Species boundaries and host range of tortoise mites (Uropodoidea) phoretic on bark beetles (Scolytinae), using morphometric and molecular markers.

Understanding the ecology and evolutionary history of symbionts and their hosts requires accurate taxonomic knowledge, including clear species boundaries and phylogenies. Tortoise mites (Mesostigmata: Uropodoidea) are among the most diverse arthropod associates of bark beetles (Curculionidae: Scolytinae), but their taxonomy and host associations are largely unstudied. We tested the hypotheses that (1) morphologically defined species are supported by molecular data, and that (2) bark beetle uropodoids with a broad host range comprise cryptic species. To do so, we assessed the species boundaries of uropodoid mites collected from 51 host species, across 11 countries and 103 sites, using morphometric data as well as partial cytochrome oxidase I (COI) and nuclear large subunit ribosomal DNA (28S). Overall, morphologically defined species were confirmed by molecular datasets, with a few exceptions. Twenty-nine of the 36 uropodoid species (Trichouropoda, Nenteria and Uroobovella) collected in this study had narrow host ranges, while seven species had putative broad host ranges. In all but one species, U. orri, our data supported the existence of these host generalists, which contrasts with the typical finding that widespread generalists are actually complexes of cryptic specialists.

Introduction

Increased access to nucleotide sequencing over the last twenty years has led to exponential growth of molecular-based taxonomy [1]. Modern molecular techniques provide powerful tools to assess species boundaries, and cryptic species (species distinguishable by no or overlooked subtle morphological differences) are being discovered increasingly in a wide range of invertebrate groups [2]–[4]. Species boundaries of symbionts are frequently assessed using molecular markers, and it is often revealed that an apparent widespread host generalist is not a generalist, but rather a complex of cryptic species with narrower host ranges. For instance, Ixodes uriae (Ixodidae) was previously considered to be a host generalist, but microsatellite analysis showed strong genetic divergence across host species, suggesting that I. uriae represents multiple host races with relatively narrower host ranges [5], [6]. Morphological and molecular analyses of Uroobovella nova (Urodinychidae), a single widespread putative generalist uropodoid species collected from silphid beetles worldwide, is actually a complex of cryptic species with varying degrees of host specificity [7].

Bark beetles (Curculionidae: Scolytinae) are a prominent group of wood-borers that feed and mate in the cambium or xylem of numerous tree species worldwide [8]. Mites are one of the most common and diverse associates of scolytines. For instance, 97 species of mites representing 65 genera and 40 families have been collected from under the bark of scolytine infested pine trees [9]. Many or most of these mites reside, feed and reproduce in the galleries of bark beetles, and they attach to dispersing scolytines, hitching a ride to new host trees or coarse woody debris, which would otherwise be difficult to access for most free-living mites.

Uropodoids (Acari: Mesostigmata), or tortoise mites, are among the most frequently collected mite associates of bark beetles, and include three genera Trichouropoda, Nenteria (Trematuridae) and Uroobovella (Urodinychidae). Scolytine-associated uropodoids are often found at a relatively high prevalence (e.g. up to 36% of 8475 beetles had mites in Louisiana; [10]. The superfamily Uropodoidea is represented by over 2,000 described species worldwide, many of which occur in patchy habitats such as nests, woody debris, and dung [11]. Phoresy is therefore a prerequisite for dispersal between such patchy habitats, and deutonymphal uropodoids glue themselves to their host with an anally secreted pedicel. The feeding habits of uropodoids are poorly known but typically they are considered to be omnivorous, feeding on fungal hyphae, slow moving prey, or small particulate matter [12]. The deutonymphs of some species associated with scolytines have been reported as feeding on nematodes and or fungi [13], [14], as well as the eggs and larvae of their bark beetle hosts [15], [16].

Many acarological studies have used mitochondrial cytochrome oxidase I (COI) and nuclear large subunit ribosomal DNA (28S), either alone or combined with other markers, to elucidate species boundaries, uncover cryptic species, and assess phylogenetic relationships of mites [17]–[22]. In this study, we employed morphological and molecular markers (COI and 28S D2–D4) to explore the species boundaries of bark beetle-associated uropodoids and to assess whether morphological species concepts are supported by molecular data. Additionally, we tested whether generalists are truly single species with broad host preferences or instead complexes of cryptic species with narrower host ranges, using quantitative morphological and molecular analyses.

Materials and Methods

Biological Material

Bark beetle specimens were collected across 11 countries and 103 sites, with the majority of sites in Canada and the USA. Canadian specimens were collected in Ontario by W.K. and in various provinces by the Canadian Food Inspection Agency (CFIA) staff as part of the Invasive Alien Species Monitoring program, and examined by W.K. with permission. Specimens from the USA and other countries were collected by A.I.C., and examined by W.K. with permission. All necessary permits and permissions were obtained for the described field studies. Field studies were conducted with a permit to collect in Ontario Provincial Parks issued by Ontario Parks and coordinated by B. Steinberg and B. Crins, as well as permission from private landowners to sample on their property.

In Ontario, bark beetles were collected from mid-April to early August 2009 across four study sites: Algonquin Provincial Park site 1 (45.902, −77.605), Algonquin PP site 2 (45.895, −78.071), one site near Pakenham (45.33, −76.371), and another on Hwy 132 near Dacre (45.369, −76.988). Four Lindgren traps with propylene glycol were placed in each study site. Traps were baited with 95% ethanol and/or α-pinene lures (Synergy Semiochemicals). Traps were emptied every two weeks, trap lures were replaced every eight weeks, and the propylene glycol insecticide was replaced at each visit. Bark beetles were placed individually into 1.5 ml microfuge tubes with 95% ethanol and stored at −20°C. Scolytines were identified to species using keys [8], [23], and tribes were based on the literature [24]. Beetles were examined for uropodoid mites using a dissecting microscope, and all mites found were removed and placed into a 0.5 ml microfuge tube with 95% ethanol and stored at −20°C.

A portion of the bark beetles collected by CFIA staff in 2009 from Canadian provinces, as well as scolytine specimens collected by A.I.C. from USA and several other countries were examined by W.K. for uropodoid mites, and all mites found were removed and stored in 95% ethanol at −80°C. Four species of uropodoids (Uroobovella spp. 1–4) collected from Nicrophorus beetles (Silphidae) in Ontario were used as outgroup specimens. Although the outgroup species are in the same genus as some of the ingroup, the generic position of the outgroup species is contentious, and they are associated with a different family of beetles. Following DNA extraction, mites were recovered from the extraction buffer and slide-mounted in a polyvinyl alcohol medium, and slides were cured on a slide warmer at about 40°C for 3–4 days. Slide-mounted specimens were examined using a compound microscope (Leica DM 5500B or Nikon 80I) and identified to species (or morphospecies) using taxonomically informative morphological characters based on species descriptions from the literature [25]–[30]. Species were identified prior to examining the molecular reconstructions, and in any instances where a conflicting result emerged between the molecular data and morphology-based identifications, both datasets were reexamined. Voucher specimens are deposited in the Canadian National Collection of Insects, Arachnids and Nematodes, in Ottawa, Canada, and the Michigan State University A.J. Cook Arthropod Research Collection, East Lansing, USA.

DNA Extraction, Amplification and Sequencing

Total genomic DNA was extracted from whole specimens for 24 hours using a DNeasy Tissue kit (Qiagen Inc., Santa Clara, CA, USA). Following extraction, mites were removed from the extraction buffer, and genomic DNA was purified following the DNeasy Tissue kit protocol.

PCR amplifications were performed in a total volume of 25 µl, with 13 µl ddH2O, 2.5 µl 10× PCR buffer, 2.5 µl 25 mM MgCl2, 0.5 µl of each 10 µM primer, 0.5 µl 10 mM dNTPs, 0.5 µl Taq DNA polymerase (Promega Corp., Madison, WI, USA), and 5 µl genomic DNA template. In the instances where semi-nested or nested primers were employed, 1 µl of primary PCR product was used as template and the ddH20 was increased to 17 µl. PCR amplification cycles were performed on an Eppendorf ep Gradient S Mastercycler (Eppendorf AG, Hamburg, Germany). Primer pairs LCO1490+ LoDog, and LCO1490+ BB R4 (Table 1), were used to amplify 643 and 603 bp fragments, respectively, of the mitochondrial COI gene. Specimens that did not produce detectable PCR products using either of these primer pairs were reamplified using 1 µl of the primary PCR product and semi-nested, LCO1490+ BB R3Lo, or nested, BB F + BB R3Lo, primer combinations (Table 1), which amplified 592 and 475 bp fragments, respectively. The thermocycler protocol for COI amplification was as follows: initial denaturation cycle at 94°C for 3 min, followed by 40 cycles of 94°C for 45 s, primer annealing at 45°C for 45 s, 72°C for 1 min, and a final extension at 72°C for 5 min. The primer annealing temperature was reduced to 43°C when primer BB R4 was employed.

Table 1

Primer sequences (5′–3′) used to amplify partial COI and 28S D2–D4 sequences from uropodoid mites collected from bark beetles (*primers from this study).

Gene	Primer	Sequence 5′–3′	Reference
COI	LCO1490	GGTCAACAAATCATAAAGATATTGG	51
	BB F	TAATTGGWRATGAYCAAATTTTTAA	*
	BB R2	AATHGTDGTAATAAAATTAATTGA	*
	BB R3Lo	CCTCCTGCTAADACHGG	*
	BB R4	GTATAGTAATRGCTCCTGC	*
	LoDog	GGRTCAAAAAAAGAWGTRTTRAARTTTCG	*
28S	D23F	GAGAGTTCAAGAGTACGTG	52
	28S Fb	GAGTACGTGAAACCGCWTWGA	*
	28Sa	GACCCGTCTTGAAACACGG	53 (modified)
	28S F1	GGCGHAATGAAATGTGAAGG	*
	28S R3	GGCTTCRTCTTGCCCAGGC	*
	28S R4	GGCTTCGTCTTGCCCAGGC	*
	28Sb	CGGAAGGAACCAGCTAC	53 (modified)
	28S R2	CCAGTTCTGCTTACCAAAAATGG	*

Primer pairs D23F +28S R2, and 28S Fb +28S R2 (Table 1), were used to amplify a 990 and 980 bp fragment, respectively, from the 5′ end of the nuclear ribosomal 28S gene, spanning the D2–D4 region. In the instances where neither primer pair produced a detectable PCR product, the specimens were reamplified using 1 µl of the primary PCR product and semi-nested primer pairs, D23F +28Sb or 28S Fb +28Sb, which amplified an 800 and 790 bp fragment of 28S rDNA, respectively (Table 1). The PCR protocol for D23F +28S R2, and D23F +28Sb was as follows: initial denaturation cycle at 95°C for 2 min, followed by 30 cycles of 95°C for 1 min, primer annealing at 44°C for 1.5 min, 72°C for 2 min, and a final extension at 72°C for 10 min. The primer annealing temperature was changed to 56°C for 28S Fb +28S R2, and it was changed to 50°C for 28S Fb +28S R2. Additional primers were designed to amplify COI and 28S from uropodoids; all primers designed or used in this study are shown in the primer map (Table 1, Fig. 1).

Figure 1

Primer map showing the relative location of primers used to amplify.

(A) partial COI, and (B) 28S D2–D4 sequences from uropodoid mites collected from bark beetles.

Amplified products and negative controls were visualized on 1% agarose electrophoresis gels, and purified using pre-cast E-Gel CloneWell 0.8% SYBR Safe agarose gels (Invitrogen, Carlsbad, CA, USA) following the protocol of [31]. Sequencing reactions were performed in a total reaction volume of 10 µl, with 3 µl ddH2O, 1.5 µl of 5× sequencing buffer, 0.5 µl of primer, 1 µl of BigDye Terminator (PE Applied Biosystems, Foster City, CA, USA), and 4 µl of purified PCR product. Sequencing was performed at the Agriculture & Agri-Food Canada, Eastern Cereal and Oilseed Research Centre Core Sequencing Facility (Ottawa, ON, Canada). Purification of sequencing reactions was performed using the ABI ethanol/EDTA/sodium acetate precipitation protocol and reactions were analysed on an ABI 3130×l Genetic Analyzer (PE Applied Biosystems, Foster City, CA, USA).

Sequence Alignment and Phylogenetic Analysis

Sequence chromatograms were edited and contiguous sequences were assembled using Sequencher v4.7 (Gene Codes Corp., Ann Arbor, MI, USA). COI sequences were aligned manually in Mesquite v2.74 [32] according to the translated amino acid sequence. 28S was initially aligned in ClustalX v2.0.12 [33] with the default settings, and subsequently adjusted manually in Mesquite, no regions were excised, and due to the absence of any secondary structure for mites for this gene region, no secondary structure alignment was performed. Sequences have been submitted to GenBank (Table 2).

Table 2

Collection locations and host species records of uropodoid mites collected from scolytines (ingroup) and Nicrophorus beetles (outgroup) with GenBank accession no. for COI and 28S (*Uroob = Uroobovella, Trich = Trichouropoda, Nent = Nenteria).

Beetle no.	Beetle species	Collection location	Lat	Long	Date	Mite species*	COI	28S
1 - WKB4051	Pityokteines sparsus	Can, ON, Hwy 132, Dacre	45.369	−76.988	16 v 2009	Uroob. orri	JN992226	–
2 - WKB4057	Orthotomicus caelatus	Can, ON, Algonquin P.P. 1	45.902	−77.605	16 v 2009	Uroob. n.sp. 6	JN992227	–
3 - WKB4095	Gnathotrichus materiarius	Can, ON, Algonquin P.P. 2	45.895	−78.071	16 v 2009	Trich. parisiana	JN992184	–
4 - WKB4109	Ips grandicollis	Can, ON, Algonquin P.P. 2	45.895	−78.071	16 v 2009	Trich. australis	–	–
5 - WKB4190	Pityokteines sparsus	Can, ON, Algonquin P.P. 2	45.895	−78.071	28 v 2009	Trich. moseri	JN992171	–
6 - WKB4232	Polygraphus rufipennis	Can, ON, Carbine Rd.	45.330	−76.371	16 v 2009	Uroob. orri	–	–
7 - WKB4429	Dendroctonus valens	Can, ON, Algonquin P.P. 2	45.895	−78.071	16 v 2009	Uroob. americana	JN992202	–
8 - WKB4850	Polygraphus rufipennis	Can, AB, Fort McMurray	56.016	−110.88	23 vii 2009	Trich. moseri	JN992172	–
9 - WKB4869	Dryocoetes affaber	Can, AB, Fort McMurray	56.016	−110.88	29 vi 2009	Uroob. orri	–	–
10 - WKB4943	Hylesinus aculeatus	Can, ON, Hwy 132, Dacre	45.369	−76.988	1 v 2009	Trich. bipilis	JN992155	–
11 - WKB4987	Ips pini	Can, ON, Algonquin P.P. 1	45.902	−77.605	1 v 2009	Trich. australis	JN992139	–
12 - WKB4995	Trypodendron retusum	Can, ON, Algonquin P.P. 1	45.902	−77.605	1 v 2009	Trich. parisiana	–	–
13 - WKB5224	Polygraphus rufipennis	Can, ON, Algonquin P.P. 1	45.902	−77.605	28 v 2009	Uroob. orri	JN992228	–
14 - WKB5226	Dryocoetes affaber	Can, ON, Algonquin P.P. 1	45.902	−77.605	28 v 2009	Uroob. orri	JN992229	–
15 - WKB5261	Hylastes porculus	Can, ON, Algonquin P.P. 1	45.902	−77.605	28 v 2009	Uroob. dryocoetes	JN992211	–
16 - WKB5344	Gnathotrichus materiarius	Can, ON, Algonquin P.P. 1	45.902	−77.605	28 v 2009	Trich. parisiana	JN992185	–
17 - WKB5351	Dendroctonus valens	Can, ON, Algonquin P.P. 1	45.902	−77.605	28 v 2009	Uroob. dryocoetes	–	–
18 - WKB5563	Pityogenes hopkinsi	Can, ON, Algonquin P.P. 2	45.895	−78.071	28 v 2009	Trich. n.sp. 3	–	–
19 - WKB5564	Polygraphus rufipennis	Can, ON, Algonquin P.P. 2	45.895	−78.071	28 v 2009	Trich. moseri	–	–
20 - WKB5568	Ips pini	Can, ON, Algonquin P.P. 2	45.895	−78.071	28 v 2009	Trich. australis	–	–
21 - WKB5639	Orthotomicus caelatus	Can, ON, Algonquin P.P. 2	45.895	−78.071	28 v 2009	Uroob. n.sp. 6	JN992230	–
22 - WKB5682	Dryocoetes autographus	Can, ON, Algonquin P.P. 1	45.902	−77.605	25 vi 2009	Uroob. dryocoetes	JN992212	–
23 - WKB5759	Ips grandicollis	Can, ON, Algonquin P.P. 1	45.902	−77.605	25 vi 2009	Trich. lamellosa	–	–
24 - WKB5759	Ips grandicollis	Can, ON, Algonquin P.P. 1	45.902	−77.605	25 vi 2009	Uroob. orri	JN992231	–
25 - WKB5797	Hylurgops pinifex	Can, ON, Algonquin P.P. 2	45.895	−78.071	25 vi 2009	Trich. hirsuta	–	–
26 - WKB5882	Hylastes porculus	Can, ON, Algonquin P.P. 2	45.895	−78.071	25 vi 2009	Trich. hirsuta	JN992167	JN992260
27 - WKB5970	Dendroctonus ponderosae	Can, AB, Grande Prairie			2007	Trich. lamellosa	JN992170	JN992261
28 - WKHD001	Gnathotrichus materiarius	Can, QC, La Patrie, Route 212	46.345	−72.576	22 v 2009	Trich. parisiana	–	–
29 - WKHD004	Pityokteines sparsus	Can, QC, La Patrie, Route 212	46.345	−72.576	22 v 2009	Uroob. orri	JN992232	–
30 - WKHD008	Dendroctonus valens	Can, QC, La Patrie, Route 212	46.345	−72.576	22 v 2009	Uroob. americana	–	–
31 - WKHD009	Polygraphus rufipennis	Can, QC, East Hereford	45.029	−71.505	22 v 2009	Uroob. orri	–	–
32 - WKHD010	Gnathotrichus materiarius	Can, QC, East Hereford	45.029	−71.505	22 v 2009	Trich. parisiana	–	–
34 - WKHD012	Gnathotrichus materiarius	Can, QC, Pont Rouge	46.806	−71.679	05 vi 2009	Trich. parisiana	JN992186	–
35 - WKHD014	Polygraphus rufipennis	Can, QC, Pont Rouge	46.806	−71.679	05 vi 2009	Uroob. dryocoetes	JN992213	–
36 - WKHD018	Dendroctonus rufipennis	Can, NS, West Northfield			01 vi 2009	Uroob. orri	–	–
37 - WKHD030	Hylastes porculus	Can, NS, Westfield	44.403	−64.975	28 v 2009	Uroob. dryocoetes	JN992214	–
38 - WKHD037	Hylastes porculus	Can, NB, Bayside, Route 127	45.205	−67.140	15 vi 2009	Uroob. dryocoetes	–	–
39 - WKHD042	Xyleborinus saxesenii	Can, BC, Stanley Park, Pipeline Dr.			06 vi 2008	Trich. parisiana	JN992187	–
40 - WKHD057	Gnathotrichus materiarius	Can, QC, Parc des iles de Boucherville	45.601	−73.466	26 v 2009	Trich. parisiana	–	–
41 - WKHD062	Dendroctonus valens	Can, QC, Sorel-Tracy	46.030	−73.083	09 vi 2009	Uroob. americana	JN992203	–
42 - WKHD065	Gnathotrichus materiarius	Can, QC, Sorel-Tracy	46.030	−73.083	09 vi 2009	Uroob. orri	–	–
43 - WKHD066	Hylastes porculus	Can, QC, Sorel-Tracy	46.030	−73.083	09 vi 2009	Uroob. dryocoetes	JN992215	JN992277
44 - WKHD067	Dryocoetes autographus	Can, QC, Sorel-Tracy	46.030	−73.083	09 vi 2009	Uroob. dryocoetes	–	–
45 - WKHD070	Dryocoetes affaber	Can, QC, Sorel-Tracy	46.030	−73.083	09 vi 2009	Uroob. dryocoetes	–	–
46 - WKHD075	Hylastes ruber	Can, BC, McPhee Creek Rd.	49.323	−117.61	29 iv 2009	Trich. fallax	JN992166	JN992259
47 - WKHD078	Hylurgops pinifex	Can, NS, Greenfield	44.335	−64.915	11 vi 2009	Trich. fallax	–	–
48 - WKHD079	Dendroctonus rufipennis	Can, NS, Annapolis, Granville ferry	44.810	−65.537	22 vi 2009	Trich. alascae	JN992137	–
49 - WKHD079	Dendroctonus rufipennis	Can, NS, Annapolis, Granville ferry	44.810	−65.537	22 vi 2009	Uroob. orri	JN992233	–
50 - WKHD080	Dendroctonus rufipennis	Can, NS, Victoria Beach	44.703	−65.747	22 vi 2009	Uroob. orri	JN992234	–
51 - WKHD085	Dendroctonus rufipennis	Can, NS, Blomidon, Stewart Mtn. Rd.	45.227	−64.397	19 vi 2009	Trich. alascae	JN992138	JN992253
52 - WKHD085	Dendroctonus rufipennis	Can, NS, Blomidon, Stewart Mtn. Rd.	45.227	−64.397	19 vi 2009	Uroob. orri	JN992235	–
53 - WKHD114	Dendroctonus rufipennis	Can, QC, Degelis	47.561	−68.644	16 vi 2009	Uroob. orri	–	–
54 - WKHD116	Hylastes porculus	Can, QC, Saint Come De liniere	46.014	−70.483	23 vi 2009	Uroob. dryocoetes	JN992216	–
55 - WKHD117	Gnathotrichus materiarius	Can, QC, Degelis	47.551	−68.642	26 vi 2009	Trich. parisiana	–	–
56 - WKHD118	Hylastes porculus	Can, QC, Degelis	47.551	−68.642	26 vi 2009	Uroob. dryocoetes	JN992217	–
57 - WKHD120	Dendroctonus valens	Can, QC, Pont Rouge	46.562	−71.545	08 vi 2009	Uroob. americana	JN992204	–
58 - WKHD121	Dendroctonus valens	Can, QC, Saint Pamphile	46.943	−69.764	17 vi 2009	Uroob. dryocoetes	JN992218	–
59 - WKHD129	Dendroctonus rufipennis	Can, QC, Saint Pamphile	46.947	−69.761	17 vi 2009	Uroob. orri	–	–
60 - WKHD130	Dryocoetes autographus	Can, NB, Monument	45.954	−67.767	24 vi 2009	Uroob. dryocoetes	JN992219	–
61 - WKHD133	Dendroctonus rufipennis	Can, NS, Sheet Harbour	44.907	−62.491	19 vi 2009	Uroob. orri	JN992236	–
62 - WKHD136	Polygraphus rufipennis	Can, NS, Sheet Harbour	44.907	−62.491	19 vi 2009	Uroob. orri	JN992237	–
63 - WKHD140	Dryocoetes autographus	Can, NS, Sheet Harbour	44.909	−62.503	19 vi 2009	Uroob. dryocoetes	JN992220	–
64 - WKHD142	Dryocoetes affaber	Can, NS, Sheet Harbour	44.909	−62.503	19 vi 2009	Trich. hirsuta	–	–
65 - WKHD142	Dryocoetes affaber	Can, NS, Sheet Harbour	44.909	−62.503	19 vi 2009	Uroob. orri	JN992238	–
66 - WKHD149	Polygraphus rufipennis	Can, QC, Cookshire	45.389	−71.513	02 vii 2009	Trich. hirsuta	–	–
67 - WKHD158	Dryocoetes autographus	Can, QC, Cookshire	45.389	−71.513	02 vii 2009	Uroob. dryocoetes	JN992221	–
68 - WKHD169	Dryocoetes affaber	Can, QC, Cookshire	45.389	−71.513	02 vii 2009	Uroob. dryocoetes	JN992222	–
69 - WKHD172	Dryocoetes affaber	Can, QC, Saint Malo	45.197	−71.527	02 vii 2009	Uroob. dryocoetes	–	–
70 - WKHD175	Hylastes porculus	Can, QC, La Patrie, Route 212	46.345	−72.576	02 vii 2009	Uroob. dryocoetes	JN992223	–
71 - WKHD177	Dryocoetes autographus	Can, QC, La Patrie, Route 212	46.345	−72.576	02 vii 2009	Uroob. dryocoetes	–	–
72 - WKHD178	Orthotomicus caelatus	Can, NS, Goodwood	44.603	−63.677	27 v 2009	Uroob. n.sp. 6	JN992239	JN992278
73 - WKHD179	Ips pini	Can, NS, Goodwood	44.603	−63.677	27 v 2009	Trich. australis	JN992140	JN992254
74 - WKHD181	Polygraphus rufipennis	Can, NS, Purcell’s Cove	44.624	−63.575	03 vi 2009	Uroob. orri	JN992240	–
75 - WKHD182	Dryocoetes affaber	Can, NS, Purcell’s Cove	44.624	−63.575	03 vi 2009	Uroob. orri	JN992241	–
76 - WKHD183	Dendroctonus rufipennis	Can, NS, Purcell’s Cove	44.624	−63.575	13 vii 2009	Uroob. orri	–	–
77 - WKHD184	Gnathotrichus materiarius	Can, NS, Debert, Industrial Park	45.428	−63.429	25 vi 2009	Trich. parisiana	JN992188	–
78 - WKHD185	Ips pini	Can, NS, Debert, Industrial Park	45.428	−63.429	25 vi 2009	Trich. australis	JN992141	–
79 - WKHD189	Ips borealis	Can, NS, Debert, Industrial Park	45.428	−63.429	25 vi 2009	Trich. polytricha	JN992191	–
80 - WKHD193	Dryocoetes autographus	Can, NS, Debert, Industrial Park	45.428	−63.429	25 vi 2009	Uroob. dryocoetes	JN992224	–
81 - WKHD194	Dryocoetes affaber	Can, QC, Saint Roch de Mekinac	46.792	−72.748	23 vi 2009	Uroob. orri	–	–
82 - WKHD199	Hylastes porculus	Can, QC, Saint Severin, Route 159	46.686	−72.525	23 vi 2009	Uroob. dryocoetes	JN992225	–
83 - WKHD204	Ips grandicollis	Can, ON, Brampton	43.708	−79.728	06 vii 2009	Trich. australis	JN992142	–
84 - WKHD208	Ips grandicollis	Can, ON, Argentia Rd. Century Ave	43.598	−79.744	07 vii 2009	Trich. australis	JN992143	JN992255
85 - WKHD228	Ips pini	Can, QC, Boucherville	45.601	−73.466	09 vii 2009	Trich. australis	JN992144	–
86 - WKHD230	Ips pini	Can, ON, Argentia Rd. Century Ave	43.598	−79.744	20 vii 2009	Trich. australis	–	–
87 - WKHD232	Ips grandicollis	Can, ON, New Market, 500 Water St.	44.047	−79.456	23 vii 2009	Uroob. orri	JN992242	–
88 - WKHD234	Ips pini	Can, ON, New Market, 500 Water St.	44.047	−79.456	23 vii 2009	Trich. australis	JN992145	–
89 - WKHD235	Polygraphus rufipennis	Can, QC, Saint Zacharie	46.130	−70.262	21 vii 2009	Trich. moseri	JN992173	JN992262
90 - WKHD236	Polygraphus rufipennis	Can, QC, Woburn	45.342	−70.898	21 vii 2009	Trich. moseri	JN992174	–
91 - WKHD237	Polygraphus rufipennis	Can, QC, Saint Benjamin	46.268	−70.617	21 vii 2009	Trich. moseri	–	–
92 - WKHD252	Ips borealis	Can, NS, Hantsport, Cobesquid Bay	45.099	−64.184	21 vii 2009	Trich. polytricha		–
93 - WKHD254	Ips pini	Can, NS, Hantsport, Cobesquid Bay	45.099	−64.184	11 viii 2009	Trich. australis	JN992146	–
94 - WKHD261	Hylastes subopacus	USA, NM, Bernalillo			10 x 2008	Nent. chiapasa	–	–
95 - WKB5929	Dendroctonus valens	Can, ON, Algonquin P.P. 2	45.895	−78.071	25 vi 2009	Uroob. americana	JN992205	–
96 - WKB5639	Orthotomicus caelatus	Can, ON, Algonquin P.P. 2	45.895	−78.071	28 v 2009	Uroob. n.sp. 6	JN992243	JN992279
97 - WKB5929	Dendroctonus valens	Can, ON, Algonquin P.P. 2	45.895	−78.071	25 vi 2009	Uroob. americana	JN992206	JN992275
98 - MSU001	Pityophthorus sp.	USA, CA, El Dorado N.F. Ice House Res.	38.5	−120.22	25 v 2007	Trich. n.sp. 2	JN992178	JN992265
99 - MSU004	Dendroctonus valens	USA, OH, Secrest Arboretum	40.782	−81.916	v 2007	Uroob. americana	–	–
100 - MSU006	Ficicis sp.	China, Yunnan, Xishuangbanna	22.163	100.871	30 v 2008	Uroob. australiensis	JN992210	–
101 - MSU010	Dendroctonus valens	USA, PA, Keystone Rd.	40.739	−76.308	30 iv 2009	Uroob. americana	–	–
102 - MSU012	Polygraphus sp.	Thailand, Doi Pui			iv 2005	Trich. polygraphi	–	–
103 - MSU014	Scolytus ventralis	USA, CA, El Dorado N.F. Ice House Res.	38.5	−120.22	17 vi 2003	Trich. n.sp. 10	JN992175	JN992263
104 - MSU016	Hylurgops rugipennis pinifex	USA, UT, Ashley N.F., Gray Head Peak	39.54	−110.45	11 vi 2003	Trich. fallax	–	–
105 - MSU020	Monarthrum dentigerum	USA, TX, Davis Mt. S.P.			25 v 2001	Trich. n.sp. 8	–	–
106 - MSU024	Monarthrum dentigerum	USA, TX, Big Bend N.P.			iv 2004	Trich. n.sp. 8	–	–
107 - MSU025	Hylurgops sp.	Mex, South of Amecameca	19.016	−98.741	11 v 2004	Uroob. vinicolora	JN992248	–
108 - MSU028	Hylastes sp.	USA, WI, Cobma			11 iv 2004	Trich. perissopos	–	–
109 - MSU030	Dendroctonus valens	USA, WI, nr. Madison			v 2005	Uroob. americana	JN992207	–
110 - MSU032	Pseudips mexicanus	Mex, Jalisco			5 xi 2003	Nent. moseri	JN992136	JN992252
111 - MSU036	Pityokteines curvidens	Croatia			2003	Uroob. orri	JN992244	JN992280
112 - MSU038	Pseudips mexicanus	Mex, Jalisco, nr. Ciudad Guzman			9 ii 2006	Trich. n.sp. 9	JN992181	–
113 - MSU040	Orthotomicus erosus	Italy, Tuscany, nr. San Gusme	43.360	11.501	29 xii 2006	Trich. n.sp. 4	JN992179	JN992266
114 - MSU045	Ips hunteri	USA, UT, Ashley N.F., Hwy 191	40.43	−109.29	10 vi 2003	Trich. polytricha	–	–
115 - MSU049	Ips pilifrons utahensis	USA, CO, San Isabel N.F. Monarch Pass	38.31	−106.19	9 vi 2003	Trich. polytricha	–	–
116 - MSU050	Ips cribricollis	USA, NM, Big Burro Mts			20 viii 2003	Trich. australis	JN992147	–
117 - MSU051	Ips perturbatus	USA, MN, Cascade River Park			12 vi 2001	Trich. polytricha	JN992192	–
118 - MSU053	Ips cribricollis	Mex, South of Amecameca	19.016	−98.741	11 v 2004	Trich. tegucigalpae	JN992201	JN992274
119 - MSU055	Ips cribricollis	Mex, Landa de Matamoros	21.263	−99.177	14 v 2004	Trich. australis	–	–
120 - MSU056	Ips nitidus	China, Sichuan			9 vii 2004	Nent. eulaelaptis	JN992135	JN992251
121 - MSU057	Ips cribricollis	Mex, Jalisco, nr. Ciudad Guzman			9 ii 2006	Trich. n.sp. 13	JN992198	–
122 - MSU060	Ips pilifrons	USA, CO, White River N.F. Lost Lake			30 vi 2005	Trich. polytrichasimilis	–	–
123 - MSU066	Ips calligraphus	USA, FL, Naples, Collier	26.157	−81.660	iii - iv 2007	Trich. australis	–	–
124 - MSU067	Ips hoppingi	USA, TX, McDonald Observatory			12 iv 2002	Trich. californica	JN992156	–
125 - MSU069	Ips montanus	USA, WA, Hwy 410, nr. Chinook Pass			11 v 2001	Trich. polytrichasimilis	–	–
126 - MSU071	Ips pini	USA, AK, Douglas is. nr. Juneau			4 v 2001	Trich. idahoensis	JN992168	–
127 - MSU073	Ips pini	USA, CA, Lassen N.F. Polesprings Rd.			3 vii 2001	Trich. idahoensis	JN992169	–
128 - MSU079	Ips plastographus	USA, CA,			v 2001	Trich. n.sp. 11	JN992197	JN992272
129 - MSU084	Ips paraconfusus	USA, CA, Mt. Diablo S.P. Contra Costa			10 vi 2001	Trich. n.sp. 7	–	–
130 - MSU085	Ips lecontei	USA, AZ, Coronado N.F. Ladybug Peak			18 vii 2001	Trich. australis	JN992148	–
131 - MSU086	Ips cembrae	Switzerland			v 2002	Trich. polytricha	JN992193	JN992270
132 - MSU090	Ips montanus	USA, CA, El Dorado, Hwy 50 nr. Meyer			13 vi 2001	Trich. polytricha	JN992194	–
133 - MSU091	Pityogenes chalcographus	Norway			v 2002	Trich. n.sp. 5	JN992180	JN992267
134 - MSU094	Ips confusus	USA, NV, Mt. Charleston Recreation	36.16	−115.32	27 vi 2003	Trich. californica	JN992157	–
135 - MSU099	Ips confusus	USA, UT, nr. Baker Dam	37.23	−113.39	28 vi 2003	Trich. californica	JN992158	–
136 - MSU104	Ips confusus	USA, AZ, Kaibab N.F. Hwy 389	36.51	−112.16	30 vi 2003	Trich. californica	JN992159	–
137 - MSU108	Ips confusus	USA, AZ, Kaibab N.F. nr. Flagstaff	35.24	−111.35	2 vii 2003	Trich. californica	JN992160	–
138 - MSU111	Ips confusus	USA, NM, Carson N.F. nr. Los Pinons	36.25	−106.01	9 vi 2003	Trich. californica	JN992161	JN992257
139 - MSU114	Ips confusus	USA, NM, Santa Fe			17 vi 2003	Trich. californica	JN992162	–
140 - MSU119	Ips confusus	USA, NV, Risue Canyon			4 vi 2003	Trich. californica	JN992163	–
141 - MSU123	Ips confusus	USA, AZ, Coconino, nr. Red Mt.	35.31	−111.5	vi 2003	Trich. californica	JN992164	–
142 - MSU124	Ips confusus	USA, CO, F.R. 504	37.669	−108.70	9 viii 2004	Trich. californica	JN992165	–
143 - MSU125	Ips perturbatus	Can, ON, Marlborough Forest			19 v 1995	Trich. australis	–	–
144 - MSU127	Pseudips mexicanus	USA, CA, San Francisco			20 viii 1995	Trich. n.sp. 9	JN992182	–
145 - MSU131	Ips emarginatus	USA, CA, Lassen, Black Mt.			7 vii 1995	Trich. polytrichasimilis	–	–
146 - MSU132	Ips calligraphus	USA, NY, Smithtown			11 ix 1994	Trich. australis	–	–
147 - MSU133	Ips pini	USA, NY			18 x 1995	Trich. australis	–	–
148 - MSU137	Ips paraconfusus	USA, CA, Mt. Diablo			3 ix 1995	Trich. n.sp. 7	JN992199	–
149 - MSU139	Ips woodi	USA, AZ, Coronado N.F. Hospital Flat			4 ix 1996	Trich. polytricha	JN992195	–
150 - MSU143	Dendroctonus valens	USA, PA, 225 Yeager Rd. Woodland	41.049	−78.349	30 iv 2009	Uroob. americana	JN992208	–
151 - MSU144	Ips woodi	USA, AZ, Apache N.F. Hannagan Meadow			1 ix 1996	Trich. polytricha	JN992196	–
152 - MSU147	Ips pilifrons	USA, AZ, Apache N.F. Hannagan Meadow			31 viii 1996	Trich. australis	JN992149	–
153 - MSU148	Ips cribricollis	USA, NM, Otero			v 1994	Trich. australis	JN992150	–
154 - MSU150	Ips hunteri	USA, AZ, Apache N.F. Hannagan Meadow				Trich. australis	JN992151	–
155 - MSU152	Pseudips mexicanus	USA, CA, Albion River Rd. nr. Rt. 1			23 iii 1996	Trich. n.sp. 9	JN992183	JN992268
156 - MSU154	Ips emarginatus	USA, CA, El Dorado N.F. Ice House Res.			6 ix 1997	Uroob. orri	JN992245	–
157 - MSU155	Dendroctonus valens	USA, CA, University of California Berkeley			14 x 1996	Uroob. vinicolora	JN992249	–
158 - MSU157	Ips cribricollis	USA, NM, Cloudcroft			11 v 1994	Trich. australis	JN992152	–
159 - MSU162	Ips bonanseai	Mex, Nuevo Leon			xii 1993	Trich. tegucigalpae	–	–
160 - MSU163	Ips hoppingi	Mex, Nuevo Leon	24.505	−99.985	25 x 1993	Trich. californica	–	–
161 - MSU167	Ips plastographus	USA, CA, Santa Cruz			13 x 1993	Uroob. orri	JN992246	–
162 - MSU168	Ips pini	USA, RI, Lincoln S.P.			19 vii 1997	Trich. australis	JN992153	–
163 - MSU173	Ips emarginatus	USA, CA, Lassen, Bogard Bultes			6 xii 1996	Uroob. orri	JN992247	–
164 - MSU174	Ips cembrae	Germany, Dresden			28 v 1986	Trich. polytricha	–	–
165 - MSU179	Gnathotrichus materiarius	USA, MI, Mt. Pleasant			28 v 1998	Trich. parisiana	JN992189	–
166 - MSU180	Camptocerus auricomis	Panama			4 ix 2008	Trich. n.sp. 6	–	–
167 - MSU185	Corthylus sp.	Panama	8.862	−82.743	26 viii 2008	Trich. n.sp. 1	JN992176	–
168 - MSU010	Dendroctonus valens	USA, PA, Keystone Rd.	40.739	−76.308	30 iv 2009	Uroob. americana	–	–
169 - MSU084	Ips paraconfusus	USA, CA, Mt. Diablo S.P. Contra Costa			10 vi 2001	Trich. n.sp. 7	JN992200	JN992273
170 - MSU123	Ips confusus	USA, AZ, Coconino, nr. Red Mt.	35.31	−111.5	vi 2003	Trich. californica	–	JN992258
171 - MSU143	Dendroctonus valens	USA, PA, 225 Yeager Rd. Woodland	41.049	−78.349	30 iv 2009	Uroob. americana	JN992209	JN992276
172 - MSU148	Ips cribricollis	USA, NM, Otero			v 1994	Trich. australis	JN992154	JN992256
173 - MSU154	Ips emarginatus	USA, CA, El Dorado N.F. Ice House Res.			6 ix 1997	Uroob. orri	–	–
174 - MSU185	Corthylus sp.	Panama	8.862	−82.743	26 viii 2008	Trich. n.sp. 1	JN992177	JN992264
175 - MSU025	Hylurgops sp.	Mex, South of Amecameca	19.016	−98.741	11 v 2004	Uroob. vinicolora	JN992250	JN992281
176 - MSU049	Ips pilifrons utahensis	USA, CO, San Isabel N.F. Monarch Pass	38.31	−106.19	9 vi 2003	Trich. polytricha	–	JN992271
177 - MSU179	Gnathotrichus materiarius	USA, MI, Mt. Pleasant			28 v 1998	Trich. parisiana	JN992190	JN992269
2 - WKN084	Nicrophorus sayi	Can, QC, Pont-Rouge	46.806	−71.679	05 vi 2009	Uroob. sp. 2	JN992096	–
7 - WKN165	Nicrophorus orbicollis	Can, ON, Carbine Rd.	45.330	−76.371	23 vii 2009	Uroob. sp. 1	JN992074	JQ316464
8 - WKN184	Nicrophorus vespilloides	Germany, Mooswald Forest, nr. Freiburg	48.0	7.85	vi 2009	Uroob. sp. 3	JN992102	JQ316465
21 - WKN165	Nicrophorus orbicollis	Can, ON, Carbine Rd.	45.330	−76.371	23 vii 2009	Uroob. sp. 1	JN992075	–
30 - WKN090	Nicrophorus nepalensis	Taiwan, nr. Meifeng, 5 km Sungkang	24.088	121.171	02 v 2007	Uroob. sp. 4	JN992103	–
65 - WKN350	Nicrophorus sayi	Can, NS, Portobello	44.75	−63.6	2009	Uroob. sp. 2	JN992097	–

Pairwise distances were calculated using neighbour-joining (NJ) analyses with the Kimura-2-parameter (K2P) model in PAUP* v4.0b10 [34]. Phylogenetic reconstructions of COI, 28S, and concatenated datasets were performed using Bayesian inference (BI) in MrBayes v3.1.2 [35], [36], and parsimony analyses in TNT v1.1 [37]. Gaps were treated as missing since gaps scored as a fifth state produced the same topology as that observed for gaps as missing for each of the analytical approaches. Analyses of the COI dataset excluding the third codon positions produced poorly supported reconstructions with similar topology to the analyses including the third codon position; hence analyses were performed including the 3rd codon.

MrModeltest v2.3 [38] was used to determine the best-fit model of molecular evolution for each gene, which was determined to be GTR+I+G. Bayesian analysis was performed in MrBayes with a Markov Chain Monte Carlo (MCMC) method, two independent runs, with nucmodel = 4by4, Nst = 6, rates = invgamma, samplefreq = 1000, four chains = one cold and three heated. The COI dataset ran for 20 million generations, and the 28S and concatenated datasets ran for 10 million generations with a burn-in of 1000. In Mesquite, the remaining trees, excluding the burn-in, were used to generate a majority-rule consensus tree displaying the posterior probability supports for each node. Bayesian analyses were performed using the on-line Computational Biology Service Unit at Cornell University, and at the Cyberinfrastructure for Phylogenetic Research (CIPRES) portal [39].

Parsimony analysis was performed using a heuristic search with tree bisection-reconnection (TBR) branch swapping and 1000 random addition sequence replicates, all characters were treated as unordered, equal weighting, and gaps were treated as missing. Multiple trees were obtained and these were presented in a semistrict consensus tree. Node support was assessed in TNT, using jackknife resampling with 36% of characters removed and 1000 replicates, Bremer supports and partitioned Bremer supports (PBS) were also determined using TNT. Node support for the parsimony analysis of the COI and concatenated datasets were mapped onto the corresponding Bayesian phylogenies.

Morphological Analysis

To assess intraspecific morphological divergence of mites used in the molecular analyses, slide-mounted specimens were examined using a Leica DM5500B compound microscope, and 15 and 14 characters (for Trematuridae and Urodinychidae, respectively) were measured using Leica Application Suite, Live and Interactive Measurements Modules v3.5. Characters from different body regions were selected based on their relative ease of measurement and prominence, as well as previously observed variation across specimens. The 15 characters measured for trematurid species were: maximal length and width of the dorsal shield and ventrianal shield; sternal shield (SS) median length; SS width at five levels (from anterior to posterior): maximal width of the SS anterior margin, maximum width of the two expansions at level with coxae II–III and coxae III–IV, minimum width of the posterior constriction level with coxa IV, and width of the SS posterior margin; length of tarsus I; and the length of the following setae: opisthogastric setae V8 and V4 [25] (JV4 and paranal, sensu [40]), the proximoventral setae of femur I, and the longest of anterodorsal setae in the sensory pit of tarsus I. The same characters were measured for Urodinychidae (Uroobovella) species, except that seta V4 and proximoventral setae of femur I were not measured, but the length of dorsal seta j1 was instead. Morphological divergence was visualized by generating an ordination based on semistrong hybrid multidimensional scaling (SSH MDS) with PATN v2.27 [41]. The ordination was based on a Bray-Curtis distance matrix between mite specimens created using morphometric data standardized for body size to eliminate bias linked to body size, and transformed ((value – minimum)/range) to balance the weight of all measured characters. The ordination was generated based on 1000 iterations and 1000 random starts. Significant differences among groups detected in a given ordination were tested using ANOSIM (analysis of similarity), with 1000 iterations.

To ensure that specimens that underwent DNA extraction could be studied morphologically without any bias, the effect of DNA extraction was tested by comparing the morphology of specimens that underwent DNA extraction with specimens of the same species, and from that same host individual, that did not undergo extraction. Thirteen of the aforementioned morphological characters (standardized for body size) were examined for specimens of two species (Uroobovella orri, Trichouropoda californica) using Wilcoxon signed rank tests performed in SPSS v17 (SPSS Inc., Chicago, United States of America). No significant differences in morphology were observed between U. orri mites that underwent DNA extraction versus mites that did not undergo extraction, based on 13 characters and 15 pairwise comparisons (each pair consisting of two mites from the same host individuals; P = 0.078–0.995). DNA extraction had no significant effect on the morphology of T. californica specimens either (P = 0.139–0.799; 13 characters, 10 pairwise comparisons), except for two characters: median length and width of the sternal shield (P = 0.037, P = 0.009). The variation of these characters was most likely an artefact of slide mounting following DNA extraction, in that extraction weakens sclerotized tissue, which may have encouraged shields to fracture. Slide-mounted T. californica specimens that underwent DNA extraction had small fractures on either side of the sternal shield just posterior to the midpoint, and this may have increased sternal shield medial length and width measured relative to that of mites that did not undergo DNA extraction. With the exception of these two characters, DNA extraction did not significantly alter mite morphology, and as a result specimens that underwent extraction can be compared morphologically without any incurred bias.

Results

A total of 36 species of uropodoids (from three genera and two families) were found on 51 scolytine species (from 20 genera and 10 tribes), which were collected across 11 countries (Table 2). Of these 36 mite species, 13 are undescribed. The majority of the 36 species were collected from only one (64%) or two (17%) host species; fewer species were collected from three to nine host species (19%) (Fig. 2, Table 2). Most (76%) of the host associations observed in this study represent new records, and 19 of the 23 described species collected in this study had new host records (Table 3). There was little overlap in bark beetle hosts between this study and the literature for many of the common uropodoid species (e.g. T. australis, T. polytricha, and U. orri, each with only 1–3 host species shared; Table 3). The host records of many of the described species collected in this study are novel, when compared with published host records (Table 3). Most bark beetle species were associated with only one or two mite species; four host species had three mite species, and one host species (Polygraphus rufipennis) was associated with four mite species (Table 2).

Figure 2

Distribution of the breadth of host range of uropodoid mites.

Uropodoids collected from 51 species of bark beetles from 11 countries, showing the number of total mite species and the number of scolytine species used by each mite species. Note that these observed host ranges are based on opportunistic sampling from various regions; therefore, the true host ranges are possibly much broader.

Table 3

Comparing observed host records (this study) with published records (publ.) for described mite species collected from scolytines and other families of wood-boring beetles1 (*number of host spp. shared).

Mite species	No. host spp/genera		Published host species (°spp. shared with present study)	Regions2	References
	This study	Publ.
Nenteria chiapasa	1	0	pine duff (needle litter)	Mexico	54
N. eulaelaptis	1	0	no host or habitat provided	Hungary, Mongolia	25, 54
N. moseri	1	1	Dendrocontus frontalis	Guatemala	55
Trichouropoda alascae	1	2*/1	Dendroctonus obesus, D. rufipennis°	AK	28,56
T. australis	8/1	12***/3	Dendroctonus brevicomis, D. frontalis, D. ponderosae, D. terebrans, D. simplex, Ips avulsus, I. bonanseai, I. calligraphus°, I. confusus, I. grandicollis°, I. pini°; CER: Neacanthosinus obsoletus	AZ, LA, MS, TX	9,57,58
T. bipilis	1	1	Scolytus pygmaeus	Austria	29
T. californica	2/1	1*	Ips confusus°	CA	59
T. fallax	3/2	5*/3	Dendroctonus adjunctus, Hylastes ater, H. cunicularius, H. interstitialis, Hylurgops pinifex°	LA; Siberia; Belgium	29,57
T. hirsuta	4/4	15/7	Dendroctonus approximatus, D. brevicomis, D. frontalis, D. valens, Gnathotrichus materiarius, Ips avulsus, I. calligraphus, I. grandicollis, I. pini, Trypodendron scabricollis; CER: Monochamus carolinensis, M. scutellatus, M. titillator, Neacanthosinus obsoletus, Xyloterus sagittatus	AB, ON; AZ, LA, MS, TX	9,27,57,58,60
T. idahoensis	1	1*	Ips pini°	ID	27
T. lamellosa	2/2	10*/6	Dendroctonus pseudotsugae, Dryocoetes confusus, Ips avulsus, I. calligraphus, I. grandicollis°; CER: Monochamus carolinensis, M. scutellatus, M. titillator, Neacanthosinus obsoletus, Xyloterus sagittatus	AB, ON; AZ, LA, MS	9,14,57,58,60
T. moseri	2/2	1	Dendroctonus simplex	AB	25
T. parisiana	3/3	2/1	Ips sexdentatus, I. typographus	France	28
T. perissopos	1	1	CUR: Perissops sobrinus	Poland	27
T. polygraphi	1	1	Polygraphus minor	India	29
T. polytricha	7/1	7*/4	Dryocoetes autographus, Hylurgops palliatus, Ips amitinus, I. cembrae°, I. hauseri, I. typographus, Pityogenes chalcographus	Austria, Germany, Poland, Turkey	29,61
T. polytrichasimilis	3/1	1	Ips sexdentatus; under bark of Pinus pinaster	France, Portugal	25,62
T. tegucigalpae	2/1	3**/2	Dendroctonus frontalis, Ips bonanseai°, I. cribricollis°	Honduras, Mexico	27
Uroobovella americana	1	7*/3	Dendroctonus pseudotsugae, D. terebrans, D. valens°, Gnathotrichus materiarius, Ips avulsus, I. calligraphus, I. grandicollis	AZ, LA	9,57
U. australiensis	1	1	CER: Pelargoderus arouensis	Australia	63
U. dryocoetes	5/4	3*/3	Dryocoetes autographus°, Hylastes cunicularius, Ips sexdentatus	Austria	29
U. orri	9/6	11**/4	Dendroctonus brevicomis, D. frontalis, D. obesus, D. pseudotsugae, D. valens, Dryocoetes confusus, Gnathotrichus materiarius°, Ips avulsus, I. calligraphus, I. grandicollis°, I. pini.	AZ, LA, MS, TX	9,57
U. vinicolora	2/2	1	Ips typographus	Germany	61

CER  =  Cerambycidae, CUR  =  Curculionidae.

Provinces and states of Canada and USA follow accepted abbreviations.

Amplification of COI was attempted with 176 deutonymphal mites, from which only 116 (representing 29 species and three genera) from nine countries and 74 sites yielded sequence data (Table 2). COI was amplified from 122 specimens (116 ingroup and six outgroup specimens), with 608 characters in total, 328 constant, 19 parsimony-uninformative, and 261 parsimony-informative. Mean base pair frequencies (A: 0.294, C: 0.187, G: 0.153, T: 0.366) were found to be heterogeneous across all specimens (χ2 = 504.83, P<0.0001). The 28S D2–D4 region was used to assess the branching patterns observed in the COI reconstructions and to further test species boundaries. Partial 28S was amplified from 31 mites from 25 species (three genera) collected across nine countries and 26 sites, as well as from two outgroup specimens (Table 2), with 1069 characters in total, 446 constant, 114 parsimony-uninformative, and 509 parsimony-informative. Mean base pair frequencies (A: 0.239, C: 0.199, G: 0.283, T: 0.279) were found to be homogeneous across all specimens (χ2 = 92.12, P = 0.59). In each reconstruction, each specimen is labeled with a unique number, followed by the host species and abbreviated state, province or country (Table 2).

Pairwise Divergence

NJ analysis (K2P) of COI was performed on 122 mite specimens including 116 ingroup specimens (29 spp. total: 21 Trichouropoda, 2 Nenteria, and 6 Uroobovella spp.) and six outgroup specimens (four spp.). Average COI intraspecific pairwise distance was lowest among Trichouropoda species (1.5%±1.8) and slightly higher among Uroobovella species (1.9%±2.9) (Table 4). The maximum intraspecific divergence was high for both genera, with a maximum of 10.4% for T. polytricha and 12.5% for U. orri, both of which were between new and old world specimens (Table 4). Mean interspecific divergence within each genus was relatively high for all three genera (16.7–17.3%), and typically greater than intraspecific divergence (Table 4). The maximum divergence between Trichouropoda species was between T. hirsuta and T. moseri (23.4%), and the minimum was between T. n.sp. 11 and T. idahoensis (0.5%). The maximum for Uroobovella was between U. americana and U. orri (20.8%), and the minimum was between U. americana and U. vinicolora (8.4%) (Table 4). Average intergeneric divergence was high (18.6–21.5%), with the maximum divergence between T. hirsuta and U. australiensis (28.1%) (Table 4).

Table 4

Intra- and interspecific nucleotide divergence (%) ±standard deviation (range) of COI and 28S amplified from uropodoid mites associated with bark beetles.

	COI	28S
	mean (range)	mean (range)
Intraspecific
Trichouropoda	1.5±1.8 (0–10.4)	0.3±0.2 (0.1–0.5)
Nenteria 1	–	–
Uroobovella	1.9±2.9 (0–12.5)	0.0±0.0 (0)
Interspecific
Trichouropoda	16.7±2.9 (0.5–23.4)	7.1±5.0 (0–16.6)
Nenteria	16.9±0.0 (16.9)	10.0±0.0 (10.0)
Uroobovella	17.3±2.7 (8.4–20.8)	32.7±15.9 (1.5–42.5)
Intergeneric
Trich – Nent	18.6±1.2 (16.3–23.2)	16.0±1.1 (13.8–20.0)
Trich – Uroob	21.3±1.4 (17.7–28.1)	34.9±3.9 (28.5–41.6)
Nent – Uroob	21.5±1.3 (18.6–23.6)	34.5±3.7 (29.0–41.1)

Nenteria was represented by only 2 species, and each by a single individual.

NJ analysis of 28S was performed on 33 mite specimens including 31 ingroup specimens (25 spp. total: 18 Trichouropoda, 2 Nenteria, and 5 Uroobovella spp.), and two outgroup species. Average 28S intraspecific pairwise distance was highest among Trichouropoda species (0.3%±0.2), and lowest among Uroobovella species (0%±0) (Table 4). The maximum intraspecific divergence was relatively low for Trichouropoda with a maximum of 0.5% for T. californica, and low for Uroobovella with a maximum of 0% for U. n.sp. 6 and U. americana (Table 4). Mean interspecific divergence within each genus was moderate to very high (7.1–32.7%), and clearly higher than intraspecific divergence (Table 4). The maximum between Trichouropoda species was between T. hirsuta and T. n.sp. 11 (16.6%), and the minimum was between T. lamellosa and T. n.sp. 10 (0%) (Table 4). The maximum for Uroobovella species was between U. dryocoetes and U. orri (42.5%), and the minimum was between U. vinicolora and U. americana (1.5%) (Table 4). Average intergeneric divergence was high (16.0–34.9%), with the maximum pairwise distance between Trichouropoda lamellosa and Uroobovella dryocoetes (41.6%) (Table 4).

Bayesian Inference

BI of COI was performed for 20 million generations, producing 38002 trees (after burn-in) which were summarized in a majority rule consensus tree (TL = 2021, CI = 0.2459, RI = 0.8277) (Fig. 3). The BI consensus tree was well supported, with most nodes having moderate to high posterior probabilities, with 26 nodes having 100% support, eight of which are basal nodes to ingroup species (Fig. 3). Some species, such as T. australis, T. californica, U. orri, U. dryocoetes, and U. americana, had multiple unresolved nodes collapsing into intraspecific polytomies. BI of 28S was performed for 10 million generations, producing 18002 trees (after burn-in) that were summarized in a majority rule consensus tree (TL = 1465, CI = 0.6881, RI = 0.8204) (tree not shown). The consensus tree was well supported: 12 nodes had 100% support, one of which was the node to the ingroup. BI of the concatenated dataset was performed for 10 million generations, producing 18002 trees (after burn-in) which were summarized in a majority rule consensus tree (TL = 2947, CI = 0.4964, RI = 0.6746) (Fig. 4). The total evidence consensus tree was well supported: 13 nodes had 100% support, including the basal node to the ingroup (Fig. 4).

Figure 3

Bayesian majority rule consensus tree based on COI from bark beetle associated uropodoids.

Majority rule consensus tree of 38002 trees generated by Bayesian MCMC analysis (20 million generations) of 608 bp fragment of COI from 122 uropodoid specimens, 116 ingroup specimens representing 29 species, and six outgroup specimens representing four species (TL = 2021, CI = 0.2459, RI = 0.8277) (Uroob. =  Uroobovella, Trich. =  Trichouropoda, Nent. =  Nenteria). Posterior probability >50%/jackknife support >50%/Bremer support (JKS and BS from parsimony analysis).

Figure 4

Bayesian majority rule consensus tree based on COI and 28S from bark beetle associated uropodoids.

Majority rule consensus tree of 18002 trees generated by Bayesian MCMC analysis (10 million generations) of concatenated dataset of 608 bp fragment of COI and 1069 bp fragment of 28S from 31 specimens, 29 ingroup specimens representing 25 species, and two outgroup species (TL = 2947, CI = 0.4964, RI = 0.6746) (Uroob. =  Uroobovella, Trich. =  Trichouropoda, Nent. =  Nenteria). Posterior probability >50%/jackknife support >50%/partitioned Bremer support (COI, 28S) (JKS and PBS from parsimony analysis).

Parsimony

The parsimony heuristic analysis of COI resulted in 34 most parsimonious trees (TL = 1928, CI = 0.2578, RI = 0.8383) presented in a semistrict consensus tree (tree not shown). Many nodes had moderate to high JKS which were mapped onto the Bayesian analysis of COI (Fig. 3), 18 nodes had 100% jackknife support (JKS). Many nodes had poor Bremer support, with 24 nodes with moderate to strong support (≥10), as shown in the Bayesian phylogeny (Fig. 3). Nine of the nodes with 100% JKS and strong Bremer support are basal nodes to ingroup species. Similar to the BI, T. australis, T. californica, U. orri, U. dryocoetes, and U. americana had multiple unresolved nodes collapsing into intraspecific polytomies. The heuristic analysis of 28S produced 14 most parsimonious trees (TL = 1462, CI = 0.6895, RI = 0.8216) presented in a semistrict consensus tree (tree not shown). Most nodes had moderate to strong Bremer support and nearly every node had JKS, with 12 nodes having 100% JKS, one of which was the basal node to the ingroup. Multiple Trichouropoda species showed little interspecific divergence resulting in a large polytomy. The parsimony analysis of the concatenated dataset resulted in three most parsimonious trees (TL = 2924, CI = 0.5003, RI = 0.6797) presented in a semistrict consensus tree (tree not shown). Most nodes had moderate to strong JKS, with 10 nodes having 100% JKS, including the basal node to the ingroup and to the Trematuridae, and many nodes had moderate to strong PBS, as shown in the Bayesian analysis (Fig. 4).

Summary of Molecular Reconstructions

The parsimony and Bayesian analyses of COI, 28S and concatenated datasets yielded similar results. All COI analyses suggested that each trematurid (Trichouropoda and Nenteria) species was monophyletic, with the exception of T. moseri and T. polytricha. Trichouropoda moseri collected from Pityokteines sparsus consistently grouped separately from those collected from Polygraphus rufipennis. Trichouropoda polytricha collected from Ips cembrae from Switzerland was consistently shown to be more closely related to T. n.sp. 5 from Norway than to other North American T. polytricha specimens.

Overall, the relationships between trematurid species were poorly resolved using 28S, with slightly better resolution in the concatenated dataset, and the best resolution using COI alone. The D2–D4 region of 28S was not effective for examining the relationships between some closely related Trichouropoda species. The 28S and COI analyses were not entirely congruent. In all 28S reconstructions, T. hirsuta was basal to all other species in the genus, whereas T. n.sp. 2 was the basal species in COI reconstructions. COI and 28S also disagreed on the placement of T. fallax and T. alascae. COI provided more insight into the relationships between trematurid species than 28S. The concatenated dataset produced well-supported trees, which were more resolved than those based on 28S alone. The placement of a few Trichouropoda species differed between the 28S and concatenated reconstructions, reflecting the differences in trematurid species relationships independently inferred from COI versus 28S.

Across all reconstructions the monophyly of all Uroobovella species were well supported and the relationships between Uroobovella species were consistent across all analyses. In particular, U. orri, U. n.sp. 6, U. dryocoetes and U. australiensis appear to be most closely related to each other, whereas U. americana and U. vinicolora are most closely related to each other. Across all COI analyses there was a small well-supported clade grouping U. orri specimens from Orthotomicus caelatus beetles, which has been labeled as U. n.sp. 6.

To test whether host generalists displayed cryptic morphological diversity, the level of ‘intraspecific’ morphological divergence was assessed in five species with broad host ranges (T. australis, T. parisiana, T. polytricha, U. orri, U. dryocoetes), and two species with relatively narrow host ranges (T. californica and U. americana). Uroobovella orri was the only species of the seven examined that showed prominent morphological variation, with two apparent groupings in the ordination: mites from Orthotomicus caelatus, labelled as U. n.sp. 6, and mites from hosts (8 host spp.) other than O. caelatus (Fig. 5). The SSH MDS ordination (stress = 0.1571) (Fig. 5) and ANOSIM based on 14 morphological characters measured from 22 U. orri specimens indicate that U. orri and U. n.sp. 6 are significantly distinct morphologically (P = 0.01). Subsequently, slide-mounted specimens were examined closely for variation in discrete morphological characters that could be used to distinguish U. orri and U. n.sp. 6, but this investigation revealed no distinct character states. Mean COI divergence among U. n.sp. 6 specimens was low (0.5% ±0.31), where as the mean divergence between U. n.sp. 6 and other U. orri specimens from North America was 20 times higher (10.5% ±0.4).

Figure 5

SSH MDS ordination showing morphological dissimilarity among Uroobovella species.

Ordination with Bray-Curtis distance performed on measurements ((value – min)/range transformed) of 14 morphological characters from 22 uropodoids representing U. orri and U. n.sp. 6 (stress = 0.1571).

The remaining six generalist and two species with narrow host ranges displayed no significant intraspecific variation in morphometrics or discrete (qualitative) morphological characters; these species also showed low COI intraspecific divergence (<1%), with the exception of T. polytricha and T. parisiana with 4.6% (±3.8) and 2.8% (±2.7) divergence, respectively. The relatively high level of divergence among T. polytricha specimens was largely due to a single specimen from Switzerland; intraspecific divergence among North America specimens was 2% (±0.8).

Discussion

This study indicates that both partial COI and 28S D2–D4 are suitable markers for distinguishing between closely related uropodoid species, with 17% average divergence among species for both markers. 28S appears to be a good marker for separating closely related Uroobovella species, but COI was far more effective at delineating between Trichouropoda species. Most morphologically defined species were well supported in the COI phylogeny, with the exception of T. moseri and T. polytricha. The congruence between morphological and molecular data emphasizes the fact that the best approach is an integrative approach [42], and that morphology-based taxonomy is still relevant and essential [43].

Host Specificity and Cryptic Species

A total of 36 species of uropodoids, including 13 undescribed species, were collected in this study, and these mites exhibited various levels of host specificity. The majority of mite species were collected from one (64%) or two (17%) host species, and seven species (19%) had three or more host species. However, the opportunistic sampling used in this study and the haphazard coverage of hosts and regions may incur a bias towards higher apparent host specificity. Considering published host records, it appears that strict host specificity may be the exception rather than the rule. The observed host associations in this study nearly doubled the number of host records for the described species studied (54% increase from 87 records to 134), and this highlights the lack of knowledge in this group. Considering that only a small proportion of the global bark beetle fauna has been examined for uropodoids, we suspect that many more new and/or cryptic species may be uncovered with further investigations.

Typically, when the species boundaries of symbiotic taxa are assessed using molecular techniques it is revealed that apparent generalists are actually complexes of cryptic specialists (e.g. [5], [7], [44]). To the contrary, in this study molecular and morphological analyses suggested that putative host generalists do not represent complexes of cryptic species with narrower host ranges, but that they are truly single species with a broad host range, with the exception of one species (U. orri). It is possible that some of these apparent generalists comprise rare specialists that remain to be collected, or that additional markers may uncover cryptic specialists, but it is also possible that these species are truly generalists.

Uroobovella orri was the only host generalist that appears to represent at least two distinct species in North America, including a widespread generalist associated with at least eight species and six genera of hosts, and a specialist (U. n.sp. 6) associated with Orthotomicus caelatus (based on COI data). Interestingly, O. caelatus is a host-tree generalist and attacks many species of Pinus, Picea and Larix throughout its range [8]. In addition, the single specimen of U. orri found on Pityokteines curvidens (another conifer generalist) from Croatia may also represent a distinct cryptic species, based upon the level of COI divergence from other U. orri specimens (11.5% ±0.7). Considering that U. orri has been collected from many other bark beetle species that were not included in this study, it is possible that we have only begun to scratch the surface of a diverse complex of cryptic species.

In all COI reconstructions both T. moseri and T. polytricha were paraphyletic, and this may suggest that these two species represent multiple cryptic species associated with different hosts. Trichouropoda moseri collected from Pityokteines sparsus (Ipini) and Polygraphus rufipennis (Polygraphini) were paraphyletic, and these may represent two cryptic host-specific species rather than a single host generalist; however, no morphometric differences were found, and average COI divergence among T. moseri specimens was very low (0.4% ±0.2). Trichouropoda polytricha found on Ips cembrae from Switzerland was more closely related to T. n.sp. 5 from Norway (Pityogenes chalcographus) than to North American T. polytricha. Despite being apparently morphologically identical, it is possible that the North American and European T. polytricha represent two cryptic species. Alternatively, the paraphyly of T. moseri and T. polytricha may be a result of inadequate taxon sampling, or incomplete lineage sorting. More specimens and additional markers are needed to clarify the taxonomic boundaries of these two mites.

The host associations of the closely related uropodoids, T. parisiana and T. n.sp.1, are unique and likely warrant future investigations. Trichouropoda parisiana and T. n.sp. 1 were both associated with ambrosia beetles, an ecological grade of scolytine and platypodine curculionids that carry symbiotic fungi (in complex glandular mycangial structures) which is inoculated into host trees and cultivated as a food source [8]. Trichouropoda parisiana was collected from three distantly related ambrosia beetles, Gnathotrichus materiarius (Corthylini), Xyleborinus saxesenii (Xyleborini) and Trypodendron retusum (Xyloterini), which attack a broad range of unrelated host trees (Pinus and Picea spp.; numerous trees and shrubs; Populus spp., respectively) [8]. Trichouropoda n.sp. 1 is morphologically and genetically similar to T. parisiana, and it was only collected from Corthylus sp. (Corthylini), an ambrosia beetle associated with deciduous trees [8]. It is likely that a common ancestor of T. parisiana and T. n.sp. 1 was originally associated with ambrosia beetles, and that descendant populations tracked some aspect of the mycetophagous life history of their hosts. However, testing this hypothesis further will be difficult given that these two mites are associated with hosts that feed on unrelated host trees in different countries [8]. Trichouropoda n.sp. 6 and T. n.sp. 8 were also collected from ambrosia beetles, Camptocerus auricomis and Monarthrum dentigerum respectively; however, since neither species yielded COI or 28S data, the phylogenetic relationships between these species and T. parisiana and T. n.sp. 1 are not understood.

Coevolution

The evolutionary history of associated symbionts may reflect a long-term coevolutionary relationship, or it may reflect a history of host switching and ecological tracking [45], [46]. Overall, the evolution of scolytine-associated uropodoids shows little evidence of coevolution with their hosts or tracking ecologically similar host species. Phylogenetically related bark beetles [47]–[49] did not necessarily share the same or closely related mite species, and ecologically related host species, which have similar host tree ranges, overlapping geographic ranges or similar phenologies [8], [50] were not necessarily associated with the same or closely related uropodoid species.

An obstacle to the study of coevolution between bark beetles and uropodoids is that phylogenetically related hosts are often ecologically similar (e.g. host tree species, habitat range, feeding ecology, and phenology; [8], [50]), making it difficult to discern the determinants of host associations. For example, T. californica is phoretic on two sister-species, Ips hoppingi and I. confusus [49]. However, I. hoppingi and I. confusus are peripatric and similar ecologically, both feeding on pinyon pine (Pinus) species [8], and therefore it is very difficult to pinpoint the causal factor(s) in the association of T. californica with these two host species. Additionally, the ecology of bark beetle associated uropodoids are poorly understood, which hampers any interpretations of the extent to which mites may be tracking ecologically similar hosts. Future investigations into the extent to which uropodoids may be coevolving with their bark beetle hosts will require much more extensive taxon sampling than that of this study, as well as a more complete and resolved phylogeny of associated mites and their scolytine hosts, and an improved understanding of the ecology of these mites.