Literature DB >> 22882737

What is known on angiogenesis-related rare diseases? A systematic review of literature.

Luis Rodríguez-Caso1, Armando Reyes-Palomares, Francisca Sánchez-Jiménez, Ana R Quesada, Miguel Ángel Medina.   

Abstract

Angiogenesis, the formation of new vessels from pre-existing ones, is essential during ontogenetic development and is related to many important physio-pathological processes in the adult. In fact, a persistent and deregulated angiogenesis is a required event for many diseases and pathological situations, including cancer progression and metastasis. Some rare diseases are also angiogenesis-related pathologies. However, there is a lack of an exhaustive review on the topic. The main purpose of this work is to carry out a systematic review of literature to determine what (and how much) scientific information concerning angiogenesis-related rare diseases can be extracted from available sources. After exhaustive searches in bibliographic databases, preselected data were filtered by selecting only those articles on rare diseases with an Orpha number hosted in the Orphanet web. The selected bibliographic references were further curated manually. With the 187 selected references, a critical reading and analysis was carried out allowing for an identification and classification of angiogenesis-related rare diseases, the involved genes and the drugs available for their treatment, all on the basis of the information available in Orphanet database.
© 2012 The Authors Journal of Cellular and Molecular Medicine © 2012 Foundation for Cellular and Molecular Medicine/Blackwell Publishing Ltd.

Entities:  

Mesh:

Substances:

Year:  2012        PMID: 22882737      PMCID: PMC4393717          DOI: 10.1111/j.1582-4934.2012.01616.x

Source DB:  PubMed          Journal:  J Cell Mol Med        ISSN: 1582-1838            Impact factor:   5.310


Introduction

A disease is considered rare when its low incidence becomes a problem to be added, making more difficult its accurate diagnosis and decreasing the interest in its research and the development of drugs for its treatment. According to the definition provided by the European Union, rare diseases are those with prevalence values lesser than 5/10,000 and leading patients to higher risk of death or chronic disability. Although it is difficult to estimate the exact number of rare diseases, most probably this number is within the range 6000–8000. More than 2000 rare diseases have already one or more genes assigned; see (http://www.rdplatform.org) and 1. The greatest database on the subject, Orphanet (http://www.orpha.net/consor/cgi-bin/index.php) contains information on almost 6000 rare diseases. Therefore, although each rare disease is infrequent, altogether rare diseases affect to 6–8% of total population in developed countries. Currently, more than 30 millions of European citizens suffer from some kind of rare disease and are exposed to discriminatory medical care benefits. Different projects have been financed under the Programme for Community Action on Rare Diseases in 1999–2003; the EU Public Health Programme 2003–2007 and the second EU Health Programme 2008–2013 (http://ec.europa.eu/health/rare_diseases/projects/cooperation/index_en.htm). A fundamental question arises: how to get access to this highly specialized and very reduced knowledge area where each described rare disease becomes an isolated particularity? A reasonable option could be the comparative study of analogies among different rare diseases (http://www.orpha.net/consor/cgi-bin/Education_Home.php?lng=EN). However, the low prevalence (the fact of being rare) is the only descriptor that—by definition—can be applied in any methodology for the systemic study of all or a group of rare diseases. This description based on low prevalence is crucial for the integration of medical policies in the framework of rare diseases, but on the other hand it contributes nothing to the molecular description of rare diseases and the physio-pathological relationships they could share. This is the current situation, in spite of the fact that next-generation sequencing technologies and exome analysis are making possible to identify molecular markers for some rare diseases 2. The specification of classification systems able to order the collected information on a disease according to coherent categories and criteria plays an essential role in biomedical sciences. In particular, this is of paramount importance for the description and diagnosis of rare diseases and for the adoption of decisions concerning health care, clinical and therapeutical indications and derivation of patients to specialists. In this context, Orphanet and WHO (World Health Organization) are currently making important efforts for the future specification of the international classification of diseases ICD11 (http://www.who.int/classifications/icd/revisionnews/en/), which will include rare diseases for the first time 3. Unfortunately, there is still a lack of a clinical identification accredited for this kind of diseases. In consequence, the search for information on rare diseases remains complex and diffuse. Specific problems also arise from the usual way in which the scientific literature is written. Unfortunately, scientific literature does not use to identify rare diseases as such and the identifiers for them proposed (i.e. ORPHA or OMIM IDs) are scarcely mentioned. In consequence, the search of information on rare diseases through the primary sources of scientific documentation is not an easy task. In fact, the finding of common relationships among diseases depends mainly on the reduced and specialized area of knowledge that dominates each rare disease, a fact that severely limits the visibility of these relationships. Far beyond the epidemiological, clinical and molecular studies and decision making in public health, the adoption of wider and more general and holistic approaches could become a new way to access to new knowledge in this area. The implementation of informatics resources to extract data from scientific literature and to analyze and enrich this information is currently contributing to the advancement of knowledge in biomedicine. This could be a powerful strategy to establish emerging sources of knowledge also in the specific field of rare diseases. A systematic review and collection of relevant information contained in diverse sources of scientific information and documentation could provide new valuable, emergent information concerning rare diseases. In the present work, we apply this systemic approach to get a deeper insight on the current knowledge of angiogenesis-related rare diseases (A-RDs). Angiogenesis, the formation of new vessels from the pre-existing vasculature, is one main mechanism of vascularisation during normal and specific physiological processes, such as embryonic development, growth, regeneration, wound healing and formation of corpus luteum and endometrium. Angiogenesis attracted wide interest in the scientific community when the pioneering hypothesis of Judah Folkman in 1971 that tumor progression and metastasis are dependent on angiogenesis (and, as such, cancer could be therapeutically attacked by inhibiting angiogenesis) began to be confirmed by experimental studies since the eighties 4–6. In fact, inhibition of this process has become a major challenge in the development of new anticancer agents, with more than 40,000 scientific papers published on this subject, and about a hundred anti-angiogenic compounds entered in clinical trials, and numerous others in preclinical development 7–9. Currently, it is well established that a deregulated and persistent angiogenesis is one of the hallmarks of cancer 10,11. Furthermore, there is overwhelming evidence on the involvement of deregulated angiogenesis in many other pathological situations, which are currently described as angiogenesis-dependent diseases 12. The interest and impact of angiogenesis as a new therapeutical target from the treatment of non-oncological angiogenesis-dependent diseases is well represented by the recent concession of the Lasker-Debakey Clinical Medical Research Award 2010 to Dr. Napoleone Ferrara for the discovery of VEGF as a major mediator of angiogenesis and the development of an effective anti-VEGF therapy for wet macular degeneration, a leading cause of blindness in the elderly 13. This is a type of age-related macular degeneration, included as a rare disease in the Orphanet website with the Orpha number ORPHA279. Other two examples of A-RDs are POEMS syndrome (ORPHA2905) 14,15 and Amyotrophic lateral sclerosis (ORPHA803) 16. In fact, a number of the so far described rare diseases are infrequent types of neoplasia, most probably related to angiogenesis. Furthermore, many other rare diseases could be related to angiogenesis. However, there is a lack of an exhaustive and systematic review on the topic “angiogenesis related rare diseases”. To contribute to fill this gap is the main aim of the present review. To reach this goal, our group can make use or our previous experience in the management of databases and the implementation of bioinformatics tools 17–19. As a research group integrated in the Spanish Network of Rare Disease Research (http://www.ciberer.es/index.php?lang=english), we are actively involved in the search of new sources of knowledge in this research area. In the present work, we aim to evaluate how much and what kind of information we are able to uncover in the context of A-RDs. Furthermore, we also evaluate what kind of information contained in Orphanet can be extracted within the frame of our systematic search.

Methods

State of the art

The aim of this study was to perform a systematic study on the following question: what scientific information can be drawn from those rare diseases that are related to the topic called angiogenesis? To this end, we adapted the methodology stated in PRISMA statement (http://www.prisma-statement.org/statement.htm) for the systematic review of the whole set of documents that could be extracted from the databases used in this study 20,21. Table S1 in Supplementary material is the completed PRISMA checklist.

Strategy for the literature search

Eligibility criteria

Types of studies: This is a bibliometric study for the capture and identification of rare diseases appearing in different sources of scientific documentation and that are somehow related to angiogenesis. Report eligibility: The scientific information specified in the previous section was exhaustively collected from scientific publications, namely, reviews, articles, case reports, proceedings and patents. The publication time ranged from 1991 to 2010 and there was no restriction concerning language or kind of publication. This search was dated in June of 2010 and updated in December of 2010. The whole set of collected rare diseases related to angiogenesis was submitted to a filter and selection procedure, according to their presence or not within a specialized database for rare diseases (Orphanet).

Information sources

For the selection of scientific publications concerning rare diseases somehow related to angiogenesis, an online search of literature was carried out in both PubMed and ISI Web of Knowledge databases. Search terms used were “rare disease” as a generic term and “angiogen*”. The use of the two terms “rare” and “disease” juxtaposed allowed to include any pathology with its name before the search term “disease” (i.e. Castleman disease, Von Willebrand disease, Wilson disease, Menkes disease, Crohn disease, among others) and made possible to associate the search term “rare” with other related semantic terms, such as in the cases of rare tumor, rare pathology or rare disorder, among others. Finally, the term “angiogen*” was used as a root belonging to the generic term of angiogenesis and/or all possible variants. As mentioned above, to validate the rare diseases found in this initial literature search, Orphanet database was used. Only those rare diseases contained and indexed within this database were confirmed and used for the rest of the study.

Search

In PubMed database, search terms were introduced in Advanced search without time limit or any other limit and listed as “(rare disease) AND angiogen*”, according to the following structured search: “rare diseases”[MeSH Terms] OR (“rare”[All Fields] AND “diseases”[All Fields]) OR “rare diseases”[All Fields] OR (“rare”[All Fields] AND “disease”[All Fields]) OR “rare disease”[All Fields], along with more specific terms that appear by default in Medical Subject Heading (MeSH) hierarchical structure in Medline. MeSH categories were: Orphan Drug Production / All MeSH Categories / Diseases Category / Pathological Conditions, Signs and Symptoms / Pathologic Processes / Disease Attributes / Rare Diseases. The MeSH terms were: Disease, Rare / Diseases, Rare / Rare Disease / Orphan Diseases / Disease, Orphan / Diseases, Orphan / Orphan Disease. Search terms were introduced in ISI Web of Knowledge database as topics in both cases. The annotated search structure was as follows: Topic=(rare disease) AND Topic=(angiogen*). Timespan=All Years.

Study selection

Bibliography selection

The two lists of publications mentioning one or several rare diseases somehow related to angiogenesis obtained by searching PubMed and ISI Web of Knowledge as described above were merged into a unique list containing all the entrances without repetition. In order to reduce the bias among the selected data and the data that really fit the list of search terms, all the information extracted was reviewed and verified. To reach this goal, all the publications contained in the merged list were revised one by one by making a strategic reading of them 22. An analysis of matches was performed looking for the occurrence of the following terms “rare disease”, and/or “rare”, and/or “disease” and “angiogenic *” or “VEGF” in all titles, abstracts, author keywords and keywords plus found and MeSH terms. All the references that did not support this exclusion analysis were removed.

Rare diseases selection

Only those references containing explicit reference to one or more rare diseases (and therefore listed in Orphanet database with an Orpha identification number) were used to select those rare diseases included in the set to be further analyzed.

Data collection process and synthesis of indexed information

Data bibliographic systematic review

Once all the bibliographic information related to rare disease and angiogenesis was confirmed and validated, we proceeded to the analysis and compilation of all data of interest that Orphanet website could bring to the state of the art. All the collected data were allocated in sheets for the management of data in Excel format. This election was based on: (i) the easy access and operability of this format, (ii) the easy identification of data through the search option, and (iii) the capability to recover the original source of information through online links. In a first column, the titles of all the selected bibliographic references in the study were included. The order or entrance was assigned according to publication dates, from the most recent to the oldest one. All found and selected bibliographic references were categorized for each Orpha identification number validated with the applied selection criteria.

Initial classification of angiogenesis-related rare diseases

A first general classification criterion was established according to which each disease was assigned to one of the three following disjoined subsets: A (A-RDs with cancerous phenotype in all their features), B (A-RDs with cancerous phenotype only in some of their features) and C (A-RDs without cancerous phenotype). To determine the three subsets, a systematic search of the semantic terms “tumor” and “cancer” and the sufix “-ome” was carried out within the classification that orpahanet exposes for rare diseases. The terms glaucome, angiokeratome, lysosome, pseudoxanthome and hamartome were excluded due to obvious reasons. After this, all corresponding genes and orphan drugs were seized from Orphanet database, categorized for each Orpha identification number and associated to A-RDs in different sheets.

Bioinformatics analysis of bibliographic systematic review

To validate our manual systematic review of literature, we carried out an additional bioinformatics text mining study. The list of PubMed IDs (PMIDs) was obtained from the initial systematic review (all references of supplementary material, with the exception of references 5, 41, 44, 63 and 71) and uploaded into the text mining web application SciMiner 23. A biomedical literature mining analysis and the subsequent enrichment analysis were carried out concerning to those Medical Subject Headings (MeSH) associated with the retrieved PMIDs from the systematic review.

Results of the literature search and orphanet analysis

Bibliographic systematic review

As shown in the scheme depicted in Figure1, the search in ISI Web of Knowledge yielded 284 references, whereas that carried out in PubMed yielded 263 references. From all these references, only 187 fulfilled the selection criteria for their inclusion in the set to be further analyzed. The complete set of the 187 selected bibliographic references conforms the bibliography included in the Supplementary material and they validate the entrance of 180 A-RDs indexed in the database Orphanet (see Methods). An evaluation of this bibliographic set using PMIDs was carried out as described (see Methods). To avoid the occurrence of trivial MeSH terms, we have considered statistically significant only those terms with a P-value lower than 1.0E-5 and an enrichment (t-ratio/b-ratio) greater than 40. The results are shown in Table1. Figure S1 (Supplementary material) shows the PRISMA flow diagram corresponding to this systematic review.
Fig 1

Flow of information through the different phases of bibliographic systematic review.

Table 1

Bioinformatic analysis of bibliographic systematic review

MeSHt+t−b+b−WholeSizet-Ratiob-Ratiot-ratio/b-ratioP-value
Angiogenesis inhibitors33149812019,435,02319,443,1430.184.18E-04434.26.18E-76
Neovascularization, pathologic3115122,70919,420,43419,443,1430.171.17E-03145.89.89E-57
Vascular endothelial growth factor A1816420,84719,422,29619,443,1430.11.07E-0392.29.41E-30
Thalidomide12170462819,438,51519,443,1430.072.38E-042776.17E-26
Herpesvirus 8, human9173300919,440,13419,443,1430.051.55E-04319.52.49E-20
Macular degeneration7175792519,435,21819,443,1430.044.08E-0494.42.06E-12
von Hippel–Lindau disease5177174419,441,39919,443,1430.038.97E-05306.39.10E-12
Lymphangioleiomyomatosis417856919,442,57419,443,1430.022.93E-057513.29E-11
Endothelial cells717515,42019,427,72319,443,1430.047.93E-0448.52.05E-10
Carcinoma, renal cell717516,03519,427,10819,443,1430.048.25E-0446.62.68E-10
Exudates and transudates6176835419,434,78919,443,1430.034.30E-0476.72.75E-10
Hypoxia-inducible factor 1, alpha subunit5177412319,439,02019,443,1430.032.12E-04129.66.57E-10
Vascular malformations317931119,442,83219,443,1430.021.60E-051030.54.11E-09
Telangiectasia, hereditary hemorrhagic4178192919,441,21419,443,1430.029.92E-05221.54.25E-09
Activin receptors, type II317934619,442,79719,443,1430.021.78E-05926.35.65E-09
Hemangioendothelioma, epithelioid317945919,442,68419,443,1430.022.36E-05698.21.31E-08
Vascular endothelial growth factors5177769219,435,45119,443,1430.033.96E-0469.41.44E-08
Angiogenic proteins317948219,442,66119,443,1430.022.48E-05664.91.52E-08
POEMS syndrome317948619,442,65719,443,1430.022.50E-05659.41.56E-08
Osteolysis, essential317954119,442,60219,443,1430.022.78E-05592.42.15E-08
Hemangioma, capillary317966519,442,47819,443,1430.023.42E-05481.93.97E-08
Protein kinase inhibitors517710,84019,432,30319,443,1430.035.58E-0449.37.82E-08
Interferon-alpha51771163719,431,50619,443,1430.035.99E-0445.91.11E-07
Pyrroles517711,89319,431,25019,443,1430.036.12E-0444.91.23E-07
Von Hippel–Lindau tumor suppressor protein3179108219,442,06119,443,1430.025.56E-05296.21.70E-07
Hypoxia-inducible factor 13179174619,441,39719,443,1430.028.98E-05183.67.10E-07
Endothelial growth factors4178786619,435,27719,443,1430.024.05E-0454.31.12E-06
Sarcoma, kaposi4178816319,434,98019,443,1430.024.20E-0452.31.30E-06
Linkage disequilibrium4178869019,434,45319,443,1430.024.47E-0449.21.66E-06
Rare diseases3179237019,440,77319,443,1430.021.22E-04135.21.77E-06
Collagen type XVIII218020219,442,94119,443,1430.011.04E-051057.71.80E-06
Receptors, vascular endothelial growth factor3179249719,440,64619,443,1430.021.28E-04128.42.06E-06
Lipoid proteinosis of urbach and wiethe218024619,442,89719,443,1430.011.27E-05868.52.67E-06
Retinal vessels4178999919,433,14419,443,1430.025.14E-0442.72.88E-06
Stem cell transplantation417810,09319,433,05019,443,1430.025.19E-0442.32.99E-06
Receptors, CXCR43179331519,439,82819,443,1430.021.70E-0496.74.80E-06
Dacarbazine3179354219,439,60119,443,1430.021.82E-0490.55.84E-06

MeSH, medical subject headings; t+, number of papers annotated with the MeSH in the sample PMIDs; t−, number of papers not annotated with the MeSH in the sample PMIDs; b+, number of papers annotated with the MeSH in whole PMIDs; b−, number of papers not annotated with the MeSH in whole PMIDs; WholeSize, whole PMIDs; t-ratio, proportion in the sample PMIDs; b-ratio, proportion in the whole PMIDs; t-ratio/b-ratio, value relative to the enrichment of the MeSH term; and P-value, Hypergeometric test value.

Flow of information through the different phases of bibliographic systematic review. Bioinformatic analysis of bibliographic systematic review MeSH, medical subject headings; t+, number of papers annotated with the MeSH in the sample PMIDs; t−, number of papers not annotated with the MeSH in the sample PMIDs; b+, number of papers annotated with the MeSH in whole PMIDs; b−, number of papers not annotated with the MeSH in whole PMIDs; WholeSize, whole PMIDs; t-ratio, proportion in the sample PMIDs; b-ratio, proportion in the whole PMIDs; t-ratio/b-ratio, value relative to the enrichment of the MeSH term; and P-value, Hypergeometric test value.

Initial classification of angiogenesis-related rare diseases

When this analysis was carried out, the Orphanet web contained 5781 rare diseases. This means that a 3% of all the described rare diseases can be considered as A-RDs. In the present work, the distribution of A-RDs within the subsets A, B, C as a function of the classification range pointed by Orphanet (for those which have a classification in this database) was analyzed. This initial classification was based on the tight physio-pathological relationship of cancer with angiogenesis 4–9, their relevant clinical and pharmacological applications 7–9 and the bibliographic relevance of the Boolean descriptor “cancer AND angiogenesis”. As expected, the greatest subset is that of rare oncologic diseases (subset A), which amounted up to 81 A-RDs. However, the subset C (A-RDs without cancerous phenotype) was almost as big, containing 76 non-oncologic A-RDs. Finally, the subset B (A-RDs with cancerous phenotype only in some of their features) contained 23 diseases, most of them increasing the risk of developing a cancer. Table2 show the lists of A-RDs in each of the three subsets, their relationship with bibliographic references of the supplementary material and the number of genes and drugs associated to each A-RD.
Table 2

Angiogenesis-related rare diseases

ReferencesOrpha IDRare diseaseOrpha genesOrpha drugs
Subset A (rare oncologic diseases)
1[1, 136]519Acute myeloid leukemia (ARD)*1933
2[59]213772Adenocarcinoma of the cervix uteri00
3[128]1501Adrenocortical carcinoma01
4[47]163699Alveolar soft-part sarcoma20
5[114]142Anaplastic thyroid carcinoma01
6[52]86886Angioimmunoblastic T-cell lymphoma00
71198731Arteriovenous fistula00
8[23, 26, 68, 79, 105, 143]211266Arteriovenous malformation00
9[51]157980Bladder Cancer00
10[125, 134]223727Bone sarcoma70
11[83]3395Brain tumor (ARD)*170
12[165]97287Bronchial endocrine tumor00
13[26]137667Capillary malformation-arteriovenous malformation10
14[45, 112, 143, 152]164Cerebral cavernous malformations00
15[99]86829Chronic neutrophilic leukemia00
16[61]99970Dedifferentiated liposarcoma00
17[61]31112Dermatofibrosarcoma protuberans20
1815141209Diffuse lymphatic malformation00
19[29, 138, 167]877Endocrine tumor22
20[29]100092Enteropancreatic endocrine tumor02
21[103]99871Eosinophilic granuloma00
22[65, 98, 139, 162]157791Epithelioid hemangioendothelioma00
23[147, 149]99976Esophageal adenocarcinoma00
24[149]99977Esophageal squamous cell carcinoma10
25[61, 134]319Ewing sarcoma50
26[51, 146, 164]733Familial adenomatous polyposis14
27[64]523Familial leiomyomatosis10
282099361Familial medullary thyroid carcinoma00
29[39, 42, 47, 92, 104, 159, 160]151Familial renal cell carcinoma (ARD)*1122
30[70, 135]63443Gastric cancer25
31[61, 97]44890Gastrointestinal stromal tumor25
32[5, 36, 83]360Glioblastoma833
33[5, 83]182067Glial tumor (ARD)*926
34[45]83454Glomuvenous malformation11
35[34]99915Granulosa cell malignant tumor00
36[184]58017Hairy cell leukemia02
37[76]2126Hemangiopericytoma00
38[123, 137]88673Hepatocellular carcinoma (ARD)*214
39[141]227535Hereditary breast cancer00
40[94, 107]29072Hereditary pheochromocytoma-paraganglioma syndrome60
41[166, 167]97279Insulinoma03
42[87, 118, 144, 158, 162, 169, 172, 177, 179, 180, 181, 185, 186]33276Kaposi's sarcoma05
4322213807Leiomyosarcoma of the cervix uteri00
4422213625Leiomyosarcoma of the corpus uteri00
45[111]65285Lhermitte-Duclos disease (ARD)*10
46[141]524Li-Fraumeni syndrome21
47[173]69078Liposarcoma12
48[24, 75]168811Malignant peritoneal mesothelioma00
49[67, 112]3148Malignant Schwannoma00
50698292Mastocytosis11
51[20, 165]1332Medullary thyroid carcinoma13
52[56]97338Melanoma of soft part20
53[24, 75]50251Mesothelioma03
54[55, 77, 140, 166, 178, 184]29073Multiple myeloma223
55152688Myelodysplastic syndromes210
56[61]99967Myxoid liposarcoma10
57[80]209989Non-papillary transitional cell carcinoma of the bladder01
58[134]668Osteosarcoma25
59[59]213504Ovarian adenocarcinoma07
60[142]2800Paget disease extramammary00
61[165]217074Pancreatic carcinoma721
62[94]717Pheochromocytoma and secreting paraganglioma (ARD)*81
63[14, 66, 115]2905POEMS syndrome00
64[87, 169, 172, 177, 180]48686Primary effusion lymphoma00
65[87, 144, 169, 172, 180, 181]99923Primary effusion lymphoma associated with HIV infection00
66[59]213528Rare adenocarcinoma of the breast00
67[74]180250Rare breast cancer (ARD)*120
68[12, 28, 39, 42, 47, 57, 63, 84, 92, 104, 122, 159, 160, 182]217071Renal cell carcinoma (ARD)*1224
69[61]69077Rhabdoid tumor20
70[165]70573Small cell lung cancer04
71[9, 22, 56, 97, 125, 173]3394Soft tissue sarcomas2010
72[162]210584Spindle cell hemangioma00
73[93]67037Squamous cell carcinoma of head and neck (ARD)*45
74[131]99868Thymic carcinoma00
75[131]3398Thymic epithelial tumor00
76[131]100100Thymic tumor00
77[131]99867Thymoma00
78[133]1063Tufted angioma00
79[52]86885Unspecified peripheral T-cell lymphoma04
80[85, 88, 159]39044Uveal melanoma01
81[61]99971Well-differentiated liposarcoma00
Subset B (A-RDs with cancerous phenotype only in some of their features)
1[111]109Bannayan-Riley-Ruvalcaba syndrome (ARD)*10
2[89, 184]521Chronic myeloid leukemia (ARD)*312
3[69]53721Cobb syndrome00
4[60, 109]191Cockayne syndrome50
5[95]2414Congenital pulmonary lymphangiectasia00
6[111]201Cowden syndrome (ARD)*30
717324Fabry disease13
8[15,16, 73, 118]73Gorham-Stout disease00
9[35, 110]90308Klippel-Trenaunay syndrome (ARD)*10
10[90]389Langerhans cell histiocytosis01
11[174]79383Lymphedema (ARD)*40
12[50]2451Mucocutaneous venous malformations (ARD)*11
13[166, 167]652Multiple endocrine neoplasia type 122
14[89, 148]824Myelofibrosis with myeloid metaplasia12
15[2, 61]636Neurofibromatosis type 1 (ARD)*32
16[53]2869Peutz-Jeghers syndrome10
17[91]42775PHACE syndrome00
18[89]729Polycythemia vera15
19[174]77240Primary lymphedema20
20[8,13,23, 45, 79, 105, 143]774Rendu-Osler-Weber disease (ARD)*31
21[37, 88]3205Sturge-Weber syndrome00
22[12, 29, 39, 42, 84, 88, 92, 122, 130, 161, 170, 182]892Von Hippel–Lindau disease (ARD)*12
23[187]913Zollinger-Ellison syndrome13
Subset C (A-RDs without cancerous phenotype)
1[25]93585Acquired thrombotic thrombocytopenic purpura due to anti-ADAMTS 13 antibodies01
2[54]79126Acute interstitial pneumonia00
3[19, 27, 32, 40, 43, 48, 62, 88, 176]279Age-related macular degeneration61
4[58, 126]803Amyotrophic lateral sclerosis (ARD)*1710
5[35, 110]2346Angio-osteohypertrophic syndrome (ARD)*20
6[25]2134Atypical hemolytic uremic syndrome (ARD)*63
7[154]3453Autoimmune polyendocrinopathy type 110
8[46]117Behcet disease02
921131Budd-Chiari syndrome00
10[30, 120]36258Buerger's disease00
11[152]136CADASIL syndrome10
12[31, 179, 185]160Castleman disease02
13[154]178029Central diabetes insipidus10
14[68]98044Central nervous system malformation00
15[40]179Chorioretinopathy, Birdshot type10
16[155]2137Chronic autoimmune hepatitis01
17[117]183Churg-Strauss syndrome01
18[40, 109]190Coats disease10
19[78]2041Coronary arterial fistulas00
20[6, 103, 133]206Crohn disease50
21[116]137698Cytomegalovirus disease in patients with impaired cell mediated immunity deemed at risk01
22[68]97339Dural sinus malformation00
23[40]40923Eales disease00
24[165]99889Ectopic Cushing syndrome01
25[72]199323Endophthalmitis00
26[183]337Fibrodysplasia ossificans progressiva (ARD)*10
27[45]2092Focal dermal hypoplasia10
283221126Fowler syndrome10
2917355Gaucher disease25
301777260Gaucher disease, type 214
311777261Gaucher disease, type 314
32[154]95509Granulomatous hypophysitis00
33[121]855Hashimoto struma10
34[90]158032Hemophagocytic syndrome141
35[132, 152]85458Hereditary cerebral hemorrhage with amyloidosis20
36[132]100006Hereditary cerebral hemorrhage with amyloidosis, Dutch type00
37[157]422Idiopathic and/or familial pulmonary arterial hypertension (ARD)*317
382169665Intrahepatic cholestasis of pregnancy20
39[100]2778Juvenile chronic recurrent multifocal osteomyelitis00
40[82]2331Kawasaki disease01
41[156]1571Knobloch syndrome (ARD)*10
42[101, 163]530Lipoid proteinosis (ARD)*10
43[7, 108]538Lymphangioleiomyomatosis20
441793448Lysosomal storage disease with skeletal involvement220
45[86]101338Mediterranean spotted fever00
46[168]54370Membranoproliferative glomerulonephritis10
47[10, 127, 145]565Menkes disease10
48[68, 106]2573Moyamoya disease10
49[87, 144, 169, 172, 177, 180]93686Multicentric Castleman disease00
50[176]94058Neovascular glaucoma10
51[129]649Norrie disease10
52[25]447Paroxysmal nocturnal hemoglobinuria02
531785212Perinatal-lethal Gaucher disease10
5418563Peripartum cardiomyopathy00
55[40]758Pseudoxanthoma elasticum10
56[4, 113, 157]182090Pulmonary arterial hypertension03
57[96, 153]199241Pulmonary capillary hemangiomatosis02
58[113]71198Rare pulmonary hypertension01
59[38]60032Recurrent respiratory papillomatosis00
60[40, 102, 171, 176]90050Retinopathy of prematurity12
61[33]49041Retroperitoneal fibrosis00
62[86]102021Rickettsiae disease00
63[17, 82]797Sarcoidosis12
64[81, 124]801Scleroderma03
65[166]36426Stevens-Johnson syndrome00
66[99]3243Sweet syndrome00
67[116, 119, 154]536Systemic lupus erythematosus21
68[81]90291Systemic sclerosis03
69[135]93573Thrombotic microangiopathy00
70[25, 151]54057Thrombotic thrombocytopenic purpura15
71[25]90038Typical hemolytic uremic syndrome01
72[117]52759Vasculitis00
73[49, 109, 129]98668Vitreoretinopathy (ARD)*140
74[86, 151, 175]903Von Willebrand disease13
75[150]51636WHIM syndrome10
76[82, 127, 145]905Wilson disease14

ARD: angiogenic rare disease.

Angiogenesis-related rare diseases ARD: angiogenic rare disease. Since Orphanet identifies genes listed in its database such as those considered to be involved in the pathophysiology of rare diseases and because this information is extracted from the scientific literature and cross-validated, genes directly related to angiogenesis and A-RDs can be associated (i.e. those genes linked to A-RDs in the systematic review and in the same way recovered with the Gene Ontology GO term called angiogenesis; GO:0001525). In this context, we consider that diseases recovered in this way can be called “angiogenic rare diseases” and they can be retrieved from those 180 rare diseases related in some way with angiogenesis. These 27 angiogenic rare diseases are also highlighted in Table2. The most commonly used classification of diseases is WHO ICD-10 (http://www.who.int/classifications/icd/en). Tables S2–S4 (Supplementary material) list A-RDs corresponding to subsets A, B, and C, respectively, indicating their ICD-10 when available. It is noteworthy that as many as 83 A-RDs (47 in subset A, 6 in subset B and 30 in subset C) have currently no ICD code assigned.

Genes and drugs associated to angiogenesis-related rare diseases

We manually collected 244 entrances identified as genes in Orphanet. To study the relative distribution of the set of extracted and annotated genes in the list of A-RDs, and also to know their representation in the three initial subsets (A, B, C), three categories of A-RDs where established: those currently associated to no gene, those associated to one gene, and those with two or more genes associated. The number of genes in each A-RD is highlighted in Table2. Furthermore, Tables S5 and S6 (Supplementary material) list all the A-RDs associated to a single or to more than a gene, respectively, identifying the corresponding related genes by their Orpha gene IDs. It is interesting to note that this relationship among genes and A-RDs is not symmetrical. Tables3 and 4 list the whole set of 186 genes associated to one A-RD and 58 genes associated to two or more A-RDs, respectively, identifying the corresponding A-RDs by their Orpha rare disease IDs. Figure2 shows the distribution of the annotated genes grouped in two categories (those associated to one A-RD and those associated to two or more A-RDs in the whole set and the three subsets of A-RDs.
Table 3

Genes associated to a single angiogenesis-related rare disease

nGenesRare disases Orpha ID
1ACTA22573 (C)
2ATF197338 (A)
3ACVR1337 (C)
4ADAMTS1354057 (C)
5AP3B1158032 (C)
6ARMS2279 (C)
7APP85458 (C)
8ALS2803 (C)
9ALK3395 (A)
10ANG803 (C)
11(TATCCGGAGGGCTCGCCATGCTGCT)94058 (C)
12AVP178029 (C)
13ARSB93448 (C)
14AGA93448 (C)
15ATG16L1206 (C)
16ATP8B169665 (C)
17ATP7A565 (C)
18ATP7B905 (C)
19ABCA4279 (C)
20ABCB469665 (C)
21ABCC6758 (C)
22AIRE3453 (C)
23BEST198668 (C)
24BLOC1S3158032 (C)
25BMPR2422 (C)
26BARD1180250 (A)
27BRIP1180250 (A)
28BCR521 (B)
29BRCA1180250 (A)
30CDH163443 (A)
31CREB3L13394 (A)
32CREB3L23394 (A)
33Cathepsin A—CTSA93448 (C)
34CEBPA519 (A)
35CD462134 (C)
36CXCR451636 (C)
37CHGB803 (C)
38COL2A198668 (C)
39COL9A198668 (C)
40COL11A198668 (C)
41COL11A298668 (C)
42CR1536 (C)
43C32134 (C)
44CFB2134 (C)
45CFI2134 (C)
46CBFB519 (A)
47CDKN1B652 (B)
48CDKN2A217074 (A)
49CST385458 (C)
50CTLA4536 (C)
51DAO803 (C)
52DEK519 (A)
53DTNBP1158032 (C)
54ENG774 (B)
55ETV6519 (A)
56ERCC1191 (B)
57ERCC2191 (B)
58ERCC5191 (B)
59ERCC6191 (B)
60ERCC8191 (B)
61EXT1223727 (A)
62ECM1530 (C)
63FCGR3B855 (C)
64FLVCR22211 (C)
65FBLN5279 ((C)
66FIG 4803 (C)
67FLT3519 (A)
68FOXC279383 (B)
69FOXO13394 (A)
70FZD498668 (C)
71FUCA193448 (C)
72GALNS93448 (C)
73GLA324 (B)
74GLB193448 (C)
75GLMN83454 (A)
76GNS93448 (C)
77GUSB93448 (C)
78HMCN1279 (C)
79HGSNAT93448 (C)
80HPS1158032 (C)
81HPS3158032 (C)
82HPS4158032 (C)
83HPS5158032 (C)
84HPS6158032 (C)
85HTRA1279 (C)
86HYAL193448 (C)
87IDS93448 (C)
88IDUA93448 (C)
89IGHG129073 (A)
90ING167037 (A)
91ING367037 (A)
92INSM1877 (A)
93IRF429073 (A)
94IL10206 (C)
95IL23R206 (C)
96LRP598668 (C)
97LYST158032 (C)
98HLA-A179 (C)
99HLA-DRB1797 (C)
100MAN2B193448 (C)
101MANBA93448 (C)
102MECOM52688 (A)
103MKL1519 (A)
104MANF217074 (A)
105MUTYH63443 (A)
106MLL519 (A)
107MYH11519 (A)
108MYST3519 (A)
109GNPTAB93448 (C)
110GNPTG93448 (C)
111NAGLU93448 (C)
112NF1636 (B)
113NEFH803 (C)
114NME13395 (A)
115SGSH93448 (C)
116NR1H3803 (C)
117NR2E398668 (C)
118NPM1519 (A)
119NUP214519 (A)
120NUP98519 (A)
121NOD2206 (C)
122OPTN803 (C)
123PAX33394 (A)
124PAX73394 (A)
125PHOX2B3395 (A)
126PON1803 (C)
127PON2803 (C)
128PON3803 (C)
129PTCH23395 (A)
130PRF1158032 (C)
131PRPH803 (C)
132PLCE199977 (A)
133PDGFRA44890
134PORCN2092 (C)
135KCNJ1398668 (C)
136PRLR180250 (A)
137PML519 (A)
138PSAP355 (C)
139RAB27A158032 (C)
140RAD51180250 (A)
141RAD51C180250 (A)
142RB1668 (A)
143RARA519 (A)
144RS198668 (C)
145RMST3394 (A)
146RPS1452688 (A)
147RNF135636 (B)
148RBM15519 (A)
149RUNX1521 (B)
150RUNX1T1519 (A)
151SETX803 (C)
152STK112869 (B)
153SET519 (A)
154NEU193448 (C)
155SMAD9422 (C)
156SLC17A593448 (C)
157SLC22A4206 (C)
158SLC44A493448 (C)
159SOX1879383 (B)
160SUMF193448 (C)
161SOD1803 (C)
162SUFU3395 (A)
163SUZ12636 (B)
164SS183394 (A)
165SSX13394 (A)
166SSX23394 (A)
167SSX2IP3394 (A)
168SSX2B3394 (A)
169STX11158032 (C)
170STXBP2158032 (C)
171TARDBP803 (C)
172TEK2451 (B)
173TSPAN1298668 (C)
174THBD2134(C)
175TSC1538 (C)
176TSC2538 (C)
177TNFRSF10B67037 (A)
178UNC13D158032 (C)
179ABL1521 (B)
180VAPB803 (C)
181VCAN98668 (C)
182KRAS217074 (A)
183MYCN3395 (A)
184VWF903 (C)
185WT13394 (A)
186ZBTB16519 (A)

(A), (B), (C) correspond to subset A, B and C respectively.

Table 4

Genes associated to two or more angiogenesis-related rare diseases

n°Genes1234567
Rare diseases Orpha ID
1PTEN3395 (A)180250 (A)182067 (A)67037 (A)201 (B)109 (B)65285 (A)
2FUS3394 (A)519 (A)803 (C)69078 (A)99967 (A)
3SDHD180250 (A)717 (A)29072 (A)201 (B)877 (A)
4TP533395 (A)182067 (A)360 (A)217074 (A)524 (A)
5CHEK2180250 (A)223727 (A)524 (A)668 (A)
6EWSR13394 (A)223727 (A)319 (A)97338 (A)
7GBA355 (C)77260 (C)77261 (C)85212 (C)
8NDP98668 (C)190 (C)649 (C)90050 (C)
9SDHB180250 (A)717 (A)29072 (A)201 (B)
10TFE33394 (A)217071 (A)151 (A)163699 (A)
11VHL217071 (A)151 (A)717 (A)892 (B)
12CFH279 (C)2134 (C)54370 (C)
13DMBT13395 (A)182067 (A)360 (A)
14EGFR3395 (A)182067 (A)360 (A)
15FH217071 (A)151 (A)523 (A)
16GLTSCR13395 (A)182067 (A)360 (A)
17GLTSCR23395 (A)182067 (A)360 (A)
18GLI13395 (A)182067 (A)360 (A)
19LRRN23395 (A)182067 (A)360 (A)
20YEATS43395 (A)182067 (A)360 (A)
21OGG1217071 (A)151 (A)
22ACVRL1422 (C)774 (B)
23APC3395 (A)733 (A)
24ASPSCR13394 (A)163699 (A)
25AGGF12346 (C)90308 (B)
26BRCA2180250 (A)217074 (A)
27CTNNB13395 (A)88673 (A)
28COL1A13394 (A)31112 (A)
29COL18A198668 (C)1571 (C)
30DIRC1217071 (A)151 (A)
31DIRC2217071 (A)151 (A)
32ETV4223727 (A)319 (A)
33ETV1223727 (A)319 (A)
34FLT479383 (B)77240 (B)
35FLCN217071 (A)151 (A)
36FHIT217071 (A)151 (A)
37FLI1223727 (A)319 (A)
38GJC279383 (B)77240 (B)
39HSPBAP1217071 (A)151 (A)
40JAK2824 (B)729 (B)
41MET217071 (A)88673 (A)
42MEN1652 (B)913 (B)
43NOTCH3136 (C)95509 (C)
44PRCC217071 (A)151 (A)
45PALB2180250 (A)217074 (A)
46PDGFB3394 (A)31112 (A)
47RASA12346 (C)137667 (A)
48RET717 (A)1332 (A)
49RNF139217071 (A)151 (A)
50SMAD4217074 (A)774 (B)
51SDHAF2717 (A)29072 (A)
52SDHA717 (A)29072 (A)
53SDHC717 (A)29072 (A)
54SMARCA43394 (A)69077 (A)
55SMARCB13394 (A)69077 (A)
56TMEM127717 (A)29072 (A)
57ERG223727 (A)319 (A)
58KIT44890 (A)98292 (A)

(A), (B), (C) correspond to subset A, B and C respectively.

Fig 2

Relative distribution of genes associated to angiogenesis-related rare disease. Percentages of genes belonging to described subsets of A-RDs: A (A-RDs with cancerous phenotype in all their features), B (A-RDs with cancerous phenotype only in some of their features) and C (A-RDs without cancerous phenotype). Horizontal-axis represents the distribution of genes in the different subsets. Color code: blue, genes related to one A-RD; brownish, genes related to two or more A-RDs; dark grey: total genes related to A-RDs.

Relative distribution of genes associated to angiogenesis-related rare disease. Percentages of genes belonging to described subsets of A-RDs: A (A-RDs with cancerous phenotype in all their features), B (A-RDs with cancerous phenotype only in some of their features) and C (A-RDs without cancerous phenotype). Horizontal-axis represents the distribution of genes in the different subsets. Color code: blue, genes related to one A-RD; brownish, genes related to two or more A-RDs; dark grey: total genes related to A-RDs. Genes associated to a single angiogenesis-related rare disease (A), (B), (C) correspond to subset A, B and C respectively. Genes associated to two or more angiogenesis-related rare diseases (A), (B), (C) correspond to subset A, B and C respectively. In the case of drugs, in this study 285 entrances were manually identified in Orphanet database as orphan drugs. As in the case of genes, three categories of A-RDs where established: those currently associated to no drug, those associated to one drug, and those with two or more drugs associated. The number of drugs in each A-RD is highlighted in Table2. Furthermore, Tables S7 and S8 (Supplementary material) list all the A-RDs associated to a single or to more than a drug, respectively, identifying the corresponding related drugs by their Orpha drug IDs. As in the case of genes, the relationship A-RDs-drugs is also asymmetrical. Tables S9 and S10 list the whole set of 198 drugs associated to one A-RD and 87 drugs associated to two or more A-RDs, respectively, identifying the corresponding A-RDs by their Orpha rare disease IDs. Figure3 shows the distribution of the annotated drugs grouped in two categories (those associated to one A-RD and those associated to two or more A-RDs) in the whole set and the three subsets of A-RDs.
Fig 3

Relative distribution of Orphan drugs associated to angiogenesis-related rare disease. Percentages of drugs belonging to described subsets of A-RDs: A (A-RDs with cancerous phenotype in all their features), B (A-RDs with cancerous phenotype only in some of their features) and C (A-RDs without cancerous phenotype). Horizontal-axis represents the distribution of drugs in the different subsets. Color code: blue, drugs related to one A-RD; brownish, drugs related to two or more A-RDs; dark grey: total drugs related to A-RDs.

Relative distribution of Orphan drugs associated to angiogenesis-related rare disease. Percentages of drugs belonging to described subsets of A-RDs: A (A-RDs with cancerous phenotype in all their features), B (A-RDs with cancerous phenotype only in some of their features) and C (A-RDs without cancerous phenotype). Horizontal-axis represents the distribution of drugs in the different subsets. Color code: blue, drugs related to one A-RD; brownish, drugs related to two or more A-RDs; dark grey: total drugs related to A-RDs.

Discussion of the literature search and orphanet analysis

Our bibliographic systematic review (see Fig.1) has allowed us to select 187 references (see bibliography in Supplementary material) and 180 A-RDs (that is, 180 rare diseases related with the neovascularization process, see Table2A–C). This systematic review has also made possible the extraction of a great amount of data in an exhaustive and trustworthy manner. In the present work, these extracted data could be synthetized, validated and interrelated through the use of a reproducible methodology, based in PRISMA statements 20,21 (see PRISMA checklist in Table S1 and PRISMA flow diagram in Figure S1). When we recovered those A-RDs that are cited three or more times in our set of selected references (29 of the 180 A-RDs), we found that in most cases vascular diseases (or malformations) or angioproliferative disorders were retrieved, with the exceptions of Multicentric castleman disease (OPRPHA93686), Multiple myeloma (ORPHA29073), Primary effusion lymphoma associated with HIV infection (ORPHA99923) and Primary effusion lymphoma (ORPHA48686). Renal cell carcinoma (ORPHA217071) was the angioproliferative disease more times referenced (in fact, it is mentioned in 14 of the 187 selected references included in supplementary material). On the other hand, a text mining analysis has been used as an automatic and independent validation of the results achieved in the systematic review. We can observe that the enriched MeSH terms of the 187 bibliographic references, obtained from the systematic review, are notably related to angiogenesis and pathological conditions (see Table1). These results of the text mining analysis confirm that our selection of the bibliography has consistent information related to angiogenesis and biological process involved in the pathogenesis. Under these conditions, more than a half of PMIDs linked to MeSH terms related to pathologies (i.e. Neovascularization, Pathologic, Herpesvirus 8, Macular Degeneration, Pathologic-von Hippel–Lindau Disease, lymphangioleiomyomatosis, Renal Cell Carcinoma, Hereditary Hemorrhagic Telangiectasia, Hemangioendothelioma, POEMS Syndrome, Essential osteolysis, Capillary Hemangioma Kaposi Sarcoma, Rare Diseases and Lipoid proteinosis of Urbach and Wiethe) match with those PMIDs that are linked to MeSH terms related to angiogenesis (Angiogenesis inhibitors, Vascular Endothelial Growth Factor A, Thalidomide, Vascular Endothelial Growth Factors, Angiogenic Proteins, Vascular Endothelial Growth Factor Receptors). It is interesting to note that only three PMIDs are indicated for the term called “Rare disease”, which highlights the lack of identification with this type of disease in the scientific literature (see Table1). Orphanet has its own classification of rare diseases, based on a hierarchy of descriptive categories. These categories are pathological descriptions based in published scientific data and information provided by experts in the field. These pathological descriptions are referred to as manifestations along the tables presented in this work. The close relationship between angiogenesis and tumor progression was used for the initial classification of A-RDs into three differentiated subsets (see Table2). The analysis of this classification confirmed that this procedure gave rise to a consistent separation. The dominant subset was “rare neoplasias” (subset A), as expected. Concerning A-RDs included in subset B, they are mostly vascular malformations (as angiomas and hemangiomas), as well as dysplasias and hamartomas. They are non neoplastic pathologies associated to an increased risk to develop tumors. Finally, subset C included a whole array of non-tumoral rare diseases tightly related with (and, in many cases, dependent on) angiogenesis. On the other hand, the systematic review of the collected data allowed us to detect a number of incoherencies in the Orphanet classification of rare diseases. Some of them are highlighted here: Cerebral cavernous malformations (ORPHA164) are rare brain vascular malformations that are also named as brain cavernous angioma. The term “angioma” showed concurrence with this and other search terms included in the three subsets, in spite of the fact that an angioma is not a tumor 24. Our analysis led to include cerebral cavernous malformations (ORPHA164) within subset A, although the Orphanet classification for this disease remained undefined (“This disease will be assigned to a classification in the near future”). Furthermore, the clinical description of this disease in Orphanet was unclear enough as to make possible its inclusion in any of the other subsets (either B or C). On the other hand, ICD-10 codes this disease as Q28.3 (“Congenital malformations, deformations and chromosomal abnormalities”), as it is also the case for other angiomas (glomuvenous malformation (ORPHA83454), among others). POEMS syndrome (ORPHA2905) is a rare paraneoplasia that only presented concurrency with search terms in some of their classifications. However, it is a multisystemic disease in most of the cases associated to osteosclerotic myeloma. This is the main reason why it was finally included into subset A, although there were also reasons to include it into subset B. ICD-10 codes it within R16 (“Symptoms, signs and abnormal clinical and laboratory findings, not elsewhere classified”). Chronic myeloid leukemia (ORPHA521) appears included in subset B (Table2) because at the moment in which this systematic review and analysis was carried out Orphanet offered four general categories of classification (namely, classification of hematopoietic and lymphoid tumors, classification of disease with platelet number and function anomalies, Orphanet classification of rare hematological diseases and Orphanet classification of rare tumors) for this disease, one of which (namely, classification of disease with platelet number and function anomalies) had no concurrence with search terms. However, updates arranged in Orphanet after our systematic review and analysis offer only two general classification for this disease (namely, Orphanet classification of rare hematological diseases and Orphanet classification of rare tumors), which would be consistent with the inclusion of this disease within subset A. In fact, ICD-10 codes this disease as C92.1 (“Neoplasms”). These previously commented cases and others reveal the importance of establishing correct and unambiguous denominations to these diseases in databases such as Orphanet. A systematic, unambiguous classification and the actual way in which the information is documented and transmitted can help physicians during health assistance. We have also detected that ICD-10 have no code assigned for 46% (83 out of 180) of the A-RDs listed (see Tables S2–S4 in Supplementary material). The announced release of ICD-11 (which will include a systematic classification based on worldwide accepted clinical criteria) should standardize the classification of rare diseases. This undoubtedly will make it easier the documentation procedure and the curation of the collected information concerning this kind of vaguely described disorders. It should be mentioned that several classifications of rare diseases available in Orphanet at the moment of carrying out this systematic review were deleted from Orphanet website in more recent actualizations of the site. This was the case of Orphanet classification of red cell diseases, classification of hematopoietic and lymphoid tumors and classification of disease with platelet number and function anomalies. The recent emergence of a new category in the Orphanet classification: Inherited cancer-predisposing syndrome (ORPHA140162) should also be mentioned. As mentioned, from the 180 selected A-RDs, these 27 highlighted with an asterisk in Table2 can be considered as angiogenic rare diseases. Three of them have same genetic and molecular profiles closely related to angiogenesis: Angio-osteohypertrophic syndrome (ORPHA2346), Neurofibromatosis type I (ORPHA636) and Rendu-Osler-Weber disease (ORPHA774). Orphanet also includes information about this. The other angiogenic rare diseases are pathologies whose genetic and molecular profiles are related to certain aspects of angiogenesis such as VEGF expression, anti-angiogenic therapies or related with vascular proliferation process, among others. In many of these cases further investigation is required. A problem arises with Orpha IDs that are classified in Orphanet as diseases that group other diseases. Under these conditions, since no distinction is made by Orphanet and only in some cases it is indicated correctly (i.e. “This term does not characterize a disease but a group of diseases. To learn about the diseases included under this term, search for in the Classifications menu”), we think that many other diseases could be retrieved. In the case of A-RDs that group other diseases, Orphanet does not only list those genes that are being shared among all diseases belonging to that category, but it also contains all the genes that are within that class of diseases. In this context, no genetic profile is identified in these categories of classification. As mentioned, a classification made in this way is useful when grouping features around a category of diseases and allows a proper allocation of patient, but it says little about its genetic and molecular profiles. No information is displayed in the summary of almost a third of these A-RDs and only two of these that group other diseases are identified (i.e. An Orphanet summary for this disease is currently under development. However, other data related to the disease are accessible from the Additional Information menu located on the right side of this page). The case of Brain tumor (ORPHA3395) is clearly a kind of pathology that groups other diseases. In Oprhanet it is identified as: “This disease will be assigned to a classification in the near future”. For this disease, currently no list of genes, and no classification is indicated in Orphanet. Another problem for systematic studies is also the way in which Orphanet updates and corrects its database. For instance, up to four angiogenic rare diseases were outdated in the course of our systematic review. Glioma, now called Glial tumor (ORPHA182067), does not remain associated with the gene called PTEN, which in its original link (MIN ID605 691) is identified as a tumor suppressor. Oligodendroglial tumor (ORPHA46484) is linked in UniProt (ID60484) too and it is just a subcategory of glial tumor. In addition, two genes are listed for Brain tumor: PTEN and CTNB1. On the other hand, two genes (PML and RBM15) were listed for Acute myeloid leukemia (ORPHA519). Currently, the symbol RBM15 (RNA binding motif protein 15) does not appear in Orphanet database. In Uniprot (ID Q96T37), Acute megacaryoblastic leukemia (ORPHA518) is listed as an Orphan disease. Figure4 shows frequence distributions of A-RDs taking into account the number of genes or the number of drugs to which they are related (information abstracted from Tables4 and S5–S10. As Figure4 shows, approximately half of A-RDs are linked to no gene and no drug. The highest percentage of A-RDs linked to two or more genes or drugs corresponds to subset A. This reflects the actual current state of knowledge in this research area, which—as expected—is much higher in neoplastic A-RDs (those included in subset A).
Fig 4

Relative distribution of angiogenesis-related rare diseases associated to genes and Orphan drugs. Left panels. Up, the percentages of A-RDs associated to drugs are shown. Down, the percentages of the three described subsets associated to genes are shown. Subsets: A (angiogenesis-related rare diseases with cancerous phenotype in all their features), B (cancer-related, angiogenesis-related rare diseases with cancerous phenotype only in some of their features) and C (angiogenesis-related rare diseases without cancerous phenotype). Right panels. Up, the percentages of A-RDs associated to drugs are shown. Down, the percentages of the same three A-RDs groups described above, here associated to genes.

Relative distribution of angiogenesis-related rare diseases associated to genes and Orphan drugs. Left panels. Up, the percentages of A-RDs associated to drugs are shown. Down, the percentages of the three described subsets associated to genes are shown. Subsets: A (angiogenesis-related rare diseases with cancerous phenotype in all their features), B (cancer-related, angiogenesis-related rare diseases with cancerous phenotype only in some of their features) and C (angiogenesis-related rare diseases without cancerous phenotype). Right panels. Up, the percentages of A-RDs associated to drugs are shown. Down, the percentages of the same three A-RDs groups described above, here associated to genes. Lysosomal storage disease with skeletal involvement (ORPHA93448) is the A-RD linked to the highest number of genes (22), but at the same time is linked to no drug. On the other hand, both Acute myeloid leukemia (ORPHA519) and Glioblastoma (ORPHA360) are the two A-RDs with the highest number of linked drugs (33 in each case), being the third and the 12th respectively according to their linked genes (see Table2 and Table S6). As Figure2 shows, most of the genes are linked to only one A-RD. The majority of those genes linked to two or more A-RDs in fact are related with A-RDs of the subset A. A similar situation is found in the case of drugs (Fig.3). Phosphatase and tensin homolog (mutated in multiple advanced cancers 1)—PTEN is one of the genes with more links to A-RDs (Table4). It is noteworthy that Orphanet updated versions used when this systematic review and analysis was carried out identified the entrance Antisense Oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) as both a gene (which is obviously false) and as a drug (see Table3 and Table S9). In both cases, this entrance was linked to an only A-RD: to Neovascular glaucoma (ORPHA94058) in Table3 and to Retinopathy of prematurity (ORPHA90050) in Table S9. We have maintained both entrances according to the results yielded by our systematic methodology. This highlights that this systematic approach allows for a more correct curation of the collected data. In more recent updates of Orphanet some of the detected error have been corrected. The obvious great current interest in angiogenesis and in rare diseases demanded a systematic review of the current state of knowledge in the Boolean intersection of these two research areas, namely, the still not well defined set of angiogenesis-related rare diseases. The present review report contributes to satisfy such a demand. Current technology allows researchers to have access to great databases containing overwhelming amounts of data. Furthermore, there are a number of biocomputational tools that makes it easier the access, extraction and analysis of biological data contained in databases and they can enhance the molecular knowledge emerged from the systematic review results. We claim that the critical use of such tools makes possible and affordable to carry out systematic reviews of the current state of knowledge of specific research areas. These systematic reviews are aimed to add value to the classical bibliographical reviews thanks to their potential to extract new emergent information. The present systematic review on angiogenesis-related rare diseases can be considered an initial contribution in this way. Herein we propose a simple classification of angiogenesis-related rare diseases trying to discriminate the tight relationships of those linked to cancer. We have detected that both the Orphanet classification of rare diseases and the WHO International Classification of Diseases ICD-10 urgently require deep revisions and updates. Much more research is urgently needed for the identification of genes and drugs related to many angiogenesis-related rare diseases and for the exploration of new diagnostic, prognostic and therapeutic procedures. Orphanet database is a useful resource for all scientists and physicians engaged with rare diseases, as well as for patients’ associations. However, form a scientific point of view, Orphanet still lacks of an actual semantic classification of rare disease. Furthermore, a deep upgrade of the scientific information contained in Orphanet is urgently required. This systematic review of available literature on angiogenesis rare diseases has ordered and connected the currently available but up to now dispersed wealth of information on the topic, as reflected by the full set of accompanying figures and tables. This information will be useful for those interested in knowing the full set of described angiogenesis-related rare diseases, and what genes and drug treatments a specific angiogenesis-related rare disease shares with other ones. In particular, this information can be a very useful start point for new, deep reviews focused on concrete angiogenic rare diseases. Taking the ordered information contained in the accompanying figures and tables of the present work as a starting point, functional enrichment and network analysis tools could be used in the near future to make predictions of new gene targets, drugs and/or treatments for some rare diseases based in their shared spectra with the full set of angiogenesis-related rare diseases herein reviewed.
  23 in total

Review 1.  The hallmarks of cancer.

Authors:  D Hanahan; R A Weinberg
Journal:  Cell       Date:  2000-01-07       Impact factor: 41.582

Review 2.  Angiogenesis in health and disease.

Authors:  Peter Carmeliet
Journal:  Nat Med       Date:  2003-06       Impact factor: 53.440

3.  Systems biology metabolic modeling assistant: an ontology-based tool for the integration of metabolic data in kinetic modeling.

Authors:  Armando Reyes-Palomares; Raul Montañez; Alejando Real-Chicharro; Othmane Chniber; Amine Kerzazi; Ismael Navas-Delgado; Miguel Angel Medina; José F Aldana-Montes; Francisca Sánchez-Jiménez
Journal:  Bioinformatics       Date:  2009-02-02       Impact factor: 6.937

Review 4.  Anti-angiogenic drugs: from bench to clinical trials.

Authors:  Ana R Quesada; Ramón Muñoz-Chápuli; Miguel A Medina
Journal:  Med Res Rev       Date:  2006-07       Impact factor: 12.944

5.  The PRISMA statement for reporting systematic reviews and meta-analyses of studies that evaluate health care interventions: explanation and elaboration.

Authors:  Alessandro Liberati; Douglas G Altman; Jennifer Tetzlaff; Cynthia Mulrow; Peter C Gøtzsche; John P A Ioannidis; Mike Clarke; P J Devereaux; Jos Kleijnen; David Moher
Journal:  PLoS Med       Date:  2009-07-21       Impact factor: 11.069

Review 6.  Networking for rare diseases: a necessity for Europe.

Authors:  S Aymé; J Schmidtke
Journal:  Bundesgesundheitsblatt Gesundheitsforschung Gesundheitsschutz       Date:  2007-12       Impact factor: 1.513

7.  Principles of cancer therapy: oncogene and non-oncogene addiction.

Authors:  Ji Luo; Nicole L Solimini; Stephen J Elledge
Journal:  Cell       Date:  2009-03-06       Impact factor: 41.582

Review 8.  Playing only one instrument may be not enough: limitations and future of the antiangiogenic treatment of cancer.

Authors:  Ana R Quesada; Miguel Angel Medina; Emilio Alba
Journal:  Bioessays       Date:  2007-11       Impact factor: 4.345

9.  SciMiner: web-based literature mining tool for target identification and functional enrichment analysis.

Authors:  Junguk Hur; Adam D Schuyler; David J States; Eva L Feldman
Journal:  Bioinformatics       Date:  2009-02-02       Impact factor: 6.937

Review 10.  Challenges of antiangiogenic cancer therapy: trials and errors, and renewed hope.

Authors:  Miguel Angel Medina; Ramón Muñoz-Chápuli; Ana R Quesada
Journal:  J Cell Mol Med       Date:  2007 May-Jun       Impact factor: 5.310

View more
  9 in total

1.  Deepening the knowledge of rare diseases dependent on angiogenesis through semantic similarity clustering and network analysis.

Authors:  Raquel Pagano-Márquez; José Córdoba-Caballero; Beatriz Martínez-Poveda; Ana R Quesada; Elena Rojano; Pedro Seoane; Juan A G Ranea; Miguel Ángel Medina
Journal:  Brief Bioinform       Date:  2022-07-18       Impact factor: 13.994

2.  An Aptamer-Based Antagonist against the Receptor for Advanced Glycation End-Products (RAGE) Blocks Development of Colorectal Cancer.

Authors:  Jihui Zheng; Wenjing Zhu; Fang He; Zhu Li; Na Cai; Hong-Hui Wang
Journal:  Mediators Inflamm       Date:  2021-05-05       Impact factor: 4.711

3.  The role of NBI HDTV magnifying endoscopy in the prehistologic diagnosis of laryngeal papillomatosis and spinocellular cancer.

Authors:  Petr Lukes; Michal Zabrodsky; Eva Lukesova; Martin Chovanec; Jaromir Astl; Jaroslav A Betka; Jan Plzak
Journal:  Biomed Res Int       Date:  2014-06-17       Impact factor: 3.411

4.  MgCl2 and ZnCl2 promote human umbilical vein endothelial cell migration and invasion and stimulate epithelial-mesenchymal transition via the Wnt/β-catenin pathway.

Authors:  Shuang Pan; Liwen An; Xin Meng; Liming Li; Fu Ren; Yifu Guan
Journal:  Exp Ther Med       Date:  2017-09-20       Impact factor: 2.447

5.  Gene- and Disease-Based Expansion of the Knowledge on Inborn Errors of Immunity.

Authors:  Lyubov E Salnikova; Ekaterina V Chernyshova; Lyudmila A Anastasevich; Sergey S Larin
Journal:  Front Immunol       Date:  2019-10-21       Impact factor: 7.561

Review 6.  Antiangiogenic Effects of Coumarins against Cancer: From Chemistry to Medicine.

Authors:  Mohammad Bagher Majnooni; Sajad Fakhri; Antonella Smeriglio; Domenico Trombetta; Courtney R Croley; Piyali Bhattacharyya; Eduardo Sobarzo-Sánchez; Mohammad Hosein Farzaei; Anupam Bishayee
Journal:  Molecules       Date:  2019-11-24       Impact factor: 4.411

Review 7.  Histamine, Metabolic Remodelling and Angiogenesis: A Systems Level Approach.

Authors:  Aurelio A Moya-García; Almudena Pino-Ángeles; Francisca Sánchez-Jiménez; José Luis Urdiales; Miguel Ángel Medina
Journal:  Biomolecules       Date:  2021-03-11

Review 8.  Aeroplysinin-1, a Sponge-Derived Multi-Targeted Bioactive Marine Drug.

Authors:  Javier A García-Vilas; Beatriz Martínez-Poveda; Ana R Quesada; Miguel Ángel Medina
Journal:  Mar Drugs       Date:  2015-12-22       Impact factor: 5.118

9.  Germline GATA2 variant disrupting endothelial eNOS function and angiogenesis can be restored by c-Jun/AP-1 upregulation.

Authors:  Giulio Purgatorio; Elisa Piselli; Giuseppe Guglielmini; Emanuela Falcinelli; Loredana Bury; Valeria Di Battista; Fabrizia Pellanera; Francesca Milano; Caterina Matteucci; Cristina Mecucci; Paolo Gresele
Journal:  Haematologica       Date:  2022-05-01       Impact factor: 11.047

  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.