Literature DB >> 22848622

Analysis of autophagy genes in microalgae: Chlorella as a potential model to study mechanism of autophagy.

Qiao Jiang1, Li Zhao, Junbiao Dai, Qingyu Wu.   

Abstract

BACKGROUND: Microalgae, with the ability to mitigate CO(2) emission and produce carbohydrates and lipids, are considered one of the most promising resources for producing bioenergy. Recently, we discovered that autophagy plays a critical role in the metabolism of photosynthetic system and lipids production. So far, more than 30-autophagy related (ATG) genes in all subtypes of autophagy have been identified. However, compared with yeast and mammals, in silico and experimental research of autophagy pathways in microalgae remained limited and fragmentary. PRINCIPAL
FINDINGS: In this article, we performed a genome-wide analysis of ATG genes in 7 microalgae species and explored their distributions, domain structures and evolution. Eighteen "core autophagy machinery" proteins, four mammalian-specific ATG proteins and more than 30 additional proteins (including "receptor-adaptor" complexes) in all subtypes of autophagy were analyzed. Data revealed that receptor proteins in cytoplasm-to-vacuole targeting and mitophagy seem to be absent in microalgae. However, most of the "core autophagy machinery" and mammalian-specific proteins are conserved among microalgae, except for the ATG9-cycling system in Chlamydomonas reinhardtii and the second ubiquitin-like protein conjugation complex in several algal species. The catalytic and binding residues in ATG3, ATG5, ATG7, ATG8, ATG10 and ATG12 are also conserved and the phylogenetic tree of ATG8 coincides well with the phylogenies. Chlorella contains the entire set of the core autophagy machinery. In addition, RT-PCR analysis verified that all crucial ATG genes tested are expressed during autophagy in both Chlorella and Chlamydomonas reinhardtii. Finally, we discovered that addition of 3-Methyladenine (a PI3K specific inhibitor) could suppress the formation of autophagic vacuoles in Chlorella.
CONCLUSIONS: Taken together, Chlorella may represent a potential model organism to investigate autophagy pathways in photosynthetic eukaryotes. The study will not only promote understanding of the general features of autophagic pathways, but also benefit the production of Chlorella-derived biofuel with future commercial applications.

Entities:  

Mesh:

Substances:

Year:  2012        PMID: 22848622      PMCID: PMC3407069          DOI: 10.1371/journal.pone.0041826

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Microalgae represent a group of tiny and usually unicellular algae, including numerous marine and freshwater species [1]. Microalgae have long been considered potential resources for renewable bioenergy production [2]–[4]. The cellular lipids in several species of microalgae can be used to produce biofuel. For instance, Chlorella protothecoides is one of the promising model oleaginous microalgae to produce commercially viable biodiesel because of its rapid biomass production, high photosynthetic efficiency and high lipid content (50.3% of dry cell weight) [5]–[8]. Algae use light energy to convert water and carbon dioxide into glucose and oxygen. Ideally, microalgal biodiesel is carbon-neutral and feasible without affecting global food supply [1]. Algal biofuel research has been a hot topic and attracted experts both in biotechnology and biochemical engineering. However, most of these studies focused on algal cultivation and transesterification. Molecular and cellular mechanisms concerning lipid accumulation in model oleaginous microalgae remains elusive. Recently, we identified that autophagy plays a critical role in the metabolism of photosynthetical system and in the production of lipids in Chlorella. Inhibition of autophagy impairs the breakdown of chloroplasts and decreases lipid accumulation (Jiang Q. et. al., manuscript in preparation). Thus, a better understanding of the cellular and molecular aspects of autophagy is required for the production of biofuel and mitigating CO2 emission. Programmed cell death (PCD) is a crucial mechanism involved in many physiological and pathological processes. Studies of PCD used to focus on apoptosis (Type I PCD, self-killing) and recently, autophagy (Type II PCD, self-eating) became an active field of study. Autophagy is a conserved catabolic process for the degradation of long-lived organelles and proteins, which consists of several sequential processes. The early stage of autophagy includes induction and formation of autophagosomes and the late stage includes fusion of autophagosome and lysosome/vacuole, degradation and lysosome/vacuole reformation [9]. In metazoa, autophagic dysfunction is implicated in cancer, ageing, and neurodegeneration [10], [11]. In plants, autophagy induced by starvation or senescence is responsible for nutrient recycling and negative regulation of apoptosis, and has a pro-death function in hypersensitive cell death [12], [13]. Autophagy studies in filamentous fungi Podospora anserina, Aspergillus oryzae and A. fumigatus suggested the role of autophagy in fungal differentiation [14], [15]. Various forms of autophagy, either selective or not, have been discovered, including macroautophagy, microautophagy, Cvt (cytoplasm-to-vacuole targeting), and pexophagy. Macroautophagy is a mechanism responsible for the degradation of cytoplasm using specialized cytosolic vesicles, while Cvt is a selective pathway in which at least two precursor hydrolases are transported to the vacuole [16]. Pexophagy, the selective autophagic degradation of peroxisomes, has been widely studied in Pichia pastoris [17]. Certain organelles can also be selectively degraded through autophagy, including mitochondria (mitophagy) and ribosomes (ribophagy) [18], [19]. ATG (uophay-related) genes encode proteins required for autophagy and were first identified in S. cerevisiae. Afterwards, several putative ATG genes maintaining sequence and functional conservation were revealed in yeast, filamentous fungi, mammalian, and plant genomes [20], [21]. Besides, TOR (the target of rapamycin) is a conserved Ser/Thr kinase that regulates autophagy from yeast to plants and mammals [22]. In addition, several proteins absent in yeast are crucial for autophagy in mammals, including UVRAG (UV irradiation resistance-associated gene, for activating VPS34), DRAM (Damage-Regulated Autophagy Modulator, like TOR), FIP200 (FAK family-interacting protein of 200 kDa) and ATG101 (mediating mTOR signalling) [23]–[27]. To date, more than thirty ATG proteins have been identified in various autophagy pathways. ATG genes required for autophagosome formation are termed the “core autophagy machinery”. Seventeen out of 34 known ATG proteins constitute three series of core autophagic machinery, including the ATG9-Cycling system (transmembrane protein ATG9, the ATG1 kinase complex ATG1, ATG13, ATG2, ATG18, ATG23 and ATG27), the phosphatidylinositol 3-kinase (PI3K) complex (VPS34, ATG6/VPS30, ATG14, vacuolar protein sorting VPS15, and VPS38), and the ubiquitin-like protein (Ubl) conjugation system (Ubl protein ATG8, ATG12, ATG3, ATG10, ATG7, ATG4, ATG5 and ATG16) [28]. Experimental evidence for the presence of autophagic-like vacuoles in microalgae has been described in four species, including C. reinhardtii treated with rapamycin or a mutant C. reinhardtii strain lacking phytoene synthase, diatom Cyclotella meneghiniana exposed to chlorinated benzenes, and uninfluenced growth of Dunaliella primolecta [29]–[32]. Putative ATG proteins have been previously identified in three algal species [33]. The presence and function of TOR genes have also been surveyed in microalgae, which demonstrated the presence of TOR homolog in Chlamydomonas reinhardtii. After treatment with rapamycin, FKBP12 (the 12-kD FK506-binding protein) binds rapamycin and inactivates TOR. Besides, in silico analysis of TOR was performed and several putative homologs of TOR were identified as well [32], [33]. However, experimental evidence and in-silico studies of autophagy pathways in model oleaginous microalgae have not been reported. In order to identify ATG genes and investigate autophagic pathway in microalgae, including promising oleaginous microalgae, we manually checked all of the ATG genes and explored their distributions, domain structures and evolution. More than 40 related proteins in the core machinery and representative subtypes were used as queries. The results showed that more ATG genes are present than currently annotated in databases, because certain genes were either missed or incorrectly annotated. Furthermore, RT-PCR was performed for several identified ATG genes to confirm the existence of specific mRNAs in Chlorella and Chlamydomonas. The results suggest that Chlorella, one of the model oleaginous microalgae, could become a potential model organism to investigate autophagy pathways in photosynthetic eukaryotes. The study will not only promote understanding of the general features of autophagic pathways, but also benefit the production of Chlorella-derived biofuel for future commercial applications.

Results

Identification of ATG genes in microalgae and choanoflagellate

Because the molecular insights of the autophagic pathway mainly come from yeast species, most of the ATG proteins are identified in S. cerevisiae (Sc) and P. pastoris (Pp). Putative homologs of the Sc ATG or Pp ATG proteins were identified in 9 microalgae genomes (Table 1). For comparison, we also searched the genome of the marine choanoflagellate Monosiga brevicollis, which is the closest unicellular relative of animals. However, we cannot exclude the possibility that, in certain species, not all of the ATG sequences could be identified because of excessively high evolutional divergence.
Table 1

Species analyzed in this study.

AbbreviationOrganismsKey FeatureEnvironmentPrior experimental evidence of autophagy
Cr Chlamydomonas reinhardtii Chlorophyceae (green alga, Model organism)FreshwaterYes
Cv Chlorella sp. NC64A (Chlorella variabilis)Trebouxiophyceae (green alga)Freshwater; symbioticUnpublished results
Mb Monosiga brevicollis Choanoflagellate (protist, closest animal relative)Marine; heterotrophicNA
Mp Micromonas pusilla CCMP1545Prasinophyceae (ancient green alga)Marine (temperate coastal waters)NA
Mr Micromonas pusilla NOUM17 (Micromonas sp. RCC299)Prasinophyceae (ancient green alga)Marine (tropical waters)NA
Ol Ostreococcus lucimarinus Prasinophyceae (ancient green alga)Marine (upper water column)NA
Ot Ostreococcus tauri Prasinophyceae (ancient green alga)Marine (upper water column)NA
Pt Phaeodactylum tricornutum CCAP1055/1DiatomMarineNA
Tp Thalassiosira pseudonana CCMP1335DiatomMarineNA
Vc Volvox carteri Chlorophyceae (green alga)FreshwaterNA

Na, not present.

Na, not present.

ATG proteins involved in the core machinery

The core autophagy machinery in yeast and plants can be divided into three systems: 1) ATG9-Cycling, 2) the phosphatidylinositol 3-kinase (PI3K), and 3) the ubiquitin-like protein complex [21]. Most genes belonging to the core machinery have been identified in microalgae and choanoflagellates (summarized in Table 2–9, domain structure included).
Table 2

Distribution of ATG proteins and domains in microalgae and M. brevicollis: ATG proteins involved in ATG9-Cycling system.

ATG1 (NP_011335.1)ATG2 (NP_014157.1)ATG9 (NP_010132.1)ATG13 (NP_015511.1)ATG18 (NP_444297.1)ATG23 (NP_013535.1)ATG27 (NP_012357.2)
(PKc_like+DUF3543+S_TKc)(ATG_C)(APG9)(ATG13)(WD40)(no)(ATG27)
Chlorella sp. NC64A (Chlorella variabilis)EFN52208.1(PKc_like+S_TKc) EFN56161.1(S_TKc+STKc_AGC)NaEFN53041.1 (APG9)EFN59140.1 (ATG13)EFN51454.1(WD40)EFN58088.1(WD40)NaNa
Chlamydomonas reinhardtii XP_001695074.1(PKc_like+S_TKc) XP_001696712.1(PKc_like+Pkinase)NaNaNaXP_001698567.1(WD40) XP_001689953.1(WD40)NaNa
Micromonas pusilla CCMP1545XP_003059119.1(PKc_like+S_TKc)XP_003060662.1 (ATG_C)XP_003057426.1 (APG9)XP_003061623.1 (ATG13)XP_003059105.1(WD40) XP_003060952.1(WD40)NaNa
Micromonas sp. RCC299XP_002500392.1(PKc_like+S_TKc)XP_002504952.1 (ATG_C+MRS6)XP_002502107.1 (APG9)XP_002509135.1 (ATG13)XP_002500515.1(WD40+RING+Prp19) XP_002500377.1(WD40) XP_002955876.1(WD40) XP_002503507.1(WD40)NaNa
Monosiga brevicollis XP_001749266.1(PKc_like+S_TKc)XP_001743636.1 (ATG_C)XP_001749415.1 (APG9)NaXP_001743556.1(WD40) XP_001746830.1(WD40) XP_001749074.1(WD40) XP_001746866.1(WD40+SMC_prok_A)NaXP_001748990.1(ATG27) XP_001748596.1(ATG27) XP_001748431.1(ATG27+Frag1+WSC+Somatomedin_B+Kelch_1)
Ostreococcus lucimarinus XP_001418427.1(PKc_like+S_TKc) XP_001420104.1(S_TKc+STKc_AGC)XP_001417521.1 (ATG_C)XP_001418016.1 (APG9)XP_001420417.1 (ATG13)XP_001418375.1(WD40) XP_001421096.1(WD40)NaNa
Ostreococcus tauri XP_003079793.1(PKc_like) XP_003081539.1(S_TKc+STKc_AGC)XP_003078813.1 (ATG_C)XP_003079378.1 (APG9)XP_003081852.1 (ATG13)XP_003079686.1(WD40+COG4886) XP_003079697.1(WD40+AdoMet_MTase)NaNa
Phaeodactylum tricornutum XP_002178626.1(PKc_like+S_TKc) XP_002180851.1(PKc_like+STYKc)XP_002185265.1 (ATG_C) XP_002184167.1 (ATG_C)XP_002180897.1 (APG9)XP_002176466.1 (ATG13)XP_002182364.1(WD40+PRP4) XP_002182356.1(WD40)NaNa
Thalassiosira pseudonana XP_002291487.1(PKc_like+S_TKc) XP_002290245.1(S_TKc+STKc_AGC)NaXP_002288788.1 (APG9)XP_002294456.1 (ATG13)XP_002292898.1 (WD40)NaNa
Volvox carteri XP_002948563.1(PKc_like+S_TKc) XP_002956722.1(PKc_like+Pkinase)XP_002951181.1 (ATG_C+MRS6+DUF946)XP_002952621.1 (APG9)XP_002954490.1 (ATG13)XP_002954593.1(WD40+ PKD_channel+COG2319+Ion_trans) XP_002955876.1(WD40) XP_002947339.1(WD40+DNA_BRE_C)NaNa

Na, not present or not identifiable; numbers indicate GenBank DNA accession numbers.

Table 9

Distribution of ATG proteins and domains in microalgae and M. brevicollis: Non-yeast ATG proteins.

FIP200(Q9ESK9.3) (ATG11+DUF3584+ SMC_prok_B)DRAM(AAH13773.4)(Frag1) (NP_001015869.1) (Frag1)ATG101(NP_001092143.1) (DUF1649)UVRAG AAF53277.1(ATG14) NP_003360.2(ATG14+C2)
Chlorella sp. NC64A (Chlorella variabilis)NaNaEFN56906.1(DUF1649)EFN52878(ATG14+NIF) EFN51481(ATG14)
Chlamydomonas reinhardtii NaNaXP_001700159.1(DUF1649)XP_001693556(ATG14)
Micromonas pusilla CCMP1545NaXP_003061508(Frag1)XP_003057605.1(DFU1649)XP_003064431(ATG14)
Micromonas sp. RCC299NaXP_002501355.1(Frag1) XP_002509248.1(Frag1)XP_002501928.1(DUF1649)XP_002502757(ATG14+BAR)
Monosiga brevicollis NaXP_001744476.1(Frag1) XP_001748431.1(Frag1+ATG27+WSC+Somatomedin_B+Kelch_1+Kelch_6 ) XP_001747358.1(Frag1+SPX) XP_001746889.1(Frag1+SPX)NaXP_001745375(ATG14+FmrO+GAS)
Ostreococcus lucimarinus NaXP_001416868.1(Frag1)XP_001421448.1(DUF1649) XP_001421417.1(DUF1649)XP_001422247.1(ATG14) XP_001421563.1(ATG14)
Ostreococcus tauri NaXP_003078016.1(Frag1)NaXP_003084186(ATG14) XP_003083512(ATG14)
Phaeodactylum tricornutum XP_002186517.1(ATG11+APG17)NaNaXP_002177421 (ATG14) XP_002176147 (ATG14) XP_002185098(ATG14)
Thalassiosira pseudonana XP_002289246.1(ATG11+Histidinol_dh)NaXP_002287468.1(DUF1649)XP_002294494.1(ATG14) XP_002288406(ATG14)
Volvox carteri NaNaXP_002951085.1(DUF1649)XP_002948890(ATG14) XP_002953012(ATG14)
Na, not present or not identifiable; numbers indicate GenBank DNA accession numbers. Na, not present or not identifiable; numbers indicate GenBank DNA accession numbers. Na, not present or not identifiable; numbers indicate GenBank DNA accession numbers. Na, not present or not identifiable; numbers indicate GenBank DNA accession numbers. Na, not present or not identifiable; numbers indicate GenBank DNA accession numbers. Na, not present or not identifiable; numbers indicate GenBank DNA accession numbers. Na, not present or not identifiable; numbers indicate GenBank DNA accession numbers.

1. ATG proteins involved in ATG9-Cycling system (ATG1, ATG2, ATG9, ATG13, ATG18, ATG23, and ATG27)

As indicated in Table 2 and Figure 1A, several core proteins in the ATG9-cycling system, including ATG1, ATG2, ATG9, and ATG13, are conserved in most of the species studied. In baker's yeast, cycling of ATG9 between PAS (pre-autophagosomal structure) and non-PAS requires the ATG1 kinase complex (including ATG1 and a regulatory subunit ATG13), ATG2 and ATG18 (two interacting peripheral membrane proteins). A single ATG9 homologue is present in each of the microalgal genomes. However, ATG23 and ATG27 are missing in microalgae. By contrast, M. brevicollis maintains three putative ATG27 proteins, which are usually absent in plants and animals. The presence of multiple members of the WD40 family in microalgae, which are equally similar to ScATG18, precludes proper identification of ATG18. Besides, several additional domains identified in ATG1 imply that ATG1 is a multifunctional protein and similar conclusions were obtained from yeast to humans [34]. To our surprise, several core proteins involved in ATG9-cycling system seem to be missing in C. reinhardtii, including ATG2, ATG9, and ATG13. These findings are not consistent with the fact that deletion of ATG9 leads to complete abrogation of autophagy, while atg23 Δ or atg27 Δ strains can perform autophagy at a low level in S. cerevisiae [13], [35], [36].
Figure 1

Distribution of autophagy components in microalgae and choanoflagellate.

Blank box: no homologues or putative orthologs could be found in any of the seven microalgae genomes; green box: predicted orthologs were detected in each of the genomes studied; blue box: putative orthologs were detected in some algal genomes; yellow box: homologues could only be found in Monosiga brevicollis. A: Distribution of putative ATG proteins in “core autophagic machinery”. B: The existence of homologues of non-yeast ATG proteins. C: The existence of the orthologs of additional pathway-specific requirement.

Distribution of autophagy components in microalgae and choanoflagellate.

Blank box: no homologues or putative orthologs could be found in any of the seven microalgae genomes; green box: predicted orthologs were detected in each of the genomes studied; blue box: putative orthologs were detected in some algal genomes; yellow box: homologues could only be found in Monosiga brevicollis. A: Distribution of putative ATG proteins in “core autophagic machinery”. B: The existence of homologues of non-yeast ATG proteins. C: The existence of the orthologs of additional pathway-specific requirement.

2. ATG proteins involved in PI3K complex (ATG6/VPS30, ATG14, VPS15, VPS34 and VPS38)

ATG proteins in the PI3K complex, including VPS34, VPS15, ATG6 and ATG14, are almost fully conserved in microalgae (see Table 3 and Figure 1A). VPS34, the only class III phosphatidylinositol 3-kinase, participates in multiple membrane trafficking events in macroautophagy, Cvt pathway and pexophagy [37]. ScVPS34 contains three domains (including PI3Kc_III, PI3Ka_III, and C2_PI3K_class_III), whereas in several algal orthologs of VPS34, only one or two related domains could be identified, which suggests that the function of VPS34 in yeast may be compensated by two or three proteins in microalgae. For instance, EFN55063.1 of C. variabilis maintains PI3Kc_like and FATC domains, while XP_002184171.1 from Phaeodactylum tricornutum exclusively maintains a PI3Kc- like domain. Interestingly, although orthologs of ScATG14 required for PI3K complex I were identified in microalgae, an ATG14-like protein was missing in some metazoans (Table 3). This result suggests that the molecular mechanisms of the PI3K complex require species-specific proteins in plants and animals.
Table 3

Distribution of ATG proteins and domains in microalgae and M. brevicollis: ATG proteins involved in PI3K complex.

ATG6 (NP_015205.1) (APG6)ATG14 (NP_009686.1) (ATG14)VPS34 (NP_013341.1) (PI3Kc_III+PI3Ka_III+C2_PI3K_class_III)VPS15 (NP_009655.2) (Pkinase+WD40)
Chlorella sp. NC64A (Chlorella variabilis)CP04629(APG6)EFN52878(ATG14+NIF) EFN51481(ATG14)EFN50586.1(C2) EFN55063.1(PI3Kc_like+FATC) EFN54838.1(PI3Kc_like+PI3Ka)EFN54741.1(Pkinase+WD40+HEAT) ACQ83472.1(Pkinase+NAF+DUF552) EFN59818.1(Pkinase)
Chlamydomonas reinhardtii XP_001689505.1(APG6)XP_001693556(ATG14)AAC50017.1(PI3Kc_III+PI3Ka_III+PI3Kc_like) XP_001700926.1(PI4Kc_III_alpha+PI3Ka)XP_001689631.1 (PI3Kc_III+PI3Ka_III+C2+PI3Kc_like)XP_001703148.1(Pkinase) XP_001703541.1(Pkinase+IQ)
Micromonas pusilla CCMP1545XP_003060474.1(APG6)XP_003064431(ATG14)XP_003062450.1(PI3Kc_III+PI3Ka_III+C2)XP_003055278.1 (Pkinase+WD40+HEAT)
Micromonas sp. RCC299XP_002505141.1(APG6)XP_002502757 (ATG14+BAR)XP_002506109.1 (PI3Kc_III+PI3Ka_III+C2)XP_002499874.1(Pkinase)
Monosiga brevicollis XP_001748523.1 (APG6+RPN7+PCI)XP_001745375 (ATG14+FmrO+GAS)XP_001748498.1(PI3Kc+C2A_PI3K_class_II+PI3Ka+C2A_SLP+PX_domain+SH3) XP_001744392.1(PI3Kc_III) XP_001744858.1 (PI3Kc+PI3Ka+C2+PI3K_rbd+PI3K_p85B)XP_001743460.1(Pkinase) XP_001749069.1(Pkinase) XP_001750681.1(Pkinase) XP_001749118.1 (Pkinase+WD40+2_5_RNA_ligase)
Ostreococcus lucimarinus XP_001417602.1(APG6)XP_001422247.1(ATG14)XP_001421563.1(ATG14)XP_001416907.1(PI3Kc_III+PI3Ka_III)XP_001417017.1(Pkinase+WD40+HEAT)
Ostreococcus tauri XP_003079004.1(APG6)XP_003084186(ATG14) XP_003083512(ATG14)XP_003078099.1(PI3Kc_III+PI3Ka_III+C2)XP_003078318.1(Pkinase+WD40+HEAT)
Phaeodactylum tricornutum XP_002176511.1(APG6) XP_002177919.1(APG6)XP_002177421 (ATG14) XP_002176147 (ATG14) XP_002185098(ATG14)XP_002184171.1(PI3Kc_like)XP_002184017.1(Pkinase+WD40) XP_002178422.1 (Pkinase+TPR_2+TPR_1)
Thalassiosira pseudonana XP_002292845.1(APG6) XP_002291400.1(APG6)XP_002294494.1(ATG14) XP_002288406(ATG14)XP_002293246.1(PI3Kc_like+PI3Ka_III) XP_002296868.1(PI3Kc_like)XP_002288602.1(Pkinase) XP_002292529.1(Pkinase+DUF2271) XP_002293876.1(Pkinase) XP_002289061.1(Pkinase+WD40+IKI3+MMS19_N) XP_002288266.1(Pkinase+MCR_beta+Phage_head_chap)
Volvox carteri XP_002952061.1(APG6)XP_002948890(ATG14) XP_002953012(ATG14)XP_002954001.1 (PI3Kc_III+PI3Ka_III+PI3Kc_like)XP_002947818.1(Pkinase+WD40+RRM_1+Poxvirus_B22R+Otopetrin) XP_002951746.1(Pkinase +IQ) XP_002959907.1(Pkinase+Pex24p) XP_002950395.1(Pkinase) XP_002951452.1(Pkinase)

Na, not present or not identifiable; numbers indicate GenBank DNA accession numbers.

3. ATG proteins involved in Ubiquitin-Like Protein Conjugation Systems (ATG3, ATG4, ATG5, ATG7, ATG8, ATG10, ATG12, and ATG16)

Two ubiquitin-like protein conjugation systems are involved in selective and nonselective autophagy, including ATG8-PE (phosphatidyl ethanolamine) and ATG5-ATG12. The first ubiquitin-like protein conjugation complex, composed of ATG3, ATG4, ATG7 and ATG8, is highly conserved in microalgae, except for ATG4 in M. pusilla and ATG7 in P. tricornutum (see Table 4 and Figure 1A). The phylogenetic tree of ATG8 coincides well with the phylogenies based on 16 s rRNA (Figure 2). As for the second complex, only the green algae Chlorella and Chlamydomonas contain the entire set of the core proteins. It appears that several algal species including V. carteri, P. tricornutum, Micromonas sp. and T. pseudonana lack genes involved in ATG5-12 conjugation. As expected, searches for ATG3 and ATG10 homologs resulted in identical protein sequences, since the region around cysteine234 of ATG3 shows partial homology to the corresponding region surrounding cysteine133 of ATG10. ATG16-like proteins can be identified in certain microalgae, all of which contain mammalian-style multiple WD40 repeats and other additional domains in the extended C-termini relative to their fungal counterparts.
Table 4

Distribution of ATG proteins and domains in microalgae and M. brevicollis: ATG proteins involved in Ubiquitin-Like Protein Conjugation Systems.

ATG3 (NP_014404.1) (Autophagy_N+Autophagy_act_C+Autophagy_Cterm)ATG4 (NP_014176.2) (Peptidase_C54)ATG5 (NP_015176.1) (APG5)ATG7 (NP_012041.1) (Apg7+E1_like_apg7)ATG8 (NP_009475.1) (GABARAP)/(XP_001699190.1) (GABARAP)ATG10 (NP_013058.1) (Autophagy_act_C)ATG12 (NP_009776.1) (APG12)ATG16 (NP_013882.1) (APG16)
Chlorella sp. NC64A (Chlorella variabilis)EFN54110.1 (Autophagy_N+Autophagy_act_C+Autophagy_Cterm) EFN54044.1(Autophagy_act_C)EFN56996.1 (Peptidase_C54) EFN56995.1 (Peptidase_C54)EFN59373.1 (APG5)EFN52000.1(E1_like_apg7+E1_enzyme_family)EFN52105.1 (GABARAP)EFN54044.1 (Autophagy_act_C)EFN51330.1 (APG12)Na
Chlamydomonas reinhardtii XP_001699795.1 (Autophagy_Cterm+Autophagy_act_C+Autophagy_N)XP_001691049.1 (Peptidase_C54)XP_001692662.1 (APG5)XP_001703365.1(E1_like_apg7+E1_enzyme_family)XP_001699190.1 (GABARAP)XP_001692913.1 (Autophagy_act_C)XP_001702830.1 (APG12)Na
Micromonas pusilla CCMP1545XP_003062013.1 (Autophagy_Cterm+Autophagy_act_C+Autophagy_N)NaXP_003064603.1 (APG5)XP_003060175.1(E1_like_apg7+E1_enzyme_family)XP_003063071.1 (GABARAP)NaXP_003058399.1 (APG12)Na
Micromonas sp. RCC299XP_002508119.1 (Autophagy_Cterm+Autophagy_act_C+Autophagy_N)XP_002504432.1 (Peptidase_C54)NaXP_002504186.1(E1_like_apg7+E1_enzyme_family)XP_002506884.1 (GABARAP)NaXP_002503341.1 (APG12)XP_002502794.1(ATG16+PGAM+WD40)
Monosiga brevicollis XP_001748852.1 (Autophagy_Cterm+Autophagy_N+Autophagy_act_C)XP_001745089.1 (Peptidase_C54) XP_001747503.1 (Peptidase_C54)XP_001747184.1 (APG5+WHEP-TRS+tRNA-synt_2b+HGTP_anticodon)NaXP_001748106.1 (GABARAP)NaNaXP_001749313.1(ATG16+WD40)
Ostreococcus lucimarinus XP_001418543.1 (Autophagy_Cterm+Autophagy_act_C+Autophagy_N)XP_001417407.1 (Peptidase_C54)XP_001422251.1 (APG5)XP_001418514.1 (Apg7+E1_like_apg7)XP_001415651.1 (GABARAP)NaXP_001418371.1 (APG12)XP_001420801.1(ATG16+WD40)
Ostreococcus tauri XP_003080019.1 (Autophagy_Cterm+Autophagy_act_C)XP_003078525.1 (Peptidase_C54)XP_003084193.1 (APG5)XP_003079963.1 (Apg7)XP_003074617.1 (GABARAP)NaXP_003079693.1 (APG12+GST_C)Na
Phaeodactylum tricornutum XP_002176659.1 (Autophagy_Cterm+Autophagy_act_C+Autophagy_N)XP_002185127.1 (Peptidase_C54)XP_002186339.1 (APG5)NaXP_002185239.1 (GABARAP)NaNaXP_002177918.1(ATG16+DUF745+WD40)
Thalassiosira pseudonana XP_002295882.1 (Autophagy_Cterm+Autophagy_act_C+Autophagy_N)XP_002294341.1 (Peptidase_C54)NaXP_002289307.1 (E1_like_apg7+E1_enzyme_family)XP_002287173.1 (GABARAP)NaXP_002291258.1 (APG12)XP_002289194.1(ATG16+WD40)
Volvox carteri XP_002952517.1 (Autophagy_Cterm+Autophagy_act_C+Autophagy_N)XP_002948308.1 (Peptidase_C54)NaXP_002951753.1 (E1_like_apg7+E1_enzyme_family)XP_002952089.1 (GABARAP)NaNaXP_002948303.1(ATG16+BicD+IncA+HAP1_N)

Na, not present or not identifiable; numbers indicate GenBank DNA accession numbers.

Figure 2

Phylogenetic tree of ATG8 proteins.

ATG8 from M. brevicollis is used as outgroups. The phylogenetic tree was constructed as described in Methods section (1000 bootstrap replicates). Protein accession numbers and the strain names are as in Table 1 and Table 4, respectively.

Phylogenetic tree of ATG8 proteins.

ATG8 from M. brevicollis is used as outgroups. The phylogenetic tree was constructed as described in Methods section (1000 bootstrap replicates). Protein accession numbers and the strain names are as in Table 1 and Table 4, respectively.

ATG proteins exclusively involved in non-selective or selective autophagy

As indicated in Table 5 and Figure 1C, ATG28 (in P. pastoris) or ATG29-ATG31 (in S. cerevisiae), which are exclusively involved in non-selective (starvation-induced) autophagy, are absent in microalgae. On the other hand, ATG17-like proteins are identified in certain species, including C. variabilis, Micromonas sp. and P. tricornutum. Most of the putative ATG17 proteins contain several additional domains, including Ubiquitin and DELLA (Figure 3). It is worth noting that a P. tricornutum protein (XP_002186517.1) contains both ATG11 and APG17 domains.
Table 5

Distribution of ATG proteins and domains in microalgae and M. brevicollis: ATG proteins exclusively involved in non-selective autophagy (including macroautophagy and microautophagy).

ATG17 (NP_013527.1) (APG17)ATG28 (XP_002491513.1) (Na)ATG29 (NP_015159.1) (Na)/(ABO31324.1)(Na)ATG31 (NP_010305.1) (ATG31)
Chlorella sp. NC64A (Chlorella variabilis)EFN58270.1(APG17+ubiquitin+DELLA)NaNaNa
Chlamydomonas reinhardtii NaNaNaNa
Micromonas pusilla CCMP1545XP_003062461.1(APG17+Nucleoplasmin+TMF_DNA_bd)NaNaNa
Micromonas sp. RCC299XP_002506097.1(APG17+ubiquitin)NaNaNa
Monosiga brevicollis NaNaNaNa
Ostreococcus lucimarinus NaNaNaNa
Ostreococcus tauri NaNaNaNa
Phaeodactylum tricornutum XP_002186517.1(APG17+ATG11)NaNaNa
Thalassiosira pseudonana NaNaNaNa
Volvox carteri NaNaNaNa

Na, not present or not identifiable; numbers indicate GenBank DNA accession numbers.

Figure 3

Domain organization of putative ATG17 proteins.

Species and sequences are as in Table 1 and Table 7. Fused domains that form a single polypeptide chain are connected by a horizontal line. Figures are not drawn to scale.

Domain organization of putative ATG17 proteins.

Species and sequences are as in Table 1 and Table 7. Fused domains that form a single polypeptide chain are connected by a horizontal line. Figures are not drawn to scale.
Table 7

Distribution of ATG proteins and domains in microalgae and M. brevicollis: ATG proteins exclusively involved in pexophagy.

ATG11 (NP_015374.1) (APG11+Cenp-F_leu_zip)ATG17 (NP_013527.1) (APG17)ATG25 (Q6JUT9) (ADIP)ATG26 (NP_013290.1) (PH+GRAM+Glyco_transf_28+UDPGT)ATG28 (AAW31632.1) (Na)/(ABO31323.1) (Na)/XP_002491513.1(Na)ATG30 (XP_002493096.1) (Na)/(BAL15150.1)PEX3 (Q01497.1) (Peroxin-3)/(NP_010616.1) (Peroxin-3)PEX14 (BAK41865.1) (PEX14-N)/NP_011362.1 (PEX14-N+PRK00409)
Chlorella sp. NC64A (Chlorella variabilis)NaEFN58270.1 (APG17+ubiquitin+DELLA)NaEFN55096.1(UDPGT+Glyco_transf_28) EFN58002.1(GRAM) EFN55594.1(UDPGT) EFN57081.1(Glyco_transf_28) EFN55592.1(UDPGT) EFN58760.1(UDPGT)NaNaEFN54221.1 (Peroxin-3)EFN56914.1 (Pex14_N)
Chlamydomonas reinhardtii NaNaNaXP_001691133.1 (Glyco_transf_28) XP_001701057.1(UDPGT) XP_001701484.1(GRAM)NaNaNaNa
Micromonas pusilla NaXP_003062461.1(APG17+Nucleopla smin+TMF_DNA_bd)NaXP_003059429.1(GRAM) XP_003063285.1(GRAM)NaNaNaXP_003063040.1 (Pex14_N)
Micromonas sp. RCC299NaXP_002506097.1 (APG17+ubiquitin)NaXP_00250 0840.1(GRAM)NaNaNaXP_002508753.1 (Pex14_N)
Monosiga brevicollis NaNaNaXP_001746818.1(GRAM) XP_001746751.1(UDPGT)NaNaNaNa
Ostreococcus lucimarinus NaNaNaXP_001421559.1(UDPGT) XP_001421559.1 (UDPGT+Glyco_transf_28) XP_001418405.1(GRAM)NaNaNaNa
Ostreococcus tauri NaNaNaXP_003079742.1(GRAM) XP_003083497.1(Glyco_tran_28_C)NaNaXP_003083403.1 (Peroxin-3)XP_003074580.1 (Pex14_N)
Phaeodactylum tricornutum XP_002186517.1(ATG11+APG17)XP_002186517.1 (APG17+ATG11)NaXP_002182817.1 (Glyco_transf_28+UDPGT) XP_002185859.1(GRAM)NaNaXP_002185591.1 (Peroxin-3)Na
Thalassiosira pseudonana XP_002289246.1(ATG11+ Histidinol_dh)NaNaXP_002294273.1(UDPGT) XP_002287301.1(GRAM)NaNaXP_002292876.1 (Peroxin-3)XP_002289783.1(Pex14_N+PUB)
Volvox carteri NaNaNaXP_002950839.1(GRAM) XP_002956588.1 (Glyco_transf_28)NaNaNaXP_002951550.1 (Pex14_N)

Na, not present or not identifiable; numbers indicate GenBank DNA accession numbers.

In microalgae, putative ATG proteins belonging to the receptor-adaptor complex in the Cvt pathway, pexophagy and mitophagy are absent (Figure 1C). Orthologs of the Cvt-specific receptor protein ATG19/ATG34 and their adaptor ScATG11 are also uncharacterized, aside from ATG 11 in P. tricornutum and T. pseudonana (see Table 6). Furthermore, ATG25, ATG28 and ATG30, which are specifically required for P. pastoris pexophagy, are not identified. Peroxisomal membrane proteins PEX3 and PEX14 are identified in C. variabilis, O. tauri and T. pseudonana (Table 7). In addition, the newly-discovered mitophagy receptor ATG32 in S. cerevisiae is absent in algal genomes. Other ATG proteins responsible for mitophagy, such as ATG33, also cannot be identified (data not shown).
Table 6

Distribution of ATG proteins and domains in microalgae and M. brevicollis: ATG proteins exclusively involved in CVT.

ATG11 (NP_015374.1) (APG11+Cenp-F_leu_zip)ATG19 (NP_014559.1) (ATG19)/(EHN00336.1) (ATG19)ATG34 (NP_014558.1) (ATG19)
Chlorella sp. NC64A (Chlorella variabilis)NaNaNa
Chlamydomonas reinhardtii NaNaNa
Micromonas pusilla CCMP1545NaNaNa
Micromonas sp. RCC299NaNaNa
Monosiga brevicollis NaNaNa
Ostreococcus lucimarinus NaNaNa
Ostreococcus tauri NaNaNa
Phaeodactylum tricornutum XP_002186517.1(ATG11+APG17)NaNa
Thalassiosira pseudonana XP_002289246.1(ATG11+Histidinol_dh)NaNa
Volvox carteri NaNaNa

Na, not present or not identifiable; numbers indicate GenBank DNA accession numbers.

Identification of non-yeast ATG proteins in microalgae and choanoflagellate

As previously mentioned, we scanned microalgae genomes to identify Sc ATG or Pp ATG homologs. However, several proteins are specifically important for autophagy in mammals, including UVRAG (for activating VPS34), DRAM (Damage-Regulated Autophagy Modulator, like TOR), FIP200 and ATG101 (mediating mTOR signaling) [23]–[27]. Therefore, we also tried to identify their orthologs in microalgae and choanoflagellate genomes (Table 9, Figure 1B). Orthologs of UVRAG are found in all microalgae genomes. On the other hand, DRAM-like proteins are absent from green algae Chlorella and Chlamydomonas. In addition, Both FIP200 and ATG101 are present in T. Pseudonana even though such is not always the case in Caenorhabditis elegans and Drosophila melanogaster (data not shown). Interestingly, some mammalian ATG proteins and yeast ATG proteins contain similar domains. For instance, the ATG14 domain was discovered in UVRAG and ScATG14, while the ATG11 domain was detected in FIP200 and ScATG11.

Structure and conserved residues of putative ATGs

Overall, there are few additional domains present within most of the ATG-like proteins identified in algae. In comparison, in ATG1, ATG17 and DRAM, multiple additional domains were identified (Table 2 and Figure 3). Several crucial residues, conserved in the catalytic and binding sites of ATG proteins in yeast, plants and animals, were also detected in microalgae. For instance, the Cys507 residue of ATG7 (which activates ATG8 and ATG12) is conserved in microalgae (Figure 4). The Cys234 residue in ATG3 (which activates ATG8) and Cys133 of ATG10 (which activates ATG12) are conserved except for EFN54110 in C. variabilis. The residues responsible for the formation of the conjugation bond between ATG5 (Lys149) and ATG12 (Gly186) are conserved in all of the algal proteins. The C-terminal cleavage site of ATG8 in baker's yeast, Arg117, could not be identified in most microalgae, but the exposed Gly116 residues are conserved (Figure 4).
Figure 4

Partial sequence alignment of ATG proteins maintaining conserved catalytic and binding sites.

The abbreviations of species are given in Table 1 and the sequence accession numbers are given in Table 4. The asterisks indicate similar residues. Residues in the catalytic and binding sites are in red boxes and the numbers indicate the positions in S.cerevisiae (Sc) ATG proteins.

Partial sequence alignment of ATG proteins maintaining conserved catalytic and binding sites.

The abbreviations of species are given in Table 1 and the sequence accession numbers are given in Table 4. The asterisks indicate similar residues. Residues in the catalytic and binding sites are in red boxes and the numbers indicate the positions in S.cerevisiae (Sc) ATG proteins.

mRNA expression analysis of selected autophagic genes in Chlamydomonas and Chlorella

As described above, the green algae Chlorella and Chlamydomonas contain relatively complete sets of “core autophagy machinery” within their genomes. Therefore, we chose putative ATGs in Chlorella and Chlamydomonas to confirm if the sequences gained from in-silico research are actually expressed. Total RNA samples were collected during autophagy as described in the material and methods section and RT-PCR analysis of ATG genes was performed. To minimize our work while obtaining more information, we tested ATG1 in the ATG9 cycling system, ATG6 in the PI3K complex, and ATG3, ATG7, ATG10 and ATG12 in the ubiquitin-like protein conjugation systems Ι and Π. The results showed that all the genes tested are expressed during autophagy in Chlorella and Chlamydomonas (see Figure 5A).
Figure 5

Expression and functional verification of autophagy genes in Chlamydomonas and Chlorella.

A: RT-PCR analysis of selected proteins in Chlamydomonas and Chlorella to confirm the sequences obtained from in silico research. Total RNA samples were collected during autophagy as described in material and methods section. Data are representative of three independent experiments. B: 3-MA (PI3K pathway inhibitor) blocks the formation of autophagic vacuole in Chlorella. Left: Autotrophically grown Chlorella cell resuspended in the heterotrophic medium and sampled after 6 h. Autophagic vacuoles disperse throughout the cytoplasm. Right: Autotrophically grown Chlorella cell resuspended in the heterotrophic medium for 6 h with 3-MA. There are no obvious autophagic vacuoles. The bar represents 500 nm. White arrowhead: lipid body; black arrowhead: autophagic vacuole. Data represent three independent experiments (A total of 208 control cells/201 test cells were analyzed).

Expression and functional verification of autophagy genes in Chlamydomonas and Chlorella.

A: RT-PCR analysis of selected proteins in Chlamydomonas and Chlorella to confirm the sequences obtained from in silico research. Total RNA samples were collected during autophagy as described in material and methods section. Data are representative of three independent experiments. B: 3-MA (PI3K pathway inhibitor) blocks the formation of autophagic vacuole in Chlorella. Left: Autotrophically grown Chlorella cell resuspended in the heterotrophic medium and sampled after 6 h. Autophagic vacuoles disperse throughout the cytoplasm. Right: Autotrophically grown Chlorella cell resuspended in the heterotrophic medium for 6 h with 3-MA. There are no obvious autophagic vacuoles. The bar represents 500 nm. White arrowhead: lipid body; black arrowhead: autophagic vacuole. Data represent three independent experiments (A total of 208 control cells/201 test cells were analyzed). In addition, the expression levels of tested genes during early and late stages of autophagy were also determined (Figure S1). As mentioned in introduction, autophagy can be divided into two stages. Expression levels of tested genes in Chlorella cells which were autotrophically-heterotrophically cultured for 2 h/4 h (early stage, before the fusion of autophagosome and vacuole at 6–7 h) and 8 h/10 h (late stage, after the fusion of autophagosome and vacuole at 6–7 h) were tested. The results indicated that the transcription of ATG genes remains constant during autophagy.

Inhibition of PI3K blocks the formation of autophagic vacuole in Chlorella

As mentioned in the introduction, the molecular evidence for autophagic pathways in C. reinhardtii has already been reported [29], [38]. Therefore, to extend the results from in-silico and mRNA analysis, we tested the presence and function of the PI3K pathway in Chlorella. 3-MA (3-Methyladenine) is a specific inhibitor of PI3K, which can suppress the formation of autophagosomes or autophagic vacuoles (AV). The autophagic vacuoles are defined as membrane-bound vacuoles that contain fragments of cellular components destined for destruction, including mitochondria, endoplasmic reticulum or chloroplasts. The presence of electron- microscopically visible AV is regarded as evidence for autophagy in both plants and C. reinhardtii. We examined 208 control and 201 test cells by electron microscopy (EM) which were switched from autotrophic to heterotrophic growth for 6 h to induce autophagy in three independent experiments. Shown in Fig. 5B is one of the typical cell, in which several autophagic vacuoles disperse throughout the cytoplasm. Among the cells we examined, 168 control cells (81%) and 157 test cells (78%) present similar structure as in Figure 5B. Significantly, when the cells were treated with 3-MA at the same time, no autophagic vacuoles were observed (see Figure 5B), suggesting the formation of these vacuoles depends on autophagy.

Discussion

In the past five years, due to increased energy consumption and the impact of carbon dioxide emissions on the environment, renewable bioenergy has grown into a research hotspot. A lot of studies have focused on microalgae, which can be used for the production of biodiesel [2]. Recently, we found that an autophagy-like mechanism plays a critical role in the photosynthesis-fermentation conversion and the production of lipids in Chlorella (Jiang Q. et. al., paper in preparation), which leads us to perform a complete survey of autophagy machineries in microalgae. So far, several surveys on autophagy genes have been reported in yeast [20], [21]. Furthermore, based on the ATGs identified in yeast, in silico identifications of ATG genes in filamentous fungi, trypanosomatids, and ascidian Ciona intestinalis genomes were performed, which have greatly accelerated our understanding of autophagic pathways in animals and fungi, despite that the function of most ATG genes remains unclear in these studies [22], [39]–[42]. Likewise, the identification of ATG genes in microalgae genomes, especially in those oleic species will be important to understand the molecular mechanism of oil accumulation. Furthermore previous in silico studies of autophagy genes were performed according to the sequential steps of autophagy in yeast and could not differentiate between the core genes conserved from yeast to human and the yeast-specific genes. In this study, the identification of the “core molecular machinery” in microalgae would eliminate the interference of yeast-specific proteins and yield a more precise view of the hereditary conservation and modification of autophagic pathways. In most cases, comparative genome analyses of autophagy proteins favor the use of ATG genes from S. cerevisiae as queries [22], [39]–[42]. However, studies have confirmed that some putative ATG proteins can be identified exclusively using sequences from an organism evolutionarily distinct from yeast [41]. Therefore, in this study, besides S. cerevisiae, we also chose ATG proteins from P. pastoris, filamentous fungus Penicillium chrysogenum and even human as queries. The occurrence of orthologs of mammalian-specific/derived ATG proteins in microalgae (DRAM, ATG101 and UVRAG) and the discovery of common domains in mammalian ATG and yeast ATG (Table 9, Figure 1B) suggests that the pathways and proteins of autophagy are more conserved than previously expected.

Conservation and the loss of autophagy subtypes in microalgae

The molecular machinery in microalgae is conserved but more complicated than expected (Table 2 to Table 9 and Figure 1A). The green alga Chlorella contains the entire set of the core autophagic machinery. In C. reinhardtii, however, we could not identify putative orthologs of most ATG genes involved in the ATG9-cycling system (Table 2). In addition, other species seem to lack the second ubiquitin-like protein conjugation complex (Table 4). In P. pastoris, the peroxisome receptor ATG30 interacts with peroxisomes via PEX3 and PEX14, and with autophagy machinery via ATG11 and ATG17 [43]. Thus, the protein (Accession number: XP_002186517) maintaining ATG11 and APG17 domains and the identification of PEX3 and PEX14 imply the presence of the pexophagy mechanism and the modification of receptor proteins in microalgae (Figure 3). Aside from pexophagy, proteins involved in several subtypes of autophagy were not present (Tables 5, 6, 7 and Figure 1C). For example, the Cvt-specific receptor protein ScATG19/ScATG34 and the mitophagy receptor ScATG32 seem absent in microalgae, which may imply the loss of Cvt and mitophagy pathways or major modifications of the receptors (Table 6 and Figure 1C). Actually, experimental evidence has demonstrated that Cvt is a fungi-specific pathway and some of the proteins involved are lineage-specific duplications in yeast and filamentous fungi [44], [45]. Moreover, the absence of proteins in non-selective autophagy (including macroautophagy and microautophagy) may demonstrate that these proteins are indeed lineage-specific (Table 5 and Figure 1C).

Expression and functional verification of ATG genes

RT-PCR analysis of putative ATGs in Chlamydomonas and Chlorella have confirmed that the putative genes identified are actually expressed (Figure 5A). In addition, since sequence similarity and conservation of function are not inevitably connected, experimental studies are required to assure the results obtained from in silico and mRNA analysis. The finding that 3-MA is able to inhibit the formation of autophagy vacuole strongly support the presence of autophagy in Chlorella (Figure 5B). Besides, the induction of autophagy and the functions of several autophagy related genes in Chlamydomonas have been experimentally studied recently. For example, CrATG8 (ATG8 protein from Chlamydomonas) was proved to be functionally conserved [29]. Like yeast ATG8, CrATG8 is cleaved at the conserved glycine (carboxyl-terminal) and associated with membranes during autophagy induced by different stresses, including nutrient limitation, oxidative stress, and the accumulation of misfolded proteins in the endoplasmic reticulum [29].

Chlorella: a potential model organism to study autophagy

Studies on autophagy in microalgae have only been carried out recently and are mainly using C. reinhardtii [38], [46]. Our study suggested that Chlorella may represent another potential model system to investigate autophagic pathways in photosynthetic eukaryotes. Firstly, Chlorella contains the entire set of the core autophagy machinery (Table 2 to Table 9). RT-PCR analysis verified that all the genes tested are expressed during autophagy (Figure 5A). Moreover, a specific inhibitor of PI3K blocks autophagy in Chlorella cells, which indicates the presence of a functional PI3K complex (Figure 5B). Secondly, the autophagic pathways in Chlorella seem closer to those in multicellular eukaryotes than those in S. cerevisiae. For example, the selective Cvt pathway widely observed in yeast seems to be absent in both Chlorella and higher eukaryotes; and the cleavage mechanism of ATG8 in Chlorella better resembles that of higher eukaryotes than yeast's (Figure 4). Thirdly, studying ATG genes in Chlorella is much easier than in higher plants because the genomes of higher plants have undergone large-scale duplications, combined with plenty of gene gain-and-loss events [47]. Multiple ATG paralogs have thus been identified in higher plants. For instance, A. thaliana maintains nine AtATG8 paralogs [48], [49], while Chlorella has far fewer putative paralogs (Table 4). Finally, the unique molecular modifications in certain subtypes of autophagy will provide an opportunity to investigate the microalgae-specific autophagy subpathways. In conclusion, our study not only presents an overall view of the putative autophagy proteins in the “core autophagy machinery” and several subpathways in microalgae, but also verifies the expression profiles and function of representative autophagic pathways by RT-PCR analysis and inhibitor treatment. Unexpected observations suggest that the “autophagy core machinery” in Chlorella seems to be more conserved than that in other algal species. Thus, we provide novel evidence for the conservation of the core machinery and the modifications or supplementations for adaptation to unique environmental niches in different microalgal species. Genome-wide in silico analysis of ATG proteins in microalgae will promote understanding of the general features of autophagic pathways and benefit the production of algal-derived bioenergy with future commercial applications. Finally, our data suggest that Chlorella may represent another potential model organism to investigate autophagy pathways in photosynthetic eukaryotes.

Materials and Methods

In silico analysis

Seven species of microalgae, including two green algae (Chlorella NC64A/Chlorella variabilis, and Volvox carteri), two ancient green algae (Micromonas pusilla CCMP 1545 and Micromonas sp. RCC299) and diatom Phaeodactylum tricornutum CCAP1055/1 were analyzed in this study (Table 1). In addition, the marine choanoflagellate Monosiga brevicollis, the closest unicellular relative of animals, was also included. The sequences of the published ATG proteins were used as queries in local Gapped-Blast analyses to identify putative orthologs of proteins involved in autophagy in microalgae. In most cases, ATG sequences of S. cerevisiae, P. pastoris, Penicillium chrysogenum and Homo sapiens were used as starting queries. ATG genes not present in yeast but crucial for autophagy in mammals were also detected. The E-value was set to 0.001, and the screening of reciprocal Gapped-Blast was conducted according to the standard protocols [50]. Proteins that maintain the crucial autophagy-related domains were identified and added to the query sets for another round of BLASTp searches. The procedure was continued until no new proteins were found. If no ortholog of Sc ATG was identified in a specific microalga, further analyses were performed using ATGs derived from plants and mammals as queries. The putative ATG proteins with conserved catalytic and binding residues were aligned in Clustal X [51]. Structure analyses of putative ATGs were performed using SMART, CDD and PFAM [52], [53]. Similar strategies have been employed to study apoptosis (Type I PCD) proteins of cyanobacteria in our lab [54]. A tree based on ATG8 was constructed using NJ methods [55], with the reliability testing of each branch by 1000 bootstrap replications. ATG8 orthologs in Homo sapiens, Arabidopsis thaliana and M. brevicollis were used as outgroups to root the tree.

mRNA isolation and RT-PCR

Chlamydomonas reinhardtii wild-type strain was kindly gifted from Dr. Junmin Pan (Tsinghua University). The induction of autophagy by rapamycin in Chlamydomonas reinhardtii was described by José et al. [29]. In brief, cells were cultured and synchronized by alternating light and dark (12 h/12 h) cycles. Cells were treated with 500 nM rapamycin for 24 h. The Chlorella cells were grown autotrophically for five days before changing to the heterotrophic medium and sampled after 2, 4, 8 and 10 hours as described previously [56]. Total RNAs were isolated using RNeasy Plant Mini kit according to the instructions (QIAGEN). RT-PCR was performed on equal input mRNA and cDNA amounts and monitored by actin control primers. The PCR products were run on 2.5% agarose gels. Sets of forward (F) and reverse (R) primers for each selected gene and the expected sizes of PCR fragments are listed in Table 10.
Table 10

Sets of forward and reverse primers designed to amplify ATG genes.

GeneForward primer (F)Reverse primer (R)PCR fragment size (bp)
ATG3 CGAGGCAGATGATGAGGCT GGACGCGATGAACTTGAGAA 388
ATG1 AAACTCTGGGTCAACAAAGGG TTGCTATGGCATCAGGGAAG 427
ATG6 GGAGGAGTCCTTTGTGATGCT GCTTGATGGTGGCGTTGTT 932
ATG7 GTCGTCGGCTACTTCAGTCCCA GCCACATGCTGCCTCATTCC 470
ATG10 ACAATGGACCGCAACATCTGA ATGACGGGCACCTGGTAGG 468
ATG12 CAATGCGAAGCCGAGGAG CTGCGATATTCAAACCAGACCA 401

Electron microscopy

Autotrophically grown Chlorella cells were resuspended in the heterotrophic medium and sampled after 6 h either with or without 5 mM 3-MA [56]. Samples ware pretreated using standard protocol, including dehydration, mixation, embedding and sectioning [56]. Cells were photographed using a JEM-1230 transmission electron microscope (Hitachi, Japan). Expression levels of autophagy genes during autophagy in . Total RNA was collected in Chlorella cells which were autotrophically-heterotrophically cultured for 2 h/4 h (early stage, before the fusion of autophagosome and vacuole at 6–7 h) and 8 h/10 h (late stage, after the fusion of autophagosome and vacuole at 6–7 h). Actin was used as loading control. Data are representative of three independent experiments. (TIF) Click here for additional data file.
Table 8

Distribution of ATG proteins and domains in microalgae and M. brevicollis: Other ATG proteins pexophagy.

ATG15 (NP_009994.2)ATG17 (NP_013527.1)ATG20 (NP_010170.1)ATG22 (NP_009892.1)ATG27 (NP_012357.2)
(Lipase_3 )(APG17)(PX+Vps5)(APG22+MFS)(ATG27)
Chlorella sp. NC64A (Chlorella variabilis)EFN56954.1 (Lipase_3)EFN58270.1 (APG17+ubiquitin+DELLA)EFN54738.1 (PX+Vps5)NaNa
Chlamydomonas reinhardtii XP_001696400.1 (Lipase_3) ADF43176.1 (Lipase_3) ADF43143.1 (Lipase_3)NaXP_001695319.1(PX+Vps5) XP_001690659.1(PX+Vps5)NaNa
Micromonas pusilla CCMP1545XP_003059563.1(Lipase_3+Acyl_transf_1)XP_003062461.1 (APG17+Nucleoplasmin+TMF_DNA_bd)XP_003055859.1(PX+Vps5) XP_003060307.1(PX+Vps5)XP_003064473.1 (ATG22) XP_003058402.1 (ATG22)Na
Micromonas sp. RCC299XP_002509028.1(Lipase_3)XP_002506097.1 (APG17+ubiquitin)XP_002505309.1(PX+Vps5) XP_002504443.1(PX+Vps5) XP_002500454.1(PX+Vps5)XP_002503338.1 (ATG22+MFS) XP_002500650.1 (ATG22+X17NfeD)Na
Monosiga brevicollis XP_001748884.1(Lipase_3)NaXP_001745313.1(PX+Vps5) XP_001750730.1(PX+Vps5)NaXP_001748990.1(ATG27) XP_001748431.1(ATG27+Frag1+WSC+Somatomedin_B+Kelch_1) XP_001748596.1(ATG27)
Ostreococcus lucimarinus XP_001417482.1(Lipase_3)NaXP_001416534.1(PX+Vps5) XP_001421495.1(PX+Vps5) XP_001417891.1(PX+Vps5) XP_001420137.1(PX+Vps5)NaNa
Ostreococcus tauri XP_003082612.1(Lipase_3+Tubulin)NaXP_003077939.1(PX+Vps5) XP_003083347.1(PX+Vps5) XP_003081616.1(PX+Vps5) XP_003079106.1(PX+Vps5)NaNa
Phaeodactylum tricornutum XP_002186305.1(Lipase_3)XP_002186517.1(APG17+ATG11)XP_002179688.1(PX+Vps5)XP_002181202.1 (ATG22+MFS) XP_002177650.1(ATG22+MFS) XP_002181320.1(ATG22+MFS)Na
Thalassiosira pseudonana XP_002295280.1(Lipase_3) XP_002287497.1(Lipase_3)NaXP_002291461.1(PX+Vps5)XP_002291311.1(PX+Vps5)XP_002293574.1(ATG22) XP_002291816.1(ATG22+DUF1440)Na
Volvox carteri XP_002945633.1(Lipase_3)NaXP_002955830.1(PX+Vps5) XP_002958583.1(PX+Vps5)NaNa

Na, not present or not identifiable; numbers indicate GenBank DNA accession numbers.

  56 in total

1.  13C-tracer and gas chromatography-mass spectrometry analyses reveal metabolic flux distribution in the oleaginous microalga Chlorella protothecoides.

Authors:  Wei Xiong; Lixia Liu; Chao Wu; Chen Yang; Qingyu Wu
Journal:  Plant Physiol       Date:  2010-08-18       Impact factor: 8.340

Review 2.  Plant autophagy--more than a starvation response.

Authors:  Diane C Bassham
Journal:  Curr Opin Plant Biol       Date:  2007-08-16       Impact factor: 7.834

3.  Inhibition of target of rapamycin signaling by rapamycin in the unicellular green alga Chlamydomonas reinhardtii.

Authors:  José L Crespo; Sandra Díaz-Troya; Francisco J Florencio
Journal:  Plant Physiol       Date:  2005-11-18       Impact factor: 8.340

4.  Autophagy induced by rapamycin and carbon-starvation have distinct proteome profiles in Aspergillus nidulans.

Authors:  Yonghyun Kim; Nazrul Islam; Bill J Moss; M P Nandakumar; Mark R Marten
Journal:  Biotechnol Bioeng       Date:  2011-06-09       Impact factor: 4.530

Review 5.  Molecular machinery required for autophagy and the cytoplasm to vacuole targeting (Cvt) pathway in S. cerevisiae.

Authors:  Waheeda A Khalfan; Daniel J Klionsky
Journal:  Curr Opin Cell Biol       Date:  2002-08       Impact factor: 8.382

6.  Processing of ATG8s, ubiquitin-like proteins, and their deconjugation by ATG4s are essential for plant autophagy.

Authors:  Kohki Yoshimoto; Hideki Hanaoka; Shusei Sato; Tomohiko Kato; Satoshi Tabata; Takeshi Noda; Yoshinori Ohsumi
Journal:  Plant Cell       Date:  2004-10-19       Impact factor: 11.277

Review 7.  Chlamydomonas reinhardtii as a unicellular model for circadian rhythm analysis.

Authors:  Ralf Werner
Journal:  Chronobiol Int       Date:  2002-03       Impact factor: 2.877

8.  Salt stress-induced cell death in the unicellular green alga Micrasterias denticulata.

Authors:  Matthias Josef Affenzeller; Anza Darehshouri; Ancuela Andosch; Cornelius Lütz; Ursula Lütz-Meindl
Journal:  J Exp Bot       Date:  2009-02-12       Impact factor: 6.992

9.  PCD and autophagy in the unicellular green alga Micrasterias denticulata.

Authors:  Matthias Josef Affenzeller; Anza Darehshouri; Ancuela Andosch; Cornelius Lütz; Ursula Lütz-Meindl
Journal:  Autophagy       Date:  2009-08-20       Impact factor: 16.016

10.  Identification of autophagy genes in Ciona intestinalis: a new experimental model to study autophagy mechanism.

Authors:  Nelly Godefroy; Céline Hoa; Foivos Tsokanos; Emilie Le Goff; Emmanuel J P Douzery; Stephen Baghdiguian; Camille Martinand-Mari
Journal:  Autophagy       Date:  2009-08-13       Impact factor: 16.016

View more
  12 in total

Review 1.  Agrigenomics for microalgal biofuel production: an overview of various bioinformatics resources and recent studies to link OMICS to bioenergy and bioeconomy.

Authors:  Namrata Misra; Prasanna Kumar Panda; Bikram Kumar Parida
Journal:  OMICS       Date:  2013-09-17

2.  Elucidating the composition and conservation of the autophagy pathway in photosynthetic eukaryotes.

Authors:  Adva Shemi; Shifra Ben-Dor; Assaf Vardi
Journal:  Autophagy       Date:  2015-04-03       Impact factor: 16.016

3.  The Microalga Nannochloropsis during Transition from Quiescence to Autotrophy in Response to Nitrogen Availability.

Authors:  Agnieszka Zienkiewicz; Krzysztof Zienkiewicz; Eric Poliner; Jane A Pulman; Zhi-Yan Du; Giovanni Stefano; Chia-Hong Tsai; Patrick Horn; Ivo Feussner; Eva M Farre; Kevin L Childs; Federica Brandizzi; Christoph Benning
Journal:  Plant Physiol       Date:  2019-11-18       Impact factor: 8.340

4.  Activation of Autophagy by Metals in Chlamydomonas reinhardtii.

Authors:  Marta Pérez-Martín; Crysten E Blaby-Haas; María Esther Pérez-Pérez; Ascensión Andrés-Garrido; Ian K Blaby; Sabeeha S Merchant; José L Crespo
Journal:  Eukaryot Cell       Date:  2015-07-10

5.  Evolutionary history of phosphatidylinositol- 3-kinases: ancestral origin in eukaryotes and complex duplication patterns.

Authors:  Héloïse Philippon; Céline Brochier-Armanet; Guy Perrière
Journal:  BMC Evol Biol       Date:  2015-10-19       Impact factor: 3.260

6.  A comparative in-silico analysis of autophagy proteins in ciliates.

Authors:  Erhan Aslan; Nurçin Küçükoğlu; Muhittin Arslanyolu
Journal:  PeerJ       Date:  2017-01-17       Impact factor: 2.984

7.  Impairment of starch biosynthesis results in elevated oxidative stress and autophagy activity in Chlamydomonas reinhardtii.

Authors:  Quynh-Giao Tran; Kichul Cho; Su-Bin Park; Urim Kim; Yong Jae Lee; Hee-Sik Kim
Journal:  Sci Rep       Date:  2019-07-08       Impact factor: 4.379

8.  Hijacking of an autophagy-like process is critical for the life cycle of a DNA virus infecting oceanic algal blooms.

Authors:  Daniella Schatz; Adva Shemi; Shilo Rosenwasser; Helena Sabanay; Sharon G Wolf; Shifra Ben-Dor; Assaf Vardi
Journal:  New Phytol       Date:  2014-09-07       Impact factor: 10.151

9.  Autophagy-like processes are involved in lipid droplet degradation in Auxenochlorella protothecoides during the heterotrophy-autotrophy transition.

Authors:  Li Zhao; Junbiao Dai; Qingyu Wu
Journal:  Front Plant Sci       Date:  2014-08-14       Impact factor: 5.753

10.  Genomic Characterization and Expressional Profiles of Autophagy-Related Genes (ATGs) in Oilseed Crop Castor Bean (Ricinus communis L.).

Authors:  Bing Han; Hui Xu; Yingting Feng; Wei Xu; Qinghua Cui; Aizhong Liu
Journal:  Int J Mol Sci       Date:  2020-01-15       Impact factor: 5.923

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.