Warning: Undefined array key "mm" in /www/wwwroot/www.ai-bt.com/si.php on line 10 Deprecated: trim(): Passing null to parameter #1 ($string) of type string is deprecated in /www/wwwroot/www.ai-bt.com/si.php on line 10 5'-Terminal chemical capping of spliced leader RNAs.

Literature DB >> 23175583

5'-Terminal chemical capping of spliced leader RNAs.

Karolina Piecyk¹, Richard E Davis, Marzena Jankowska-Anyszka.

Abstract

Spliced leader (SL) RNA trans-splicing adds a 2,2,7-trimethylguanosine cap (TMG) and a 22-nucleotide sequence, the SL, to the 5' end of mRNAs. Both non-trans-spliced with a monomethylguanosine cap (MMG) and trans-spliced mRNAs co-exist in trans-splicing metazoan cells. Efficient translation of TMG-capped mRNAs in nematodes requires a defined core of nucleotides within the SL sequence. Here we present a chemical procedure for the preparation and purification of 5'-terminal capped MMG and TMG wild-type, and mutant 22 nt spliced leader RNAs (GGU/ACUUAAUUACCCAAGUUUGAG) with or without a 3' biotin tag.

Entities: Chemical Species

Year: 2012 PMID： 23175583 PMCID： PMC3501006 DOI： 10.1016/j.tetlet.2012.06.127

Source DB: PubMed Journal: Tetrahedron Lett ISSN： 0040-4039 Impact factor: 2.415

17 in total

1. A semiflexible polymer model applied to loop formation in DNA hairpins.

Authors: S V Kuznetsov; Y Shen; A S Benight; A Ansari
Journal: Biophys J Date: 2001-11 Impact factor: 4.033

2. Synthesis of 5' cap-0 and cap-1 RNAs using solid-phase chemistry coupled with enzymatic methylation by human (guanine-N⁷)-methyl transferase.

Authors: Yann Thillier; Etienne Decroly; François Morvan; Bruno Canard; Jean-Jacques Vasseur; Françoise Debart
Journal: RNA Date: 2012-02-14 Impact factor: 4.942

3. A novel approach to solid phase chemical synthesis of oligonucleotide mRNA cap analogs.

Authors: Jacek Jemielity; Petri Heinonen; Harri Lonnberg; Edward Darzynkiewicz
Journal: Nucleosides Nucleotides Nucleic Acids Date: 2005 Impact factor: 1.381

4. Chemical Synthesis of a 5'-Terminal TMG-Capped Triribonucleotide m(3)(2,2,7)G(5)(')pppAmpUmpA of U1 RNA.

Authors: Mitsuo Sekine; Michinori Kadokura; Takahiko Satoh; Kohji Seio; Takeshi Wada; Utz Fischer; Vicki Sumpter; Reinhard Lührmann
Journal: J Org Chem Date: 1996-06-26 Impact factor: 4.354

5. Comparison of A+T-rich oligonucleotides with and without self-complementary sequence using ion-pair reversed-phase high-performance liquid chromatography/tandem electrospray ionization mass spectrometry.

Authors: Renfang Song; Wenbing Zhang; Huayong Chen; Huimin Ma; Yulian Dong; Guoying Sheng; Zhen Zhou; Jiamo Fu
Journal: Eur J Mass Spectrom (Chichester) Date: 2005 Impact factor: 1.067

6. Efficient solid-phase synthesis of oligodeoxynucleotides having a 5'-terminal 2,2,7-trimethylguanosine pyrophosphate linkage.

Authors: Akihiro Ohkubo; Kenji Sasaki; Yasuhiro Noma; Hirosuke Tsunoda; Kohji Seio; Mitsuo Sekine
Journal: Bioorg Med Chem Date: 2009-05-12 Impact factor: 3.641

5'-Terminal chemical capping of spliced leader RNAs.

1. A semiflexible polymer model applied to loop formation in DNA hairpins.

2. Synthesis of 5' cap-0 and cap-1 RNAs using solid-phase chemistry coupled with enzymatic methylation by human (guanine-N⁷)-methyl transferase.

3. A novel approach to solid phase chemical synthesis of oligonucleotide mRNA cap analogs.

4. Chemical Synthesis of a 5'-Terminal TMG-Capped Triribonucleotide m(3)(2,2,7)G(5)(')pppAmpUmpA of U1 RNA.

5. Comparison of A+T-rich oligonucleotides with and without self-complementary sequence using ion-pair reversed-phase high-performance liquid chromatography/tandem electrospray ionization mass spectrometry.

6. Efficient solid-phase synthesis of oligodeoxynucleotides having a 5'-terminal 2,2,7-trimethylguanosine pyrophosphate linkage.

7. Ion-pair reversed-phase high-performance liquid chromatography analysis of oligonucleotides: retention prediction.

8. In vivo translation and stability of trans-spliced mRNAs in nematode embryos.

9. Transcription and cap trimethylation of a nematode spliced leader RNA in a cell-free system.

10. The C. elegans trans-spliced leader RNA is bound to Sm and has a trimethylguanosine cap.

Review 1. Applications of Phosphate Modification and Labeling to Study (m)RNA Caps.