ([2002]) based on AFLP, magnetic bead enrichment, and TA cloning protocol. Genomic DNA of G. flabilabella was digested using the restriction enzyme Mse I (Promega, Madison, Wisconsin, USA) and DNA fragments from 400 to 1000 bps were isolated from agarose gels using the HiYieldTM Gel PCR DNA Fragments Extraction Kit (RBC Bioscience). The purified partial genomic library was ligated to adaptors (complementary oligo A: 5′-TACTCAGGACTCAT-3′ and 5′ phosphorylated oligo B: 5′-GACGATGAGTCCTGAG-3′). The partial genomic library was enriched using 15 cycles of prehybridization polymerase chain reaction (PCR) using adaptor specific primers (5′-GATGAGTCCTGAGTAAN-3′, hereafter referred to as Mse I-N). The enriched partial genomic library was denatured and hybridized to eight different biotinylated probes [Biotin-(AG)15, Biotin-(AC)15, Biotin-(TTG)10, Biotin-(TCC)10, Biotin-(ACG)10, Biotin-(CCA)10, Biotin-(AACT)8, and Biotin-(AGAT)8] at 68°C for 1 hour for enrichment. The DNA fragments hybridized to probes was incubated and captured using Streptavidin MagneSphere Paramagnetic Particles (Promega) at 42°C for 2 hours. The microsatellite enriched DNA fragments were eluted with high- and low-salt solutions and used as template DNAs for 25 cycles of PCR amplification. The microsatellite enriched DNA fragments were then used as templates for 25 cycles of PCR amplification using Mse I-N. The PCR products were purified using the HiYieldTM Gel PCR DNA Fragments Extraction Kit (RBC Bioscience) and then cloned directly into the p GEM®-T Easy Vector System (Promega). Plasmids containing the PCR product were isolated using an alkaline lysis protocol (Birnboim and Doly [1979]), screened using PCR with primer pairs: (AG)10 or (AC)10/SP6 or T7), and purified with a PureYieldTM Plasmid Miniprep System (Promega). The selected plasmids were subsequently sequenced in both directions using an ABI BigDye3.1 Terminator Cycle Sequencing Kit (Applied Biosystems, USA) with the ABI PRISM® 3700 DNA Automated Sequencer. Sequences enclosing tandem repeat sequences were recognized using Tandem Repeats Finder version 4.07b (Benson [1999]) by general setting on 2, 3, and 5 of match, mismatch, and indel for alignment parameters and 20 for minimum alignment score to report repeat. The pair of specific primers for each microsatellite locus detected by Tandem Repeats Finder was designed using FastPCR software version 6.4.18 (Kalendar et al. [2011]) based on the setting of parameters at a PCR product size ranging from 100 to 400 bp, an optimum annealing temperature of 55°C, and a GC content ranging from 35% to 70%.

DNA amplification and genotyping

To optimize PCR at various annealing temperatures, we evaluated each primer pair using a gradient PCR procedure. All primer pairs were tested for PCR amplification on DNA extracted from each species, i.e., two individuals of each 17 taxa. The protocol was executed at 94°C for 5 min, followed by 30 cycles of 94°C for 30 s, 48–65°C for 30 s, 72°C for 30 s, and a final extension of 72°C for 10 minutes with the LabnetMultiGene 96-well Gradient Thermal Cycler (Labnet, Edison, NJ, USA). PCR products were checked by 10% PAGE electrophoresis to separate the target DNA bands and which were following confirmed based on cloning and sequencing. These SSR primer pairs with confirmed target DNA bands were chosen for polymorphism evaluation. To investigate genetic polymorphisms, 20 individuals from each of four taxa were selected (Table 1). PCR reaction cocktail contained 20 ng template DNA, 0.2 μM each of forward and reverse primers, 2 μL 10 × PCR reaction buffer, 2 mM dNTP mix, 2 mM MgCl2, 0.5 U Taq DNA polymerase (Promega), plus adding sterile water to total volume to 20 μL. PCR amplifications were executed by a Labnet MultiGene 96-well Gradient Thermal Cycler (Labnet). The PCR protocol was piloted at 94°C for 5 min, followed by 30 cycles of 94°C for 30 s, at the optimal annealing temperature (Ta) for 30 s, 72°C for 30 s, and a final extension of 72°C for 10 minutes (Chiang et al. [2012]). PCR products were separated by electrophoresis on a 10% polyacrylamide gel (acrylamide: bisacrylamide 29: 1, 80 V for 14–16 hours) and determined the allele size by a 25 or 50 bp DNA Step Ladder (Promega). The bands of amplicons were then imaged under UV light using the Flo Gel FGIS-3 fluorescent gel image system (Top BIO Co., Taipei, Taiwan), and the sizes of bands were estimated using Quantity One software version 4.62 (Bio-Rad Laboratories, Hercules, California, USA).

Genetic variation analysis

Several genetic variation parameters were calculated using GenAlEx version 6.5 (Peakall and Smouse [2012]), including the number of alleles (Na), the number of effective alleles (Ne), the observed and expected heterozygosity (Ho and He), Shannon’s information index (H), fixation index (F). Hardy–Weinberg equilibrium (H) was evaluated using Arlequin software version 3.5.1.2 (Excoffier and Lischer [2010]).

Results and discussion

Enrichment microsatellite library and sequencing results

We sequenced 1047 positive plasmids from eight microsatellite enrich libraries and confirmed 257 microsatellite loci from SSR enrich library (Table 2). Among the derived repeats of microsatellite loci, the di-, tri-, tetra-, penta-, and hexanucleotide motif was existed in 106 (41.25%), 120 (46.69%), 9 (3.05%), 11 (4.28%) and 9 (1.67%) loci, respectively (Table 2). Di- (41.25%) and trinucleotide repeats (46.69%) comprised the largest group of repeat motifs and accounted for more than four-fifths of the total SSR content, while the rest amounted to less than 12.06%. Generally, di- and trinucleotide repeats overstepped other types of repeats in all the species and mostly contributed to the major fraction of SSRs (Wei et al. [2014]). Among the repeat motifs within G. flavilabella, di- and trinucleotide repeats were the commonest motifs, representing for 87.94%, similar to Sesamum indicum (Wei et al. [2014]), Arabidopsis thaliana, Sorghum bicolor (Sonah et al. [2011]), and Brassica napus (Cheng et al. [2009]).
Table 2

Summary of different SSR repeat motif types related to variation of repeat unit numbers in 257 SSR loci selected by the length of repeat motif more than 20 bps

No. of repeat unitsDi-Tri-Tetra-Penta-Hexa-MixTotal
4113810023
50501006
62400107
75400009
84300007
93400007
1064002012
112400006
123300208
≥1380761942172
Total10612091192257
Summary of different SSR repeat motif types related to variation of repeat unit numbers in 257 SSR loci selected by the length of repeat motif more than 20 bps

Development of microsatellite markers

Totally, we designed 144 microsatellite primer pairs based on the flanking sequences from 257 microsatellite loci. All primer pairs were screened using a gradient PCR protocol with a Labnet MultiGeneTM 96-well Gradient Thermal Cycler (Labnet) to find the best annealing temperature. Finally, 28 primer pairs showed desired DNA bands and were selected for future diversity evaluation. The characteristics of 28 microsatellite loci are listed in Table 3. Of the 28 loci, 26 are complete microsatellite loci, including 13 carrying a dinucleotide motif, 11 with a trinucleotide motif, 1 with a pentanucleotide motif, and 1 with a hexanucleotide motif, and 2 remaining loci are carried a compound motif. The sequences of 28 loci reported in this paper are available from GenBank (accession numbers: LK934509–LK934536) (Table 3).
Table 3

Summary of general information for the 28 microsatellite loci isolated from

LocusRepeat motifPrimer sequence (5′-3′)Allele size (bps)Ta(°C)Genbank accession no.
GflGelGjaGco
CT3-32(GGA)9F: TAACGGGGAATGGGGAGGCG137–14652-54-LK934509
R: TTGCGATCCCTCCCCTGTAC
CT6-4(GA)29F: CAAGAATAGGTGCCAACCTC110–15155---LK934510
R: GTGAGTTACTAGCGTGCGGC
CT6-35(TG)84F: GTCTGTTCCATTTGATATTG250–25255--50LK934511
R: GCAGTAATGACCTTTGTAGT
CT6-65(TGT)36F: CACCGAGCTTTTTGTCAATG247–2625552-51LK934512
R: GCAATAACAATAGTAGCAGC
CT6-90(TTG)7F: CAACCAAGACAAGACTCATG13255555255LK934513
R: ACATTCTTCCCTGGATGTTC
CT6-99(CAA)7F: GGCATTATCCTGTTATACTC1385550-55LK934514
R: GGGCTTTCATTTGATCATGC
CT6-120(CACAG)38F: TAGCAGCCATAAGTAAAGCC31655---LK934515
R: GTCGAGGATCAAATGAATTG
CT6-142(AAC)7F: GTCATGCACATTCTTCCCTG128–1315555-55LK934516
R: AGACTCATGTTGTTGATCCC
CT-ACT-74(AG)29F: GAGGTCCAATCTAAGATTTC122–15654---LK934517
R: CATGATATAATTCTCACCCC
CT-ACT-88(TGA)9F: TAGTGGATTTGGAGTTTGAG10154--51LK934518
R: CTCATCTTTGATACCTCTTC
CT-ACT-136(CT)12F: ATTTAGGGTCATCGAGCACC140–14254555554LK934519
R: TCGGCAAGGTGTCAAGACTC
CT-AG-35(GA)12F: TCTTCCCGCACCTCTTCAAC133–13752555555LK934520
R: TTCAGAAGCATGGCACTGGG
CT-AG-45(CTT)12F: CAGAAGCCAACATATCCATC115–1215054-52LK934521
R: TCTGAAATTTAGTGTAGCGG
CT-AG-55(TGCCTC)5F: GTGGGGAGATTACTATTACG108–1105050-55LK934522
R: AAGGAAAGGCGTAAGGATAG
CT-AG-85(TG)9 (AG)28F: CCCATATGTCCTTGGTCATC208–24854---LK934523
R: GCTTACAACTTTCTCCCTTC
CT-AG-88(AG)15F: ACAACCTACACTGTCTAAAG1525554-55LK934524
R: CTTTTTTTGTGTGGTCACCG
CT-AG-114(TG)13F: AGTGATATGATAACACCCTC10450---LK934525
R: TAGATCTCTAGCTTCAACTC
CT-AG-127(TC)9F: AAGCTTCGCTGCCCTCTTCG117–12354---LK934526
R: TTGGTTTCGGGCCAGAGCTG
CT-AG-140(AG)15F: AGTCCTGCCTTCAAGCCTTG120–12654555555LK934527
R: GAAGGATTCAAGCATGGGAG
CT-AG-144(AG)18F: GGCGATGTCAATTCAACAAG113–11552555555LK934528
R: TAACGATAGCTGCCTTCCAC
CT-AG-145(TC)14 (ACTC)3F: ATCTTCGTACATCTAACCCG14054--55LK934529
R: AATGAGCTCGTTGCAGCTTC
CT-AG-157(TG)14F: TGCAGTAATAGCATTTGCAG1205655-55LK934530
R: AGGCTGCCACTGTACTTTTC
CT-AGAT-19(TC)19F: TACATTGATTAGGATGCCTC1695550-50LK934531
R: ACATTTGTGCCTCCTCCAAC
CT-AGAT-26(TG)88F: GAATGATGCTATGTGTGCTG29555---LK934532
R: TGCAGTAATAGCATTTGCAG
CT-AGAT-131(CCA)7F: TTCAATCGCTAGTAGCTCTG13955--50LK934533
R: GTTGACATTTAGTGGAGAGG
CT-CCA-71(TGG)14F: ACATGAGTAGGAGCATCCTC150–15650--50LK934534
R: TTTCTCTTCCCCACAGCTGC
CT-CCA-108(CCA)127F: CATGGTGGGACATAAAACTG489–51647---LK934535
R: GTGGTTGTAGTCATCACTCC
CT-CCA-137(CCA)6F: AATCTCAGAGCCTTTCCCAG15055--55LK934536
R: TTGGAGGTTGCTTGTAGAGC

Note: F = the forward primer; R = the reverse primer; T a = optimized annealing temperature.

Summary of general information for the 28 microsatellite loci isolated from Note: F = the forward primer; R = the reverse primer; T a = optimized annealing temperature.

Genotyping and population genetics analysis

To inspect the level of genetic polymorphism at each locus, 20 individuals were collected in the field from the remaining wild population of G. flabilabella (Table 1). All the 28 new microsatellite loci identified in G. flabilabella were successfully amplified. Of the 28 loci, 12 microsatellite loci were monomorphic and 16 were polymorphic (Table 4). Genetic variation indices for 16 polymorphic loci, including the number of alleles (Na), the number of effective alleles (Ne), the observed and expected heterozygosity (Ho and He), Shannon’s information index (H) and fixation index (F), were estimated. Ne represents here an estimate of the number of equally frequent alleles in a model population following the formula of Ne = 1/ (1- He). As shown in Table 4, Na ranged from 2 to 15, Ne varied from 1.08 to 8.85, Ho ranged from 0 to 1.00 and mean was 0.163, and He varied from 0.08 to 0.89 and mean was 0.444. The Shannon’s information index (H) and fixation index (F) ranged from 0.17 to 2.41 and from -1.00 to 1.00, and the mean was 0.882 and 0.697, respectively. Significant deviations from Hardy–Weinberg equilibrium (H) were detected at all loci (Table 4).
Table 4

Genetic diversity characteristics of the 28 microsatellite loci tested on four taxa

Gastrodia flavilabella Gastrodia elata Gastrodia javanica Gastrodia confusoides
Locus Na Ne Ho He H F IS Na Ne Ho He H F IS Na Ne Ho He H F IS Na Ne Ho He H F IS
CT3-3241.230.000.19*0.4311.00
CT6-4158.850.100.89*2.410.887
CT6-3521.080.000.08*0.171.000
CT6- 6552.940.320.66*1.230.51511.0021.060.060.060.13-0.030
CT6-9011.0011.0011.0011.00
CT6-9911.0011.0011.00
CT6-12011.00
CT6-14221.040.000.04*0.101.00011.0011.00
CT-ACT-74104.030.160.75*1.800.783
CT-ACT-8811.00
CT-ACT-13622.001.000.50*0.69-1.00011.0022.001.000.50*0.69-1.00011.00
CT-AG-3532.560.000.61*1.001.00074.370.050.77*1.640.93521.110.110.100.21-0.05621.110.000.10*0.201.000
CT-AG-4531.090.000.08*0.201.00011.0011.00
CT-AG-5521.950.000.49*0.681.00011.0022.001.000.50*0.69-1.000
CT-AG-8583.970.020.75*1.620.97253.861.000.74*1.43-0.349
CT-AG-8811.0074.351.000.77*1.64-0.299
CT-AG-11411.00
CT-AG-12731.140.000.12*0.281.000
CT-AG-14042.340.000.57*0.971.00041.490.000.33*0.691.00011.0011.00
CT-AG-14421.170.000.15*0.281.00011.0011.0011.00
CT-AG-14511.0011.00
CT-AG-15711.0011.0011.0011.00
CT-AGAT-1911.0022.001.000.50*0.69-1.00022.001.000.50*0.69-1.000
CT-AGAT-2611.00
CT-AGAT-13111.0011.00
CT-CCA-7122.001.000.50*0.69-1.00011.00
CT-CCA-10873.710.000.73*1.571.000
CT-CCA-13711.0011.00
Mean3.0711.8960.1630.4440.8820.6972.0771.4800.5130.5851.1130.1471.2861.1590.5550.3000.450-0.5281.5881.3240.6120.3860.67-0.266

The number of different alleles (Na), number of effective alleles (Ne), observed heterozygosity (H), expected heterozygosity (He), Shannon’s information index (H), and fixation index (F) are reported.

*Significant deviation from Hardy-Weinberg equilibrium: P < 0.05.

Genetic diversity characteristics of the 28 microsatellite loci tested on four taxa The number of different alleles (Na), number of effective alleles (Ne), observed heterozygosity (H), expected heterozygosity (He), Shannon’s information index (H), and fixation index (F) are reported. *Significant deviation from Hardy-Weinberg equilibrium: P < 0.05. To test the transferability and genetic diversity, 20 individuals from each of three taxa, including G. elata, G. javanica, and G. confusoides, were tested. Of the 28 loci, 13, 7, and 17 markers worked in G. elata, G. javanica, and G. confusoides, respectively. Of the 13, 7, and 17 microsatellite loci, 9, 5, and 12 were monomorphic and 4, 2, and 5 were polymorphic (Table 4). In addition, three loci, including CT6-90, CT6-99, and CT-AG-157, are monomorphic within each of four species, but polymorphic between species. As shown in Table 4, the ranges for the Na, Ne, Ho and He were varied from 1 to 7, 1.00 to 4.37, 0.00 to 1.00, and 0.33 to 0.77 in G. elata, 1 to 2, 1.00 to 2.00, 0.11 to 1.00, and 0.10 to 0.50 in G. javanica, and 1 to 7, 1.00 to 4.35, 0.00 to 1.00, and 0.06 to0.77 in G. confusoides. The Shannon’s information index (H) and fixation index (F) ranged from 0.69 to 1.64 and from -1.00 to 1.00, and the mean was 1.113 and 0.147 in G. elata, from 0.21 to 0.69 and from -1.00 to -0.056, and the mean was 0.450 and -0.528 in G. javanica, and from 0.13 to 1.64 and from -1.00 to -0.056, and the mean was 0.670 and -0.266 in G. javanica. Significant deviations from Hardy–Weinberg equilibrium (H) were detected at 4 of 4, 1 of 2, and 4 of 5 polymorphic loci (Table 4). For orchids, only few researches were used simple sequence repeats to evaluate the genetic diversity. The genetic diversity, including the means of the observed (Ho) and expected heterozygosity (He) (Table 4), of G. flabilabella was low compared with that of other Orchidaceae species, such as Dendrobium huoshanense (0.512 and 0.569) (Wang et al. [2012b]), Dendrobium officinale (0.720 and 0.740) (Xie et al. [2010]), Dendrobium officinale (0.514 for Ho) (Lu et al. [2012]), and Dendrobium nobile (0.350 and 0.608) (Lu et al. [2014]). Unfortunately, no data for any Gastrodia taxa or mycoheterotrophic orchids are available for the comparison of genetic variability. However, the low observed and expected heterozygosity values implied that rare and mycoheterotrophic taxa tend to possess low levels of genetic diversity due to stochastic losses of genetic polymorphisms resulting from genetic drift (cf. Ge et al. [2014]). In addition, significant deviations from Hardy–Weinberg equilibrium (H) were detected at all loci in the remained population, and these deviations were credited to the heterozygote deficiency likely due to the unique interactions between orchids and pollinators (Boberg et al. [2014]). Besides, the habitat preferences (Mallet et al. [2014]) strengthened the isolation among populations.

Test the transferability

To test the transferability of these microsatellite loci, we tested the primers in 13 other Gastrodia taxa (Table 1). Two individuals of each taxon were used in the evaluation of cross-amplification. Of the 28 loci,11 to 17 loci were transferable to each of the 13 taxa of Gastrodia (Table 5), and the annealing temperatures are listed on Table 3. Three loci, including CT-ACT-136, CT-AG-88, and CT-AG-144, were transferable, and four loci, including CT6-4, CT6-35, CT-AG-85, and CT-AG-114, did not work in all taxa (Table 5). In addition, 13 of 28 loci successfully amplifying more than 10 taxa will be useful across species. Nonetheless, population genetics, phylogeographic patterns, and process of speciation among the Gastrodia taxa remain unclear. The primer set of these 13 microsatellite markers with high transferability represents a useful tool of genetic markers for interspecific researches.
Table 5

Result of cross-species transferability in 13 taxa using the 28 microsatellite primers developed from

GalGapGauGclGfoGgrGleGnaGniGpuGshGthGurTotal
Locus(N = 2)(N = 2)(N = 2)(N = 2)(N = 2)(N = 2)(N = 2)(N = 2)(N = 2)(N = 2)(N = 2)(N = 2)(N = 2)Species
CT3-321113
CT6-40
CT6-350
CT6- 65111111111110
CT6-90111111111110
CT6-9911111111111112
CT6-12011
CT6-14211111111111112
CT-ACT-7411114
CT-ACT-88111115
CT-ACT-136111111111111113
CT-AG-351111121111111
CT-AG-45111111118
CT-AG-5511111111111112
CT-AG-850
CT-AG-88111211111111113
CT-AG-1140
CT-AG-12711
CT-AG-14011111111111112
CT-AG-144111111111111113
CT-AG-14511111111111112
CT-AG-1571111111111111
CT-AGAT-19111115
CT-AGAT-26112
CT-AGAT-13111114
CT-CCA-7111114
CT-CCA-10811
CT-CCA-137111111111110
No. of loci14111717161212151715171511

For loci that were successfully amplified, the number of alleles is given.

Result of cross-species transferability in 13 taxa using the 28 microsatellite primers developed from For loci that were successfully amplified, the number of alleles is given.

Conclusions

For conservation purposes, 28 new microsatellite loci, including 12 monomorphic and 16 polymorphic loci, were isolated from G. flabilabella. The genetic diversity indices assessed using these 16 polymorphic microsatellite loci for the remained populations of this endemic and vulnerable species revealed that these markers are potentially useful for future studies, especially those focusing on evaluating the genetic variation and identifying distinct evolutionary units within populations for conservation management. Genetic diversity was characterized for three other related species using these 28 microsatellite markers. Furthermore, successful amplification in 13 other Gastrodia taxa indicated the transferability of these primer pairs. The interspecies transferability made these microsatellite loci useful for future research aiming to reconstruct the phylogeographic patterns and the process of speciation among closely related species. Additionally, the transferable microsatellite loci will be potentially useful for future studies that focus on establishing the standard operating system of molecular identification for Gastrodia elata, a traditional Chinese medicine.
  21 in total

1.  Tandem repeats finder: a program to analyze DNA sequences.

Authors:  G Benson
Journal:  Nucleic Acids Res       Date:  1999-01-15       Impact factor: 16.971

2.  Isolation and characterization of novel EST-SSRs in the showy dendrobium, Dendrobium nobile (Orchidaceae).

Authors:  J J Lu; J Y Kang; S R Ye; H Z Wang
Journal:  Genet Mol Res       Date:  2014-02-19

3.  Development and characterization of 110 novel EST-SSR markers for Dendrobium officinale (Orchidaceae).

Authors:  Jiang-Jie Lu; Na-Na Suo; Xu Hu; Shang Wang; Jun-Jun Liu; Hui-Zhong Wang
Journal:  Am J Bot       Date:  2012-10-01       Impact factor: 3.844

4.  Isolation and identification of succinic semialdehyde dehydrogenase inhibitory compound from the rhizome of Gastrodia elata Blume.

Authors:  N I Baek; S Y Choi; J K Park; S W Cho; E M Ahn; S G Jeon; B R Lee; J H Bahn; Y K Kim; I H Shon
Journal:  Arch Pharm Res       Date:  1999-04       Impact factor: 4.946

5.  Pollinator shifts and the evolution of spur length in the moth-pollinated orchid Platanthera bifolia.

Authors:  Elin Boberg; Ronny Alexandersson; Magdalena Jonsson; Johanne Maad; Jon Ågren; L Anders Nilsson
Journal:  Ann Bot       Date:  2013-10-29       Impact factor: 4.357

6.  Development and genetic mapping of microsatellite markers from genome survey sequences in Brassica napus.

Authors:  Xiaomao Cheng; Jinsong Xu; Shu Xia; Jianxun Gu; Yuan Yang; Jie Fu; Xiaoju Qian; Shunchang Zhang; Jiangsheng Wu; Kede Liu
Journal:  Theor Appl Genet       Date:  2009-02-04       Impact factor: 5.699

7.  GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research--an update.

Authors:  Rod Peakall; Peter E Smouse
Journal:  Bioinformatics       Date:  2012-07-20       Impact factor: 6.937

8.  Genome-wide distribution and organization of microsatellites in plants: an insight into marker development in Brachypodium.

Authors:  Humira Sonah; Rupesh K Deshmukh; Anshul Sharma; Vinay P Singh; Deepak K Gupta; Raju N Gacche; Jai C Rana; Nagendra K Singh; Tilak R Sharma
Journal:  PLoS One       Date:  2011-06-21       Impact factor: 3.240

9.  Development and characterization of 16 polymorphic microsatellite markers from Taiwan cow-tail fir, Keteleeria davidiana var. formosana (Pinaceae) and cross-species amplification in other Keteleeria taxa.

Authors:  Chin-Shang Ho; Huei-Chuan Shih; Ho-Yih Liu; Shau-Ting Chiu; Mei-Hui Chen; Li-Ping Ju; Ya-Zhu Ko; Yu-Shen Shih; Chaur-Tzuhn Chen; Tsai-Wen Hsu; Yu-Chung Chiang
Journal:  BMC Res Notes       Date:  2014-04-23

10.  Inferring multiple refugia and phylogeographical patterns in Pinus massoniana based on nucleotide sequence variation and DNA fingerprinting.

Authors:  Xue-Jun Ge; Tsai-Wen Hsu; Kuo-Hsiang Hung; Chung-Jian Lin; Chi-Chung Huang; Chao-Ching Huang; Yu-Chung Chiang; Tzen-Yuh Chiang
Journal:  PLoS One       Date:  2012-08-29       Impact factor: 3.240

View more
  4 in total

1.  Screening transferable microsatellite markers across genus Phalaenopsis (Orchidaceae).

Authors:  Ya-Zhu Ko; Huei-Chuan Shih; Chi-Chu Tsai; Hsing-Hua Ho; Pei-Chun Liao; Yu-Chung Chiang
Journal:  Bot Stud       Date:  2017-11-15       Impact factor: 2.787

2.  Reproductive development and genetic structure of the mycoheterotrophic orchid Pogoniopsis schenckii Cogn.

Authors:  Mariana Ferreira Alves; Fabio Pinheiro; Carlos Eduardo Pereira Nunes; Francisco Prosdocimi; Deise Schroder Sarzi; Carolina Furtado; Juliana Lischka Sampaio Mayer
Journal:  BMC Plant Biol       Date:  2021-07-12       Impact factor: 4.215

3.  RNA-Seq SSRs of Moth Orchid and Screening for Molecular Markers across Genus Phalaenopsis (Orchidaceae).

Authors:  Chi-Chu Tsai; Huei-Chuan Shih; Hao-Ven Wang; Yu-Shium Lin; Chia-Hung Chang; Yu-Chung Chiang; Chang-Hung Chou
Journal:  PLoS One       Date:  2015-11-02       Impact factor: 3.240

4.  Complete Chloroplast Genome of Paphiopedilum delenatii and Phylogenetic Relationships among Orchidaceae.

Authors:  Huyen-Trang Vu; Ngan Tran; Thanh-Diem Nguyen; Quoc-Luan Vu; My-Huyen Bui; Minh-Tri Le; Ly Le
Journal:  Plants (Basel)       Date:  2020-01-02
  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.