| Literature DB >> 23119163 |
Beatriz Alvarez-Castelao1, Carmen Ruiz-Rivas, José G Castaño.
Abstract
Protein homeostasis, proteostasis, is essential to understand cell function. Protein degradation is a crucial component of the proteostatic mechanisms of the cell. Experiments on protein degradation are nowadays present in many investigations in the field of molecular and cell biology. In the present paper, we focus on the different experimental approaches to study protein degradation and present a critical appraisal of the results derived from steady-state and kinetic experiments using detection of unlabelled and labelled protein methodologies with a proteostatic perspective. This perspective allows pinpointing the limitations in interpretation of results and the need of further experiments and/or controls to establish "definitive evidence" for the role of protein degradation in the proteostasis of a given protein or the entire proteome. We also provide a spreadsheet for simple calculations of mRNA and protein decays for mimicking different experimental conditions and a checklist for the analysis of experiments dealing with protein degradation studies that may be useful for researchers interested in the area of protein turnover.Entities:
Year: 2012 PMID: 23119163 PMCID: PMC3483835 DOI: 10.1155/2012/823597
Source DB: PubMed Journal: Biochem Res Int
Figure 1Schematic diagram of cell proteostasis. The boxes illustrate the different cellular process involved in protein homeostasis. BOX 1, nucleus, where gene transcription and pre-mRNA processing produce the mature mRNA that will be transported to the cytoplasm where it could be degraded (mRNA decay can also take place in the nucleus). The mRNA is engaged, mainly in the cytoplasm, to translation by the ribosomal machinery producing a nascent polypeptide that grows to a newly synthesized protein (BOX 2). The folding of the newly synthesized proteins, helped by chaperones, results in the “so-called” native protein structure either monomeric or oligomeric (BOX 3, only a dimer is shown for simplicity). Both the newly synthesized proteins and the mature mono or oligomeric forms of proteins are subjected to post-translational modification (PTM) and specific and unspecific protein-protein interactions (PPIs) that are illustrated in BOX 4. Proteins due to changes in its native conformation produced by different physical and/or chemical perturbations of the cell, or by mutations, could get misfolded or misprocessed and misfolded. The misfolded proteins, perhaps under the influence of PPIs and PTMs, will produce protein aggregates or soluble oligomeric protofibrils that eventually may form amyloid fibers (BOX 5). The degradation of proteins (BOX 6) is mainly due to the ubiquitin-proteasome System (UPS, nucleus and cytoplasm, 20S, and 26S proteasome) and the autophagic pathways (cytoplasmic): mainly chaperone-mediated authopagy (CMA) and macroautophagy (autophagy). Other proteases also participate in protein degradation (calpains, caspases, etc.), not shown. Blue lines connect all the boxes to the central circular box of protein degradation (BOX 6) indicating that proteolysis can regulate any of the process and vice versa. Black arrows connecting boxes indicate the “flow” of the products depicted in each BOX.
Figure 2Degradation of untagged and N-terminus and C-terminus tagged versions of human DJ-1 L166P. The untagged human DJ-1 L166P (hDJ-1 L166P) construct has been described previously [49]. The C-terminal His-V5 tagged hDJ-1 L166P was obtained by PCR amplification with the following oligonucleotides (forward BamH1-DJ-1; 5′GGAAGGATCCATGGCTTCCAAAAGAGCTCTGG 3′ and reverse Nonstop-hDJ-1; 5′GTCTTTAAGAACAAGTGGCGCCTTCACTTGAGC 3′) and cloned into pcDNA 3.1/V5-His Topo vector from Invitrogen The N-terminal 3xFlag- tagged hDJ-1 L166P was obtained by PCR amplification with the following oligonucleotides (forward BamH1-hDJ-1 and reverse XhoI-hDJ-1 5′GCGCCTCGAGCTAGTCTTTAAGAACAAGTGGAGCC 3′) and cloned into the pCMV-3Tag 1-A vector. N2a cells were cultured in DMEM medium with 10% FBS and transiently transfected with the different hDJ-1 L166P constructs. Transfected cells were treated with cycloheximide (20 μg/mL) for the times indicated and analyzed by Western immunoblotting with anti-hDJ-1specific antibodies, as described in [49]. Results presented are expressed as mean ± s.e.m for at least three independent experiments.
| Type of study | Conclusion | ||
|---|---|---|---|
| 1 | □ | Untagged protein | Good approach |
| 2 | □ | Tagged protein | Not a good approach |
| 3 | □ | Usual steady state | Partial evidence |
| 4 | □ | Kinetic (time-course) | Partial evidence |
| 5 | □ | Protein synthesis inhibitor | Partial evidence for pre-existing proteins in the cell |
| 6 | □ | Radioactive pulse-chase experiment | Partial evidence for newly synthesized proteins |
| 7 | □ | Inhibitors of protein degradation | Partial evidence |
| 8 | □ | Tet-on Tet-off, RNA interference | Partial evidence |
| 9 | □ | SILAC-MS steady-state experiments under basal conditions (turn-over) | Good evidence |
| 10 | □ | SILAC-MS upon cell stimulus or stress | Partial evidence |