Literature DB >> 23049906

MiR-145 regulates epithelial to mesenchymal transition of breast cancer cells by targeting Oct4.

Jiajia Hu1, Hua Guo, Hongyan Li, Yan Liu, Jingjing Liu, Liwei Chen, Jin Zhang, Ning Zhang.   

Abstract

MiR-145 could regulate tumor growth, apoptosis, migration, and invasion. In our present study, we investigated its role in epithelial-mesenchymal transition (EMT). Expression of miR-145 was decreased in breast tumor tissues at T3&4 stages in comparison with those at T1&2. Over-expression of miR-145 mimics enhanced protein levels of E-cadherin and dampened those of α-SMA and Fibronectin, indicative of its inhibitory role in EMT occurrence. Mechanistic studies showed that miR-145 mimics inhibited Oct4 expression and miR-145 inhibitor enhanced it. Over-expression of Oct4 reversed miR-145-regulated expression of EMT markers, suggesting that Oct4 mediated the inhibitory effects of miR-145. MiR-145 could inhibite the expression of Snail, ZEB1, and ZEB2, while over-expression of Oct4 rescued the effects. Furthermore, Oct-4 induced over-expression of transcription factor Snail, ZEB1 and ZEB2 was mediated by β-catenin. Expression of Slug and Twist were not altered by miR-145/Oct4. Taken together, our results have revealed a novel role of miR-145 on EMT. It inhibits EMT by blocking the expression of Oct4, and downstream transcriptional factors, Snail, ZEB1 and ZEB2.

Entities:  

Mesh:

Substances:

Year:  2012        PMID: 23049906      PMCID: PMC3458807          DOI: 10.1371/journal.pone.0045965

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Metastasis, the major cause of mortality among cancer patients, is a multi-step process, including detachment of tumor cells from the primary sites, intravasation into circulation, migration along the circulation, extravasation to the secondary sites, and proliferation [1]. Epithelial-mesenchymal transition (EMT) plays a critical role during the initiation stage of metastasis. Immotile epithelial cells with the apical-basal polarity are converted to the motile, dispersed mesenchymal-like cells with spindle shape [2]. Consequently, tumor cells are detached from original sites and start to invade surrounding tissue. Enhanced motility of tumor cells is essential for the following steps of metastasis, such as invasion, intravasation and extravasation [3]. Thus, EMT is a pre-requisite step for cancer cell migration. Increasing reports have demonstrated that epigenetic dysregulation, as well as genomic instability, contributes to tumor metastasis. Abnormalities in DNA methylation or histone acetylation induce tumorigenesis and metastasis [4], [5]. MicroRNAs (miRNAs), a highly conserved group of small non-coding RNAs, regulate the expression of mRNA transcripts at post-transcriptional level [6]. Increasing evidences have proven that miRNAs take part in the regulation of many physiological and pathological processes, especially EMT and tumor metastasis [7], [8], [9], [10]. Gregory et al reported that miR-200 family and miR-205 mediated EMT through targeting ZEB1 and SIP1, which in turn regulated metastasis [11]. It has been documented that miR-21, miR-181a, miR-429, miR-137 and miR-661 were also involved in EMT [12], [13], [14], [15], [16]. Several reports have revealed that the expression level of miR-145 is decreased in various human cancers [17]. Early studies have shown that miR-145 plays an important role in suppressing tumor growth and promoting tumor apoptosis [18], [19], [20]. Recently, Xin et al pointed out that miR-145 and miR-143 could modulate cytoskeletal dynamics of smooth muscle cells in response to vascular injury [21]. Gotte et al and Sachdeva et al indicated that miR-145 suppressed breast cancer cell migration via inhibiting the expression of junctional adherin molecule A (JAMA), fascin and mucin1 [22]–[23]. Thus, it is clear that miR145 regulates the expression of proteins directly involved in cell migration. EMT is a key step before cancer cell invasion and migration. However, the role of miR-145 in EMT is still largely unknown. In a search for negative regulators of cancer cell chemotaxis, we identified that miR-145 inhibited breast cancer cell chemotaxis. During a preliminary characterization, we found that over-expression of miR-145 reversed the expression of EMT markers in MDA-MB-231 cells, suggesting that miR-145 suppressed EMT. In this study, we investigated the molecular mechanism of miR-145-mediated EMT in cancer cells, revealing a signaling pathway involving transcription factor Oct4 and Snail/ZEB1/ZEB2. Furthermore, our results have demonstrated that miR-145-mediated EMT is required for cancer cell to acquire migration and invasion properties.

Materials and Methods

Ethics Statement

This project entitled “MiR-145 regulates epithelial to mesenchymal transition of breast cancer cells by targeting Oct4” will analyze the expression of miR-145 in 41 fresh samples of human breast cancer specimens obtained from patients who underwent breast cancer surgery at the Cancer Hospital of Tianjin Medical University from January 2002 to December 2004. This project had the informed consents from all the patients. This study is consistent with the regulations of the Ministry of Health, ‘biomedical research involving human ethics review (tentative)” and the Declaration of Helsinki on Ethical Principles for Medical Research Involving Human Subjects.

MiR-145 inhibits cancer cell migration and EMT (A) Expression of miR-145 mimics inhibited EGF-induced chemotaxis in MDA-MB-231 cells.

Statistical analysis was performed by one-way ANOVA.*, P<0.01 versus control. Error bars indicating SD. (B) Expression of miR-145 mimics inhibited cell migration in a wound-healing assay. Statistical analysis was also performed by one-way ANOVA. (Points, mean of three independent experiments; bars, SD.) (C) Cell migration and invasion were inhibited upon treatment with miR-145 mimics. Statistical analysis was assessed by the two-tailed Student’s t test. Columns, mean of three independent experiments; bars, SD. (D) Expression of miR-145 mimics enhanced the expression of E-cadherin, and suppressed the expression of α–smooth muscle actin and Fibronectin. A representive data of there separate experiments is shown. (E) Expression of miR-145 was examined in breast tumor tissues from 41 patients.

Cell Culture

MDA-MB-231, SK-BR-3, BT-549, ZR-75-30 and T47D cells were obtained from the American Type Culture Collection (ATCC; Manassas, VA USA). All the cell lines were cultured at the normal conditions according to the protocol from ATCC.

Reagents and Antibodies

Micro-Boyden chambers for chemotaxis assay were obtained from Neuroprobe (Neuro Probe,Gaithersburg, MD USA ); miR-145 mimics, miR-145 inhibitor, miR-145 probe and U6 probe were all from Qiagen (QIAGEN, Hilden, Germany). Recombinant human epidermal growth factor (EGF) from R&D Systems (R&D Systems, Minneapolis, MN USA), Fibronectin from Sigma (Sigma, St Louis, MO USA), and Matrigel was from BD Biosciences (BD Biosciences, Franklin Lakes, NJ USA). Antibodies against Oct4, Fibronectin, Snail1, ZEB2, β-catenin and β-actin were from Santa Cruz Biotechnology (Santa Cruz Biotechnology, CA USA); E-cadherin from BD Biosciences; α-smooth muscle actin (α-SMA) from Sigma and ZEB1 was from AbCam (AbCam, Cambridge, UK). HRP-conjugated goat anti- mouse IgG and HRP-conjugated goat anti-rabbit IgG were brought from Santa Cruz Biotechnology (Santa Cruz Biotechnology,CA USA).The pGL3-Control Luciferase Report vector, pRL Renilla Luciferase Report vector and Dual-luciferase reporter assay system were all brought from Promega (Promega, Madison, WI USA) and pcDNATM3.1/ZEO (+) plasmid was form Invitrogen (Invitrogen, Carlsbad, CA USA).

MiR-145 directly targeted Oct4 in breast cancer cells.

(A) Identification of miR-145 target site in Oct4 mRNA 3′UTR. (B) Treatment with miR-145 mimics did not alter the mRNA levels of Oct4. (C) Treatment with miR-145 mimics inhibited the protein levels of Oct4. (D) Treatment with miR-145 inhibitor enhanced the protein levels of Oct4. (E) Treatment with miR-145 mimics inhibited translational activity of a luciferase-expressing plasmid containing a 3′-UTR from Oct4. Statistical analysis was performed by t test. Values in B and E are shown as means±SD of three independent experiments. *, P<0.01, significance difference between two compared groups. Error bar indicates SD. (F) Western blot assay showed that knockdown of Oct-4 inhibited the expression of β-catenin while overexpression of Oct-4 enhanced it.

miRNA Microarray Experiments

For miRNA microarray experiments, total RNA samples were analyzed by CapitalBio (CapitalBio Corp, Beijing, China). Procedures were performed as described in detail on the website of CapitalBio (http://www.capitalbio.com). Image intensities were measured as a function of the median of foreground minus the background, as previously described [24]. Raw data were normalized and analyzed in GenePix Pro 4.0 software (Axon Instruments). Expression data were median-centered using the global median normalization function of the Bioconductor package (http://www.bioconductor.org). Statistical comparisons were performed with the SAM software [25].

Over-expression of Oct4 rescued the inhibitory effects of miR-145 on EMT.

(A) Over-expression of Oct4 reversed miR145-elicited protein expression profiles of E-cadherin, N-cadherin, α–smooth muscle actin and Fibronectin. A Western blot representative of 3 independent experiments is shown. (B) Over-expression of Oct4 rescued miR-145-suppressed cancer cell migration and invasion. Statistical analysis was performed by t test. The data are shown as means±SD for triplicate measurement. *, P<0.01, significant difference; Bars, SD.

Snail, ZEB1, and ZEB2 are the downstream molecules of miR-145/Oct4 in MDA-MB-231, BT-549, ZR-75-30 and T47D cells.

(A) MiR-145/Oct4 did not alter the expression of Slug and Twist. (B), (C) and (D) Real-time PCR and Western blot assay showed that miR-145/Oct4 regulated the expression of Snail, ZEB1 and ZEB2 both in mRNA level and protein level. Statistical analysis was performed by t test. Columns, mean of three separate experiments; Error bars show the SD of three independent experiments measured in triplicate. *, P<0.01, significant difference between two compared groups. (E) Western blot assay showed that down-regulation of β-catenin inhibited Oct-4 induced expression of ZEB1, ZEB2 and Snail in MDA-MB-231, BT-549, ZR-75-30 and T47D cells.

RNA Extraction, Reverse Transcription PCR and Real-time PCR Assay

The materials consisted of 41 patients due to breast cancer who had not undergone chemotherapy or radiotherapy prior to surgery between 2002 and 2004. The samples of patients were obtained from the department of tissue library, Tianjin Cancer Institute and Hospital, Tianjin Medical University, China. Total RNA was collected by using Trizol (Invitrogen). Real-time PCR was carried out by using miScript SYBR Green PCR kit (Qiagen). For transcription factor detection, 2 µg of total RNA was used to perform reverse transcription by using TransScript First-strand cDNA Synthesis SuperMix kit. The real-time PCR was performed by using STBR Premix Ex Taq™ kit (TaKaRa Bio,Otsu, Japan). The primers of miR-145 and U6 are acquired from miScript Primer assays kit (Qiagen). The primers for the detection of transcription factors were list in Table 1.
Table 1

Primer Sequences.

TargetForward primer sequenceForward primer sequence
Oct4 AAGCGATCAAGCAGCGAC GGAAAGGGACCGAGGAGTA
Snail CCTCCCTGTCAGATGAGGAC CCAGGCTGAGGTATTCCTTG
Slug GGGGAGAAGCCTTTTTCTTG TCCTCATGTTTGTGCAGGAG
ZEB1 TTCAAACCCATAGTGGTTGCT TGGGAGATACCAAACCAACTG
ZEB2 TTCCTGGGCTACGACCATAC TGTGCTCCATCAAGCAATTC
Twist GGAGTCCGCAGTCTTACGAG TCTGGAGGACCTGGTAGAGG
GAPDH ACCCAGAAGA CTGTGGATGG TCTAGACGGCAGGTCAGGTC

Chemotaxis, Wound-healing Assay and Invasion Assay

Chemotaxis assay was performed as previous report [26]. The 10 µm filter membrane should be pretreated with 10 µg/ml of Fibronectin at 4°C overnight. For wound-healing assay, scrape wounds were created with a sterile pipette tip in a 6-well plate and the wound distances were measured at different time points (0, 3, 6, 9, 12, 24 hours) under the microscope. Matrigel-coated invasion inserts (BD Biosciences) with 8 µm pore membrane were used for invasion assays.

MiR-145 inhibited EMT and cell migration.

(A) MiR-145 regulated EMT through Oct4 and its downstream transcriptional factors, Snail, ZEB1, and ZEB2. (B)Treatment with miR-145 mimics in BT-549, ZR-75-30 and T47D cells inhibited the protein levels of Oct4. Treatment with miR-145 inhibited cell migration (C) and invasion (D) in another three breast cancer cell lines BT-549, ZR-75-30 and T47D. Statistical analysis was performed by t test. Values in B and C are means±SD of three independent experiments. *, P<0.01, significant difference between two compared groups.

Immunoblotting

Oct4 (1∶200), E-cadherin (1∶1000), α-SMA (1∶800), Vimentin (1∶5000), Fibronectin (1∶250), ZEB1 (1∶200), ZEB2 (1∶200), Snail (1∶500) and β-actin (1∶5000) antibodies were used for Western blot assay. Secondary horseradish peroxidase-conjugated goat anti- mouse or rabbit antibodies (Bio-Rad) were used at a 1∶5000 dilution and detected by the enhanced chemiluminescence reagent (Millipore, Billeria, MA USA).

Luciferase Assay

We cloned the sequence of human Oct4 3′UTR into pGL3-Control Luciferase reporter vector, then co-transfected pre-miR-145 or negative control sequence into MDA-MB-231 cells under the control of human pGL3-Control Luciferase reporter vector inserted with human Oct4 mRNA 3′UTR or without insert for luciferase assay. pRL renilla luciferase reporter vector was as internal control in each assay. At 48 h after transfection, cell lysates were collected and measured the luminometers both the firefly luciferase luminescence and the renilla luciferase luminescence in the same well of a 96-well format in the luminometer.

Statistical Analysis

Results were expressed as the means±SD. Statistical analysis of significance was calculated using one-way ANOVA.

Results

Expression of miR-145 Suppressed EMT

Chemotaxis plays an essential role in metastasis [27]. In a search for microRNAs that negatively regulated chemotaxis and metastasis, eight pairs of breast cancer samples and matched adjacent normal tissues were screened by using miRNA gene chip V3.0 (from Capital Bio Corp.). As shown in Table 2, ten microRNAs showed significant decrease in cancer tissues, consistent with previous reports [28]. Among them, expression of miR-145 mimics blocked EGF-induced chemotaxis in MDA-MB-231 cells, a highly metastatic breast cancer cell (Fig. 1A). Wound-healing assay results further confirmed that miR-145 suppressed cancer cell migration (Fig. 1B). Furthermore, upon expression of miR145 mimics, migration and invasion, induced by NIH3T3 cell conditioned medium, were inhibited (Figure 1C).
Table 2

miRNA differentially expressed between breast cancer tissues and adjacent normal tissues.

miRNA NameGene IDFold changeLocation
has-miR-199-5p406976 0.43690819p13.2
has-miR-4975744560.29747517p13.1
has-miR-1324069210.40838917p13.3
has-miR-1454069370.4465195q32
has-miR-1434069350.5900195q32
has-miR-10a4069020.75521217q21.32
has-miR-10b4069030.5457842q31.1
has-miR-7b4068840.70229322q13.31
has-miR-7c4068850.62623621q21.1
has-miR-12+4069130.7643649q34.3
Figure 1

MiR-145 inhibits cancer cell migration and EMT (A) Expression of miR-145 mimics inhibited EGF-induced chemotaxis in MDA-MB-231 cells.

Statistical analysis was performed by one-way ANOVA.*, P<0.01 versus control. Error bars indicating SD. (B) Expression of miR-145 mimics inhibited cell migration in a wound-healing assay. Statistical analysis was also performed by one-way ANOVA. (Points, mean of three independent experiments; bars, SD.) (C) Cell migration and invasion were inhibited upon treatment with miR-145 mimics. Statistical analysis was assessed by the two-tailed Student’s t test. Columns, mean of three independent experiments; bars, SD. (D) Expression of miR-145 mimics enhanced the expression of E-cadherin, and suppressed the expression of α–smooth muscle actin and Fibronectin. A representive data of there separate experiments is shown. (E) Expression of miR-145 was examined in breast tumor tissues from 41 patients.

Next, we tested the hypothesis that miR-145 inhibited cancer cell migration by blocking EMT. Over-expression of miR-145 mimics enhanced expression of E-cadherin and impaired expression of α-SMA and Fibronectin, suggesting that miR-145 suppressed EMT (Figure 1D). If miR-145 negatively regulated EMT, it would be expected to detect a decrease in miR-145 in highly malignant tumors. Indeed, analysis of 41 breast cancer tissues (14 samples at stage T1, 14 samples at stage T2, 13 samples at stage T3&4) revealed a loss of miR-145 expression in stage T3&4 cancer samples (Fig. 1E). Taken together, our results revealed that miR-145 inhibited cancer cell migration, probably due to its inhibition of EMT.

A Transcription Factor, Oct4, was a Direct Target of miR-145 in Breast Cancer Cells

Based on sequence analysis, we hypothesized that miR-145 inhibited Oct4 which in turn mediated EMT in breast cancer cells (Fig. 2A). Expression of miR-145 mimics inhibited Oct4 protein expression, but not mRNA levels, suggesting that miRNA-145 regulated Oct4 translation, not transcription level (Fig. 2B&2C). Treatment with a miR-145 inhibitor enhanced Oct4 protein levels (Fig. 2D). Upon expression of miR-145 mimics, luciferase activities were significantly impaired in cells transfected with a plasmid containing 3′UTR of Oct4 mRNA, indicating a direct interaction between miR145 and Oct4 mRNA in breast cancer cells (Fig. 2E). WNT/β-catenin regulates EMT [29]. In MDA-MB-231 cells, knockdown of Oct4 inhibited the expression of β-catenin while overexpressing Oct4 enhanced the expression of β-catenin (Figure 2F).
Figure 2

MiR-145 directly targeted Oct4 in breast cancer cells.

(A) Identification of miR-145 target site in Oct4 mRNA 3′UTR. (B) Treatment with miR-145 mimics did not alter the mRNA levels of Oct4. (C) Treatment with miR-145 mimics inhibited the protein levels of Oct4. (D) Treatment with miR-145 inhibitor enhanced the protein levels of Oct4. (E) Treatment with miR-145 mimics inhibited translational activity of a luciferase-expressing plasmid containing a 3′-UTR from Oct4. Statistical analysis was performed by t test. Values in B and E are shown as means±SD of three independent experiments. *, P<0.01, significance difference between two compared groups. Error bar indicates SD. (F) Western blot assay showed that knockdown of Oct-4 inhibited the expression of β-catenin while overexpression of Oct-4 enhanced it.

Over-expression of Oct4 Rescued miR-145 Mediated Suppression of EMT

In order to further investigate the role of Oct4 in miR-145- elicited EMT, an Oct4 over-expression vector was transfected into MDA-MB-231 cells treated with or without miR-145 mimics. Expression of miR-145 mimics inhibited Oct4 expression while over-expression of Oct4 reversed the inhibitory effects (Fig. 3A). Furthermore, over-expression of Oct4 reversed expression of E-cadherin, N-cadherin, α-SMA, and Fibronectin in cells treated with miR-145 mimics, suggesting that miR-145 suppressed EMT via Oct4 (Fig. 3B&3C). Consequently, over-expression of Oct4 also rescued the migration and invasion defects induced by miR-145 (Fig. 3D). Thus, our results suggest that Oct4 plays an important role in miR-145 regulated EMT of breast cancer cells.
Figure 3

Over-expression of Oct4 rescued the inhibitory effects of miR-145 on EMT.

(A) Over-expression of Oct4 reversed miR145-elicited protein expression profiles of E-cadherin, N-cadherin, α–smooth muscle actin and Fibronectin. A Western blot representative of 3 independent experiments is shown. (B) Over-expression of Oct4 rescued miR-145-suppressed cancer cell migration and invasion. Statistical analysis was performed by t test. The data are shown as means±SD for triplicate measurement. *, P<0.01, significant difference; Bars, SD.

Expression of Snail, ZEB1 and ZEB2 was Regulated by miR-145/Oct4 Signaling Pathway

Extensive studies have reported that a number of transcription factors, including Snail, Slug, Twist, ZEB1, and ZEB2, regulated EMT during tumorigenesis [30], [31]. Treatment with miR-145 mimics significantly decreased the expression of Snail, ZEB1, ZEB2, but not Slug or Twist, at both mRNA and protein levels in four breast cancer cell lines MDA-MB-231, BT-549, ZR-75-30 and T47D. Over-expression of Oct4 enhanced the mRNA and protein levels of Snail, ZEB1, and ZEB2 (Fig. 4, A, B, C, and D). Thus, our results suggest that Snail, ZEB1, and ZEB2, three regulators of EMT, are the downstream effectors of miR-145/Oct4 pathway. It has been reported that β-catenin regulates the expression of Snail, ZEB1 &2 [29], [32], [33]. Thus, we tested the hypothsis that over-expression of transcription factor Snail, ZEB1 and ZEB2 induced by Oct4 was mediated by β-catenin. Indeed, knockdown of β-catenin dampened Oct-4 induced expression of Snail, ZEB1 &2. Taken together, our results suggest that miR-145/Oct-4 regulate the expression of Snail, ZEB1 and ZEB2 through β-catenin in MDA-MB-231, BT-549, ZR-75-30 and T47D cells.
Figure 4

Snail, ZEB1, and ZEB2 are the downstream molecules of miR-145/Oct4 in MDA-MB-231, BT-549, ZR-75-30 and T47D cells.

(A) MiR-145/Oct4 did not alter the expression of Slug and Twist. (B), (C) and (D) Real-time PCR and Western blot assay showed that miR-145/Oct4 regulated the expression of Snail, ZEB1 and ZEB2 both in mRNA level and protein level. Statistical analysis was performed by t test. Columns, mean of three separate experiments; Error bars show the SD of three independent experiments measured in triplicate. *, P<0.01, significant difference between two compared groups. (E) Western blot assay showed that down-regulation of β-catenin inhibited Oct-4 induced expression of ZEB1, ZEB2 and Snail in MDA-MB-231, BT-549, ZR-75-30 and T47D cells.

MiR-145 Inhibited Cell Migration by Blocking Oct4-mediated EMT in Breast Cancer Cells

Based on the above investigation of breast cancer tissues and MDA-MB-231 cells, a novel mechanism was proposed to explain the role of miR-145 in regulating cancer cell migration and metastasis (Fig. 5A). During the progress of tumorigenesis, a decrease in miR-145 expression promoted the expression of Oct4, which in turn stimulated the expression of Snail, ZEB1, and ZEB2, three key transcriptional factors, through β-catenin. Consequently, cancer cells switched from polarized epithelial-like cells to mobile mesenchymal-like cells, as indicated by the expression of EMT markers. To demonstrate that miR-145 played a general role, several additional breast cancer BT-549, ZR-75-30, and T47D cells were tested. Expression of miR-145 mimics inhibited Oct4 protein expression in these three cell lines (Fig. 5B). As shown in Fig 5 C and D over-expression of miR-145 inhibited migration and invasion of BT-549, ZR-75-30, and T47D cells, consistent with our hypothesis.
Figure 5

MiR-145 inhibited EMT and cell migration.

(A) MiR-145 regulated EMT through Oct4 and its downstream transcriptional factors, Snail, ZEB1, and ZEB2. (B)Treatment with miR-145 mimics in BT-549, ZR-75-30 and T47D cells inhibited the protein levels of Oct4. Treatment with miR-145 inhibited cell migration (C) and invasion (D) in another three breast cancer cell lines BT-549, ZR-75-30 and T47D. Statistical analysis was performed by t test. Values in B and C are means±SD of three independent experiments. *, P<0.01, significant difference between two compared groups.

Discussion

Our study has indicated a critical role of miR-145 in EMT and revealed its molecular mechanism. Our results suggest that miR145 targets genes essential for EMT, a prerequisite step for migration and invasion during metastasis. MiR145 targets Oct4 in cancer cells, which in turn regulates the expression and function of β-catenin. Oct-4/β-catenin regulates the expression of Snail, ZEB1&2, three transcriptional factors in EMT. Consequently, tumor cells acquire properties of mesenchymal cells, and become invasive and migratory. The results from immunohistochemical analysis of 41 clinical samples showed that miR-145 expression correlated with aggravation of breast cancer, supporting a role of miR-145 in EMT. Apparently, miR-145 is just one of the regulators. Slug and Twist, another two important transcriptional factors in EMT, may be regulated by other mechanisms. Taken together, our results suggest miR-145/Oct4 plays a balanced regulatory role in EMT. The function of miR-145 appears to be cell type specific. Xu et al have demonstrated that miR-145 could repress pluripotency in human embryonic stem cell by direct targeting Oct4, Sox2 and Klf4 [34]. Takahashi et al demonstrated that co-transfection of Oct4, Sox2, Klf4, and c-Myc could reprogram human fibroblasts to generate induced pluripotent cells [35]. Li et al have shown that Oct4 and Sox2 could suppress the pro-EMT signals in mouse fibroblasts, thus promoting the MET occurrence [36]. Thus, in fibroblast cells, miR-145 appears to promote the EMT program. However, miR-145 clearly suppresses EMT and its inhibitory role in metastasis has been well-documented. So, we speculate that miR-145/Oct4 may play different roles in normal cells and tumor cells. The molecular mechanism behind such difference needs further investigation. In sum, we have identified miR-145 as one of the key blockers of EMT in cancer. It exerts its function by specifically inhibits the expression of Oct4/β-catenin. We identified Slug, ZEB1, and ZEB2 as the specific downstream effectors of Oct4 in cancer cells. Due to its multiple roles in tumor formation and metastasis, miR-145 may serve as an effective target for cancer diagnosis and therapy.
  36 in total

Review 1.  Cancer metastasis: building a framework.

Authors:  Gaorav P Gupta; Joan Massagué
Journal:  Cell       Date:  2006-11-17       Impact factor: 41.582

2.  mTOR complex component Rictor interacts with PKCzeta and regulates cancer cell metastasis.

Authors:  Fei Zhang; Xiaofang Zhang; Menghui Li; Peng Chen; Bin Zhang; Hua Guo; Wenfeng Cao; Xiying Wei; Xuchen Cao; Xishan Hao; Ning Zhang
Journal:  Cancer Res       Date:  2010-10-26       Impact factor: 12.701

3.  A sensitive array for microRNA expression profiling (miChip) based on locked nucleic acids (LNA).

Authors:  Mirco Castoldi; Sabine Schmidt; Vladimir Benes; Mikkel Noerholm; Andreas E Kulozik; Matthias W Hentze; Martina U Muckenthaler
Journal:  RNA       Date:  2006-03-15       Impact factor: 4.942

4.  MicroRNAs as tumor suppressors.

Authors:  Scott M Hammond
Journal:  Nat Genet       Date:  2007-05       Impact factor: 38.330

5.  miChip: an array-based method for microRNA expression profiling using locked nucleic acid capture probes.

Authors:  Mirco Castoldi; Sabine Schmidt; Vladimir Benes; Matthias W Hentze; Martina U Muckenthaler
Journal:  Nat Protoc       Date:  2008       Impact factor: 13.491

6.  The role of microRNA genes in papillary thyroid carcinoma.

Authors:  Huiling He; Krystian Jazdzewski; Wei Li; Sandya Liyanarachchi; Rebecca Nagy; Stefano Volinia; George A Calin; Chang-Gong Liu; Kaarle Franssila; Saul Suster; Richard T Kloos; Carlo M Croce; Albert de la Chapelle
Journal:  Proc Natl Acad Sci U S A       Date:  2005-12-19       Impact factor: 11.205

7.  Protein kinase C zeta is required for epidermal growth factor-induced chemotaxis of human breast cancer cells.

Authors:  Ronghua Sun; Ping Gao; Lin Chen; Dalong Ma; Jiming Wang; Joost J Oppenheim; Ning Zhang
Journal:  Cancer Res       Date:  2005-02-15       Impact factor: 12.701

8.  Induction of pluripotent stem cells from adult human fibroblasts by defined factors.

Authors:  Kazutoshi Takahashi; Koji Tanabe; Mari Ohnuki; Megumi Narita; Tomoko Ichisaka; Kiichiro Tomoda; Shinya Yamanaka
Journal:  Cell       Date:  2007-11-30       Impact factor: 41.582

9.  The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1.

Authors:  Philip A Gregory; Andrew G Bert; Emily L Paterson; Simon C Barry; Anna Tsykin; Gelareh Farshid; Mathew A Vadas; Yeesim Khew-Goodall; Gregory J Goodall
Journal:  Nat Cell Biol       Date:  2008-03-30       Impact factor: 28.824

10.  Endogenous human microRNAs that suppress breast cancer metastasis.

Authors:  Sohail F Tavazoie; Claudio Alarcón; Thordur Oskarsson; David Padua; Qiongqing Wang; Paula D Bos; William L Gerald; Joan Massagué
Journal:  Nature       Date:  2008-01-10       Impact factor: 49.962

View more
  29 in total

1.  Tocopherols inhibit estrogen-induced cancer stemness and OCT4 signaling in breast cancer.

Authors:  Min Ji Bak; Philip Furmanski; Naing Lin Shan; Hong Jin Lee; Cheng Bao; Yong Lin; Weichung Joe Shih; Chung S Yang; Nanjoo Suh
Journal:  Carcinogenesis       Date:  2018-07-30       Impact factor: 4.944

2.  Long non-coding RNAs as novel biomarkers for breast cancer invasion and metastasis.

Authors:  Kaijiong Zhang; Zhenglian Luo; Yi Zhang; Xiaoyu Song; Li Zhang; Lichun Wu; Jinbo Liu
Journal:  Oncol Lett       Date:  2017-06-22       Impact factor: 2.967

3.  A selective screening platform reveals unique global expression patterns of microRNAs in a cohort of human soft-tissue sarcomas.

Authors:  Peter Y Yu; Mumtaz Y Balkhi; Katherine J Ladner; Hansjuerg Alder; Lianbo Yu; Xiaokui Mo; William G Kraybill; Denis C Guttridge; O Hans Iwenofu
Journal:  Lab Invest       Date:  2016-02-15       Impact factor: 5.662

Review 4.  MicroRNAs targeting prostate cancer stem cells.

Authors:  Yu-Xiang Fang; Yun-Li Chang; Wei-Qiang Gao
Journal:  Exp Biol Med (Maywood)       Date:  2015-05-12

Review 5.  MicroRNAs in breast cancer: oncogene and tumor suppressors with clinical potential.

Authors:  Wei Wang; Yun-ping Luo
Journal:  J Zhejiang Univ Sci B       Date:  2015-01       Impact factor: 3.066

6.  Identification of miR-145 targets through an integrated omics analysis.

Authors:  Tai-Chung Huang; Santosh Renuse; Sneha Pinto; Praveen Kumar; Yi Yang; Raghothama Chaerkady; Brian Godsey; Joshua T Mendell; Marc K Halushka; Curt I Civin; Luigi Marchionni; Akhilesh Pandey
Journal:  Mol Biosyst       Date:  2014-10-30

Review 7.  The Role of MicroRNA in the Regulation of Tumor Epithelial-Mesenchymal Transition.

Authors:  Jing Feng; Shaofan Hu; Keli Liu; Guiyin Sun; Yiguo Zhang
Journal:  Cells       Date:  2022-06-21       Impact factor: 7.666

8.  SNAI2 modulates colorectal cancer 5-fluorouracil sensitivity through miR145 repression.

Authors:  Victoria J Findlay; Cindy Wang; Lourdes M Nogueira; Katie Hurst; Daniel Quirk; Stephen P Ethier; Kevin F Staveley O'Carroll; Dennis K Watson; E Ramsay Camp
Journal:  Mol Cancer Ther       Date:  2014-09-23       Impact factor: 6.261

9.  miR-145 Antagonizes SNAI1-Mediated Stemness and Radiation Resistance in Colorectal Cancer.

Authors:  Yun Zhu; Cindy Wang; Scott A Becker; Katie Hurst; Lourdes M Nogueira; Victoria J Findlay; E Ramsay Camp
Journal:  Mol Ther       Date:  2018-01-04       Impact factor: 11.454

10.  Embryonic stem cells markers SOX2, OCT4 and Nanog expression and their correlations with epithelial-mesenchymal transition in nasopharyngeal carcinoma.

Authors:  Weiren Luo; Siyi Li; Bailu Peng; Yanfen Ye; Xubin Deng; Kaitai Yao
Journal:  PLoS One       Date:  2013-02-12       Impact factor: 3.240

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.