Literature DB >> 22851958

Commensal Pseudomonas species isolated from wastewater and freshwater milieus in the Eastern Cape Province, South Africa, as reservoir of antibiotic resistant determinants.

Isoken H Igbinosa1, Uchechukwu U Nwodo, Anibal Sosa, Mvuyo Tom, Anthony I Okoh.   

Abstract

Pseudomonas species are opportunistic pathogens with implications in a wide range of diseases including cystic fibrosis and sickle cell anaemia. Because of their status as multidrug resistant (MDR) and extremely drug resistant (XDR) bacteria Pseudomonas species represent a threat to public health. Prevalence, antibiogram and associated antibiotic resistant genes of Pseudomonas species isolated from freshwater and mixed liquor environments in the Eastern Cape Province of South Africa were assessed. Polymerase chain reaction (PCR) based technique was used to identify the isolates and screen for antibiotic resistant genes. The result shows occurrence of Pseudomonas spp. in freshwater and mixed liquor as follows: 71.42% and 37.5% (P. putida), 14.28% and 31.25% (P. fluorescens), 7.14% and 6.25% (P. aeruginosa) and 7.14% and 25% for other Pseudomonas species respectively. Disk diffusion antibiogram of the Pseudomonas isolates from the two locations showed 100% resistance to penicillin, oxacillin, clindamycin, rifampicin and 100% susceptibility to ciprofloxacin and gentamicin with varied percentage resistances to cephalothin, nalidixic acid, tetracycline, and ampicillin. The bla(TEM) antibiotic resistant gene was detected in 12.5% of P. putida, 57.14% of P. fluorescens, 100% P. aeruginosa and 40% in other Pseudomonas species. Similarly, Integrons conserved segment were detected in 12.5% of P. putida, 57.14% of P. fluorescens, 100% of P. aeruginosa and 40% of other Pseudomonas species. The presence of bla(TEM) gene and integrons conserved segment in some of the isolates is worrisome and suggest Pseudomonas species as important reservoirs of multidrug resistance genes in the Eastern Cape Province environment.

Entities:  

Keywords:  Pseudomonas; blaTEM; commensal; integron; multidrug resistant genes

Mesh:

Substances:

Year:  2012        PMID: 22851958      PMCID: PMC3407919          DOI: 10.3390/ijerph9072537

Source DB:  PubMed          Journal:  Int J Environ Res Public Health        ISSN: 1660-4601            Impact factor:   3.390


1. Introduction

Antibiotic resistance by bacteria has been recognized as a major medical problem facing humankind and to prevent this scourge, the knowledge of their antibiotic susceptibilities, antibiotic resistance genes and their dissemination is required [1]. Most studies on antibiotic resistance in the environment have focused on enteric pathogens including Escherichia coli [2], Enterococci [3], Aeromonas spp. [4] and Campylobacter [5]. However, antibiotic resistant bacteria in the environments are autochthonous, and as reservoirs of antibiotic resistant determinants, they could perpetuate the spread of antibiotic-resistance genes to human and animal pathogens by horizontal gene transfer through such mobile genetic elements as plasmids, transposons and integrons [2], especially in wastewater treatment facilities (WWTP) [6,7]. Integrons are genetic elements that aid the acquisition and expression of gene cassettes in bacteria, most of them are involved in antibiotic resistance. WWTP have been reported as important reservoirs of antibiotic resistant organisms/determinants which could persist in the treated effluent and subsequently released into the natural environment [8,9,10] and thus impact on the ecology of antimicrobial resistance in bacterial populations [11,12,13]. However, reports of commensal bacteria including the pseudomonads as sources of antibiotic resistance determinants in the environment are rare. Pseudomonas species are Gram negative motile rods belonging to the family Pseudomonaceae and found in various environments. Their ability to utilize different organic compounds as carbon and energy source as well as survival in the apparent absence of nutrients has been attributed to their genetic versatility which translates into enhanced metabolic activity with exceptional ability to adapt and colonize a wide variety of ecological niches including water, soil and rhizosphere [14]. Pseudomonas spp. are so well adapted in their environment that they survive extremes which includes temperatures ranging from 4 °C to 43 °C, and weak ion concentrations, among others. In this study, we assessed the incidence of Pseudomonas spp. in some freshwater environment and wastewater in the Eastern Cape Province of South Africa as well as the prevalence of antibiotic resistance genes in the isolates.

2. Materials and Methods

2.1. Sample Collection

The freshwater samples were collected from Kat river is situated in Fort Beaufort (geographical coordinates: S 32° 47.071′ E 026° 38.916′) and Tyume river in Alice (geographical coordinates: S 32° 46.629′ E026° 50.149′) in the Eastern Cape Province, South Africa. Similarly, the mixed liquor samples were collected from two wastewater treatment plants located in Fort Beaufort and Alice. The plants are relatively small with design capacities of 2–3 ML/day and operate using activated sludge technology. While the Alice plant empties its final effluent into the Tyume River, the Fort Beaufort plant empties its effluents into the Kat River. The latest Green Drop report on both plants suggests that they are deserving of attention towards ensuring that they produce effluents of acceptable qualities [15]. These samples were transported in cooler boxes to the laboratory of the Applied and Environmental Microbiology Research Group (AEMREG) University of Fort Hare, Alice for microbiological analyses. Sampling was conducted once during the four seasons of the year (autumn, winter spring, and summer).

2.2. Isolation Processing of Samples

All freshwater and wastewater samples were serially diluted and 100 µL of the diluted samples were plated on Glutamate Starch Phenol-red (GSP) agar and incubated overnight at 37 °C. Pseudomonas-like isolates were counted, isolated and purified on fresh GSP agar. Purified isolates were thereafter transferred unto Nutrient agar plates and incubated overnight at 37 °C and thereafter screened based on typical morphology, catalase and oxidase reactions.

2.3. Identification of Isolates by Polymerase Chain Reaction (PCR)

The purified isolates were grown on Nutrient agar for 24 h, and afterwards cells were harvested into 100 µL nuclease free water in 1.5 mL eppendorf tubes and homogenized by vortexing. The tubes were then placed in a heating block (Dri-block DB.2A, Techne, SA) at 100 °C for 10 min. After heating, the tubes were centrifuged at 25 °C for 3 min at 11,000 rpm (revolutions per minute) and immediately placed on ice. The supernatant was transferred to a new tube and used directly as DNA template for PCR assay [16]. Specific primers for Pseudomonas genus; PA-GS-F (5′-GACGGGTGAGTAATGCCTA-3′), and PA-GS-R (5′-CACTGGTGTTCCTTCCTATA-3′) were used in a 50 µL PCR reaction [17]. PCR conditions were as follows: 95 °C for 5 min, 10 cycles of 94 °C for 15 s, 53 °C for 30 s and 72 °C for 45 s; this was repeated for another 25 cycles with the exception of the 72 °C elongation step, which was increased by 5 seconds for every cycle; a final extension phase of 72 °C for 10 min was used. Pseudomonas aeruginosa reference strain ATCC 27853 was used as positive control and a reaction mixture containing Nuclease free water as negative control. The amplified PCR products of 617 bp were analysed by gel electrophoresis in 0.8% agarose gels stained with ethidium bromide (EtBr) 0.5 mg/L, for 1 h at 100 V in 0.5 × TAE buffer (40 mM Tris-HCl, 20 mM Na-acetate, 1 mM EDTA, pH 8.5) and then visualized and photographed with a imaging system Alliance 4.7 XD-79 (UVITEC Cambridge).

2.4. Specie Specificity Screening of Pseudomonas isolates

All isolates confirmed to belong to the Pseudomonas genus were further screened for three specific species of interest (P. fluorescens, P. aeruginosa and P. putida) selected based on on the dominance of these species from the results obtained on the preliminary identification carried out using API 20NE kit (data not shown) using the sets of primers listed in Table 1. The PCR conditions were as follows: P. fluorescens (2 min at 94 °C; 5 cycles consisting of 94 °C for 45 s, 55 °C for 1 min, 72 °C for 2 min; 35 cycles consisting of 92 °C for 45 s, 60 °C for 45 s, 72 °C for 2 min; final extension of 72 °C for 2 min; and final cooling at 4 °C); P. aeruginosa (95 °C for 1 min; 40 cycles of denaturation at 95 °C for 15 s, annealing at 58 °C for 20 s; final extension at 68 °C for 40 s); P. putida (initial denaturation at 95 °C for 10 min, then 30 cycles of denaturation at 94 °C for 30 s, annealing at 55 °C for 90 s and extension at 72 °C for 7 min).
Table 1

List of Primers used in this study.

Target genesSequences 5'–3'Amplicon size (bp)References
P. aeruginosa GGCGTGGGTGTGGAAGTC199[18]
TGGTGGCGATCTTGAACTTCTT
P. putida TCACCTCCGAGGAAACCAGCTTG676[19]
TCTGTTGTGAACGCCCTGTC
P. fluorescens TGCATTCAAAACTGACTG850[20]
AATCACACCGTGGTAACCG
blaTEM geneAGGAAGAGTATGATTCAACA535[21]
CTCGTCGTTTGGTATGGC
TetC geneGGTTGAAGGCTCTCAAGGGC505[22]
GGTTGAAGGCTCTCAAGGGC
Integrons conserved segment GGCATCCAAGCAGCAAGVariable[23]
AAGCAGACTTGACCTGA
blaOXA geneTGAGCACCATAAGGCAACCA311[24]
TTGGGCTAAATGGAAGCGTTT
blaampC GGTATGGCTGTGGGTGTTA882[25]
TCCGAAACGGTTAGTTGAG
List of Primers used in this study.

2.5. Antibiotic Susceptibility Testing

Antimicrobial susceptibility testing was performed using the disk diffusion method [17] with Muller-Hinton agar as the growth medium. Antibiotics were selected to represent some major classes of antibiotic and anti-pseudomonal antibiotics used as first line drug for pseudomonal infections. Antibiotics used in the study include penicillins (10 µg), clinamycins (2 µg), ciprofloxacin (5 µg), rafamycin (5 µg), trimethoprim (5 µg), sulphamethoxazole (25 µg), gentamicin (10 µg), chloramphenicol (30 µg), tetracycline (10 µg), erythromycin (15 µg), minocycline (30 µg), vacomycin (30 µg), cefotaxime (30 µg), nalidixic acid (30 µg), nitrofurantoin (300 µg), cephalothin (30 µg), ofloxacin (5 µg), ampicillin (25 µg), ampicillin-sulbactam (20 µg), oxacillin (1 µg). Disks were purchased from Mast Diagnostics (Mast Group, Merseyside, UK). Pseudomonas isolates were identified as susceptible, intermediate or resistant according to the National Committee for Clinical Laboratory Standard Guidelines (CLSI) [26].

2.6. PCR Detection of Antibiotic Resistant Genes

The DNA of the Pseudomonas isolates was extracted following the method of Sambrook and Russell [16]. The set of primers used for the detection of antibiotic resistance genes are shown in Table 1. The PCR reaction was done in a total volume of 25 µL and the following conditions: bla gene (3 min at 93 °C, 40 cycles of 1 min at 93 °C, 1 min at 55 °C and 1 min at 72 °C and finally 7 min at 72 °C); bla gene and bla gene (94 °C for 5 min, 30 cycles of 25 s of denaturation at 94 °C, 40 s of annealing at 53 °C and 50 s of extension at 72 °C and a final cycle at 7 min at 72 °C); TetC gene (3 min at 94 °C, followed by 30 cycles of 1 min at 94 °C, 1 min at 65 °C and 1 min at 72 °C followed by 10 min at 72 °C); Integrons conserved segment (initial denaturation at 94 °C for 12 min, 1 min of denaturation at 94 °C, 1 min of annealing at 55 °C and 5 min of extension at 72 °C for a total of 35 cycles; five seconds were added to the extension time at each cycle).

3. Results

3.1. Molecular Identification of Isolates

Molecular identification of the Pseudomonas at both genus and specie levels were carried out using the sets of primers shown in Table 1. Sixty isolates were identified to belong to the Pseudomonas genus, twenty eight (46.7%) of which were from freshwater, and 32 (53.3%) were from the wastewater mixed liquor. Freshwater and wastewater samples collected in the four seasons (winter, autumn, spring and summer) showed incidences of Pseudomonas of 50% (autumn), 21.43% (spring) and 28.57% (summer) respectively in freshwater samples with none detected in winter (Table 2). Similarly, distribution of Pseudomonas with respect to species were 85.71% for P. putida (autumn) and 14.29% for other Pseudomonas species. In spring, the distribution was 33.33% each for P. putida, P. aeruginosa and P. fluorescens (Table 2). Furthermore, the analysis of the mixed liquor showed incidences of Pseudomonas at 81.25% (spring) and 18.75% (summer) alone, but at the species level, the following were observed; 66.67% (P. putida) and 33.33% (P. fluorescens) during summer, and 30.77% each for P. putida, P. flourescens and other Pseudomonas spp. and 7.69% for P. aeruginosa during spring (Table 3), respectively.
Table 2

Prevalence of Pseudomonas species in freshwater samples.

Seasons a P. aeruginosa P. putida P. flourescens Other Pseudomonas spp.
Alice (%)FBF (%)Alice (%)FBF (%)Alice (%)FBF (%)Alice (%)FBF (%)
Autumn0012 (85.71)0002 (14.29)0
Winter00000000
Spring2 (33.33)02 (33.33)02 (33.33)000
Summer0006 (75)02(25)00

a Summer (November to March); autumn (April to May); winter (June to August); spring (September to October). Alice and Fort Beaufort (FBF) represents sampling locations.

Table 3

Prevalence of Pseudomonas species in mixed liquor samples.

Seasons a P. aeruginosa P. putida P. fluorescens Other Pseudomonas spp.
Alice (%)FBF (%)Alice (%)FBF (%)Alice (%)FBF (%)Alice (%)FBF (%)
Autumn00000000
Winter00000000
Spring02 (7.69)6 (23.08)2 (7.69)6 (23.08)2 (7.69)2 (7.69)6 (23.08)
Summer0004 (66.67)02 (33.33)00

a Summer (November to March); autumn (April to May); winter (June to August); spring (September to October). Alice and Fort Beaufort (FBF) represents sampling locations.

Prevalence of Pseudomonas species in freshwater samples. a Summer (November to March); autumn (April to May); winter (June to August); spring (September to October). Alice and Fort Beaufort (FBF) represents sampling locations. Prevalence of Pseudomonas species in mixed liquor samples. a Summer (November to March); autumn (April to May); winter (June to August); spring (September to October). Alice and Fort Beaufort (FBF) represents sampling locations. In general, with respect to the freshwater samples collected from Alice, 70% of the isolates recovered were P. putida, while the remaining 30% were equally (10% each) made up of P. fluorescens, P. aeruginosa and other Pseudomonas spp. For the Fort Beaufort water samples, P. putida constituted 75% of the isolates, while the remaining 25% were P. fluorescens. With respect to the mixed liquor samples from Alice, P. putida, and P. fluorescens made up 42.85% each of the isolates and the other Pseudomonas spp. constituted 14.29%. For the Fort Beaufort mixed liquor samples, the isolates composition includes 33.33% (P. putida), 22.22% (P. fluorescens), 11.11% (P. aeruginosa) and 33.33% (other Pseudomonas spp.).

3.2. Antibiotic Susceptibility Profile

The antibiograms of the Pseudomonas species are as shown in Table 4 and Table 5. All isolates (100%) from the two sites were susceptible to ciprofloxacin and gentamicin. Conversely, all (100%) were resistant to penicillin, oxacillin, vacomycin, trimethoprim, clindamycin and rifampicin. Varied resistances were observed against nitrofurantion as isolates from Alice showed the following resistance regimes; 60% (P. putida), 50% (P. fluorescens), 100% (P. aeruginosa) and 50% against other Pseudomonas spp. (Table 4). Unlike isolates from Alice, those from Fort Beaufort showed 100% resistance to nitrofurantoin. Isolates from Alice showed varied susceptibilities to cefotaxime in the order 60% (P. putida), 50% (P. flourescens), 100% (P. aeruginosa) and 50% (other Pseudomonas spp.). The antibiotic resistance pattern with respect to cephalothin was 100% each for P. putida, P. aeruginosa and the other Pseudomonas spp., and 75% for P. fluorescens. Ampicillin-sulbactam showed activity against P. putida (60%) and P. fluorescens (75%) (Table 4). Similarly, ofloxacin showed activity against P. putida (90%), P. flourescens (100%), P. aeruginosa (100%) and other Pseudomonas spp. (100%). Susceptibilities of isolates from Fort Beaufort to cephalothin were 50% (P. fluorescens), while all (100%) the P. putida, P. aeruginosa and the other Pseudomonas species were resistant (Table 5).
Table 4

Antibiotic susceptibilities of Pseudomonas species isolated from freshwater and mixed liquor samples from Alice.

AntibioticsP. aeruginosa P. putida P. fluorescens Other Pseudomonas species
S (%)I (%)R (%)S (%)I (%)R (%)S (%)I (%)R (%)S (%)I (%)R (%)
PenicillinPG00100001000010000100
AP001004010502507500100
OX00100001000010000100
TetracyclineT0100020404025255005050
MN1000030403025502550500
QuinolonesCIP10000100001000010000
NA0100030403025255005050
OFX10000901001000010000
CephemsCTX10000604005005050500
KF00100001000257500100
PhenicolsC1000020305025255050050
MacrolidesE01000001000257505050
AminoglycosidesGM10000100001000010000
GlycopeptidesVA00100001000010000100
NitrofuransNI100002020602507550050
Folate pathway inhibitorsTM00100300700010000100
SMX00100001005005000100
β-lactamsSAM001006010307502500100
LincosamidesCD0010000100010000100
AnsamycinsRP00100001000010000100

Legend: PG—penicillin, AP—Ampicillin, OX—Oxacillin, T—Tetracycline, MN—Minocycline, CIP—Ciprofloxacin, Na—Nalidixic acid, OFX—Ofloxacin, CTX—Cefotaxime, KF—Cephalothin, C—Chloramphenicol, E—Erythromycin, GM—Gentamicin, VA—Vacomycin, NI—Nitrofurantoin, TM—Trimethoprim, SMX—Sulphamethoxazole, SAM—Ampicillin-sulbactam, CD—Clindamycin, RP—Rifamycin.

Table 5

Antibiotic susceptibility of Pseudomonas species isolated from freshwater and mixed liquor samples from Fort Beaufort.

AntibioticsP. aeruginosa P. putida P. fluorescens Other Pseudomonas species
S (%)I (%)R (%)S (%)I (%)R (%)S (%)I (%)R (%)S (%)I (%)R (%)
PenicillinPG00100001000010000100
AP00100001000010033.33066.67
OX00100001000010000100
TetracyclineT001000406000100033.3366.67
MN00100080200505033.33066.67
QuinolonesCIP10000100001000010000
NA001002008001000033.3366.67
OFX10000800201000010000
CephemsCTX0010020602010000033.3366.67
KF00100001005050000100
PhenicolsC001000208000100033.3366.67
MacrolidesE00100001000010000100
AminoglycosidesGM10000100001000010000
GlycopeptidesVA00100001000010000100
NitrofuransNI00100001000010000100
Folate pathway inhibitorsTM00100001000010000100
SMX00100001005005000100
β-lactamsSAM00100020801000033.33066.67
LincosamidesCD00100001000010000100
AnsamycinsRP00100001000010000100

Legend: PG—penicillin, AP—Ampicillin, OX—Oxacillin, T—Tetracycline, MN—Minocycline, CIP—Ciprofloxacin, Na—Nalidixic acid, OFX—Ofloxacin, CTX—Cefotaxime, KF—Cephalothin, C—Chloramphenicol, E—Erythromycin, GM—Gentamicin, VA—vacomycin, NI—Nitrofurantoin, TM—Trimethoprim, SMX—Sulphamethoxazole, SAM—Ampicillin-sulbactam, CD—Clindamycin, RP—Rifamycin.

Antibiotic susceptibilities of Pseudomonas species isolated from freshwater and mixed liquor samples from Alice. Legend: PG—penicillin, AP—Ampicillin, OX—Oxacillin, T—Tetracycline, MN—Minocycline, CIPCiprofloxacin, Na—Nalidixic acid, OFX—Ofloxacin, CTXCefotaxime, KF—Cephalothin, C—Chloramphenicol, E—Erythromycin, GM—Gentamicin, VA—Vacomycin, NI—Nitrofurantoin, TM—Trimethoprim, SMX—Sulphamethoxazole, SAM—Ampicillin-sulbactam, CD—Clindamycin, RP—Rifamycin. Antibiotic susceptibility of Pseudomonas species isolated from freshwater and mixed liquor samples from Fort Beaufort. Legend: PG—penicillin, AP—Ampicillin, OX—Oxacillin, T—Tetracycline, MN—Minocycline, CIPCiprofloxacin, Na—Nalidixic acid, OFX—Ofloxacin, CTXCefotaxime, KF—Cephalothin, C—Chloramphenicol, E—Erythromycin, GM—Gentamicin, VA—vacomycin, NI—Nitrofurantoin, TM—Trimethoprim, SMX—Sulphamethoxazole, SAM—Ampicillin-sulbactam, CD—Clindamycin, RP—Rifamycin.

3.3. Identification of Antibiotic Resistance Genes

The screening for antibiotic resistance genes revealed the absence of bla, bla and TetC genes as they were not detected in any of the Pseudomonas isolates. However, Integron conserved segment was detected in freshwater samples in 10% of P. putida and 50% of P. fluorescens isolates. On the other hand, integron was found in isolates from mixed liquor in 33.33% (P. putida), 80% (P. flourescens), 100% (P. aeruginosa) and 50% for the other Pseudomonas spp. Similarly, bla gene was detected in these same organisms in the same proportion as Integron conserved segment.

4. Discussion

The incidences of Pseudomonas species in the studied sampling sites appeared to be season dependent as variation in seasonal distribution reflected different recovery rates of the bacteria. Nevertheless, it must be appreciated that this recovery rates may not represent the total population of viable Pseudomonas species present in the samples, but selective for some species based on the incubation temperature used, especially considering that some Pseudomonas species such as P. syringae do not grow at temperatures above 30 °C. The absence of the Pseudomonas during winter suggests that the recovered isolates could not strive at low temperature in line with their mesophilic nature. Higher prevalence of Pseudomonas isolates were recovered during spring followed by summer especially in the mixed liquor samples, suggesting that warmer temperature favoured the recovery of these isolates. Freshwater samples from Alice consistently showed higher incidences of Pseudomonas species when compared to Fort Beaufort as evident from the incidence of 71.42% compared to that of Fort Beaufort (28.57%). Conversely, a relatively higher number of isolates was recovered in mixed liquor from Fort Beaufort (56.25%) as against Alice (43.25%). These variations may be attributed to human activities at various sites of the rivers, however; this explanation will not suffice for mixed liquor, although the limitations on overreliance on one primer pair/species for speciation of the Pseudomonas species must be appreciated. Similarly, the variation of incidence with season needs to be further investigated as it is not clear why season play a role in the occurrence of Pseudomonas species. Resistance to different classes of antibiotics shown by the Pseudomonas species isolated from both freshwater and mixed liquor is an indication of the potential of the environment as a reservoir for antibiotic resistant organisms. Wastewater treatment process has been put forward as a potential vehicle for the selective enhancement and increase of multidrug resistant bacteria in the aquatic environment [8]. Although the findings of Gilliver et al. [27] in England reported on the occurrence of acquire antibiotic resistance characters in faecal bacteria from wild rodents in woodland sites and Pallecchi et al. [28] who studied a secluded population of the Peruvian Amazonas observed the presence of qnrB gene in commensal enterobacteria, both findings were with no prior exposure to antibiotics, as the areas were remote and devoid of human activities. Nevertheless the report by Osterblad et al. [29] and Thaller et al. [30] potentiate the presence of anthropic activities as a selective enrichment of multidrug resistant bacteria in the environment which is in accordance with the results of our findings, and suggests that the restriction of the misuse and overuse of antibiotics is a vital instrument in antibiotic resistance control. The antibiotics, ciprofloxacin and gentamicin are the only broad spectrum antibiotics that showed high activities against all the isolates, while other antibiotics showed little or no activity against them, thus suggesting these isolates to be multi-drug resistant. However, an intriguing situation arose where all isolates were resistant to oxacillin but blaOXA gene was not detected in any of the isolates, despite that blaOXA codes for oxacillin resistance. Hence, it becomes obvious that resistance to antibiotics may be a function of more than one gene, or better still a combination of both genetic and environmental factors. Li et al. [7] reported the presence of bla in 17.3% of the bacteria isolated from penicillin production wastewater treatment plant effluent and 11% from the river downstream the plant, however, in these organisms, bla gene was not detected. Similar trend was observed in our current study, however, bla gene was detected only in isolates from mixed liquor, portending mixed liquor as a reservoir for antibiotic resistant genes. Also, noting that Pseudomonas is the most competent bacteria with regards to DNA uptake [31] and ability to produce transformants [32] in different environmental conditions, the chances that it picks up genes from the environment is high and this could very well be the source of these resistance genes in the isolates. The Pseudomonas isolates from freshwater and mixed liquor showed the presence of integrons, however those from mixed liquor similarly harbour bla gene. The survival of bla gene containing Pseudomonas species in wastewater treatment processes [33] could result in the dissemination of the β-lactamase genes into the environment and consequently increase the risk of the environment as reservoirs of antibiotic resistance determinants.

5. Conclusions

Pseudomonas species pose a threat to public health as it has been shown to harbour some antibiotic resistance genes. These resistance genes could be transferred to pathogenic organisms, and result in difficulty in treatment and limitation in treatment options. Although resistance is shown to various antibiotics; they have high susceptibilities to ciprofloxacin and gentamicin. Similarly, the presence of antibiotic resistance genes in these environmental isolates suggests Pseudomonas species as carriers and sources of antibiotics resistant genes with the potential to disseminate these genes into the environment for other organisms to pick up or transfer horizontally to other competent bacteria. A detailed assessment of the role of season on the incidence of Pseudomonas species, and how their antibiotic resistant genes contribute individually and collectively to antibiotic resistance is a subject of ongoing investigation in our group.
  26 in total

1.  Antibiotic resistance found in wild rodents.

Authors:  M A Gilliver; M Bennett; M Begon; S M Hazel; C A Hart
Journal:  Nature       Date:  1999-09-16       Impact factor: 49.962

2.  Antibiotic resistance in soil and water environments.

Authors:  Nwadiuto Esiobu; Lisa Armenta; Joseph Ike
Journal:  Int J Environ Health Res       Date:  2002-06       Impact factor: 3.411

3.  Antimicrobial resistance among enterococci from pigs in three European countries.

Authors:  Frank Møller Aarestrup; Henrik Hasman; Lars Bogø Jensen; Miguel Moreno; Inmaculada A Herrero; Lucas Domínguez; Maria Finn; Anders Franklin
Journal:  Appl Environ Microbiol       Date:  2002-08       Impact factor: 4.792

4.  Characterization of antimicrobial resistance and class 1 integrons found in Escherichia coli isolates from humans and animals in Korea.

Authors:  Hee Young Kang; Young Sook Jeong; Jae Young Oh; Sung Ho Tae; Chul Hee Choi; Dong Chan Moon; Won Kil Lee; Yoo Chul Lee; Sung Yong Seol; Dong Taek Cho; Je Chul Lee
Journal:  J Antimicrob Chemother       Date:  2005-03-10       Impact factor: 5.790

5.  Class 1 integrons in Pseudomonas aeruginosa isolates from clinical settings in Amazon region, Brazil.

Authors:  Erica L Fonseca; Verônica V Vieira; Rosângela Cipriano; Ana C P Vicente
Journal:  FEMS Immunol Med Microbiol       Date:  2005-06-01

6.  Genetic diversity and antibiotic resistance patterns in a campylobacter population isolated from poultry farms in Switzerland.

Authors:  M Wittwer; J Keller; T M Wassenaar; R Stephan; D Howald; G Regula; B Bissig-Choisat
Journal:  Appl Environ Microbiol       Date:  2005-06       Impact factor: 4.792

7.  Antibiotic resistance. How wild are wild mammals?

Authors:  M Osterblad; K Norrdahl; E Korpimäki; P Huovinen
Journal:  Nature       Date:  2001-01-04       Impact factor: 49.962

8.  Development of PCR assay to identify Pseudomonas fluorescens and its biotype.

Authors:  Mauro Scarpellini; Laura Franzetti; Antoniëtta Galli
Journal:  FEMS Microbiol Lett       Date:  2004-07-15       Impact factor: 2.742

9.  Relationship between clinical and environmental isolates of Pseudomonas aeruginosa in a hospital setting.

Authors:  Lídia Ruiz; M Angeles Domínguez; Neus Ruiz; Miguel Viñas
Journal:  Arch Med Res       Date:  2004 May-Jun       Impact factor: 2.235

10.  Prevalence and antimicrobial-resistance of Pseudomonas aeruginosa in swimming pools and hot tubs.

Authors:  Jonathan K Lutz; Jiyoung Lee
Journal:  Int J Environ Res Public Health       Date:  2011-02-18       Impact factor: 3.390

View more
  8 in total

1.  Molecular Characterization and Phylogenetic Analysis of Pseudomonas aeruginosa Isolates Recovered from Greek Aquatic Habitats Implementing the Double-Locus Sequence Typing Scheme.

Authors:  Olga Pappa; Apostolos Beloukas; Apostolos Vantarakis; Athena Mavridou; Anastasia-Maria Kefala; Alex Galanis
Journal:  Microb Ecol       Date:  2016-12-28       Impact factor: 4.552

2.  Contribution of Time, Taxonomy, and Selective Antimicrobials to Antibiotic and Multidrug Resistance in Wastewater Bacteria.

Authors:  Hannah K Gray; Keith K Arora-Williams; Charles Young; Edward Bouwer; Meghan F Davis; Sarah P Preheim
Journal:  Environ Sci Technol       Date:  2020-12-01       Impact factor: 9.028

3.  Pseudomonas putida and Pseudomonas fluorescens Species Group Recovery from Human Homes Varies Seasonally and by Environment.

Authors:  Susanna K Remold; Megan E Purdy-Gibson; Michael T France; Thomas C Hundley
Journal:  PLoS One       Date:  2015-05-29       Impact factor: 3.240

4.  Colistin Resistance of Pseudomonas aeruginosa Isolated from Snakes in Taiwan.

Authors:  Po-Yu Liu; Ling-Ling Weng; Shu-Ying Tseng; Chou-Chen Huang; Ching-Chang Cheng; Yan-Chiao Mao; Kwong-Chung Tung
Journal:  Can J Infect Dis Med Microbiol       Date:  2017-09-25       Impact factor: 2.471

Review 5.  Systematic review in South Africa reveals antibiotic resistance genes shared between clinical and environmental settings.

Authors:  Mutshiene Deogratias Ekwanzala; John Barr Dewar; Ilunga Kamika; Maggy Ndombo Benteke Momba
Journal:  Infect Drug Resist       Date:  2018-10-17       Impact factor: 4.003

6.  The prevalence of Pseudomonas aeruginosa and multidrug resistant Pseudomonas aeruginosa in healthy captive ophidian.

Authors:  Andrea Sala; Francesco Di Ianni; Igor Pelizzone; Mara Bertocchi; Davide Santospirito; Francesco Rogato; Sara Flisi; Costanza Spadini; Tiziano Iemmi; Emanuele Moggia; Enrico Parmigiani; Sandro Cavirani; Simone Taddei; Clotilde S Cabassi
Journal:  PeerJ       Date:  2019-04-12       Impact factor: 2.984

7.  Phenotypic and genomic characterization of Pseudomonas putida ITEM 17297 spoiler of fresh vegetables: Focus on biofilm and antibiotic resistance interaction.

Authors:  Francesca Fanelli; Leonardo Caputo; Laura Quintieri
Journal:  Curr Res Food Sci       Date:  2021-02-16

Review 8.  Pseudomonas fluorescens Complex and Its Intrinsic, Adaptive, and Acquired Antimicrobial Resistance Mechanisms in Pristine and Human-Impacted Sites.

Authors:  Myllena Pereira Silverio; Gabriela Bergiante Kraychete; Alexandre Soares Rosado; Raquel Regina Bonelli
Journal:  Antibiotics (Basel)       Date:  2022-07-22
  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.