Literature DB >> 22701680

Gene expression changes in the septum: possible implications for microRNAs in sculpting the maternal brain.

Changjiu Zhao1, Michael C Saul, Terri Driessen, Stephen C Gammie.   

Abstract

The transition from the non-maternal to the maternal state is characterized by a variety of CNS alterations that support the care of offspring. The septum (including lateral and medial portions) is a brain region previously linked to various emotional and motivational processes, including maternal care. In this study, we used microarrays (PLIER algorithm) to examine gene expression changes in the septum of postpartum mice and employed gene set enrichment analysis (GSEA) to identify possible regulators of altered gene expression. Genes of interest identified as differentially regulated with microarray analysis were validated with quantitative real-time PCR. We found that fatty acid binding protein 7 (Fabp7) and galanin (Gal) were downregulated, whereas insulin-like growth factor binding protein 3 (Igfbp3) was upregulated in postpartum mice compared to virgin females. These genes were previously found to be differentially regulated in other brain regions during lactation. We also identified altered expression of novel genes not previously linked to maternal behavior, but that could play a role in postpartum processes, including glutamate-ammonia ligase (Glul) and somatostatin receptor 1 (Sstr1) (both upregulated in postpartum). Genes implicated in metabolism, cell differentiation, or proliferation also exhibited altered expression. Unexpectedly, enrichment analysis revealed a high number of microRNAs, transcription factors, or conserved binding sites (177 with corrected P-value <0.05) that were significantly linked to maternal upregulated genes, while none were linked to downregulated genes. MicroRNAs have been linked to placenta and mammary gland development, but this is the first indication they may also play a key role in sculpting the maternal brain. Together, this study provides new insights into genes (along with possible mechanisms for their regulation) that are involved in septum-mediated adaptations during the postpartum period.

Entities:  

Mesh:

Substances:

Year:  2012        PMID: 22701680      PMCID: PMC3368935          DOI: 10.1371/journal.pone.0038602

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

A variety of behavioral, metabolic, structural, and neuroendocrine alterations occur during the transition from a virgin to a lactating state [1]–[4]. These physiological adaptations during lactation are believed to be critically important for the survival and development of the offspring. For example, in rodents, within hours of parturition, the mother retrieves the scattered pups, gathers them together in the nest, and adopts a nursing posture over the pups to permit suckling [5]. Adaptive changes in several neuroendocrine systems during lactation are also evident. For example, the release of both adrenocorticotropic hormone and corticosterone in response to various stressors is markedly suppressed [6], [7]. A striking change in metabolic aspect during lactation is the negative energy balance resulting from the increased energy demand and decreased adaptive thermogenesis [8]. This energy-saving mechanism facilitates the availability of energy for milk production. The mammalian septum is a heterogeneous forebrain structure that is divided into two main subdivisions, the medial septum (MS) and the lateral septum (LS), and has been linked to various aspects of maternal care, including offspring protection and pup retrieval [9]–[12]. Neuroanatomically, MS is densely interconnected with the hippocampus while LS has extensive reciprocal connections with numerous brain regions known to regulate affect and motivation, such as hypothalamus, amygdala, bed nucleus of the stria terminalis, periaqueductal gray, ventral tegmental area, and raphe nuclei [13]–[15]. Neurochemically, a high number of neurons in LS contain GABA and in subregions of LS, neurons also express other neurotransmitters, such as neurotensin, enkephalin, galanin, and somatostatin [13], [14]. Neurons within MS are predominantly GABAergic and/or cholinergic [16]. LS has long been considered to play a critical role in regulating multiple affective, behavioral and cognitive processes, such as fear, anxiety, depression, aggression, maternal behavior, and social recognition [11], [15], [17]–[19]. MS functions mainly as a region that modulates processes related to attention and memory [20], [21]. Alterations in neuronal activity and gene expression in several brain regions during the postpartum period have been reported. For example, during lactation, neuronal activity of neuropeptide Y (NPY) and agouti-related protein are increased in the arcuate nucleus of hypothalamus (Arc), a site known to be a core feeding center, whereas proopiomelanocortin is reduced [22], [23]. These changes in neuropeptide activity have been proposed to be important in integrating Arc-mediated food intake and energy balance. Expression changes of some genes in forebrain structures during lactation have been demonstrated to be involved in the control of maternal/parental and/or reproductive behaviors [24]–[26]. However, possible alterations in gene expression in the septum that may contribute to the septum-mediated adaptations during lactation remain largely unexplored. In this study, we employed microarray analysis to identify genes in the septum with altered expression during the postpartum period. As part of this study, we were also interested in how identified gene expression differences may have occurred. Producing the maternal brain is a complex process and is associated with various contributing factors including hormonal changes and sensory input from different events, such as the mating, parturition, nursing, and additional interactions with offspring [27]–[29]. There are likely large numbers of transcription factors that contribute to the gene expression changes but which have not to date been evaluated. Newer data mining tools, such as gene set enrichment analysis (GSEA), provide a unique approach to gain insight into how altered gene expression occurs [30]. The databases include for each gene information on all known binding sites in that region, including those for a wide range of transcription factors and microRNAs (miRNAs), that may be involved in gene expression. MiRNAs are of interest because they have been implicated in peripheral alterations, such as placenta and mammary gland development [31], [32] in the maternal female, but to date no roles for miRNAs have been examined for the maternal brain. In this study, we used GSEA to gain insights into how large scale changes may have been occurring during pregnancy and early lactation with a subset of transcriptional regulators.

Results

Genes Identified as being Differentially Expressed in the Septum of Lactating Versus Virgin Mice

Using PLIER analysis with a P<0.0025 cutoff value, we identified 116 genes that displayed significant changes in expression (Table 1). Two genes of interest, Gal (P = 0.018, fold change is 0.83) and Sstrl (P = 0.004, fold change is 1.22) were not included in Table 1 because their P values were more than 0.0025. The full list of all 35,557 targets, their relative expression and P value ranking using PLIER algorithm is presented in Table S1. The genes identified as being differentially expressed in lactating versus virgin mice were distributed across a number of categories (Table 1). The function/category of each gene was sorted out individually based on the biological process using PubMed and GenBank databases.
Table 1

List of genes showing highest significant differences in gene expression between lactating and virgin mice when analyzed with the probe logarithmic intensity error statistics (PLIER) (P<0.0025).

Accession#GeneGene titleFold change
Apoptosis, anti-apoptosis
NM_019735ApipAPAF1 interacting protein1.11
NM_026121Bag4BCL2-associated athanogene 41.17
NM_001033136Fam82a2family with sequence similarity 82, member A21.07
NM_010477Hspd1heat shock protein 11.10
NM_026160Map1lc3bmicrotubule-associated protein 1 light chain 3 beta1.07
Biosynthesis
NM_013490Chkacholine kinase alpha1.14
NM_010027DdtD-dopachrome tautomerase1.16
NM_001033300Gmpsguanine monophosphate synthetase1.05
NM_134017Mat2bmethionine adenosyltransferase II, beta1.08
Cell cycle, adhesion, division, death, differentiation and proliferation
NM_007591Calrcalreticulin1.10
NM_017367Ccnicyclin I1.07
NM_009865Cdh10cadherin 101.09
NM_009969Csf2colony stimulating factor 2 (granulocyte-macrophage)0.87
NM_019561Ensaendosulfine alpha1.07
NM_023794Etv5ets variant gene 51.19
NM_021272Fabp7* fatty acid binding protein 70.69
NM_146001Hip1huntingtin interacting protein 11.09
NM_008343Igfbp3* insulin-like growth factor binding protein 31.30
NM_008564Mcm2minichromosome maintenance deficient 2 mitotin (S. cerevisiae)0.91
NM_022889Pes1pescadillo homolog 11.11
NM_033573Prccpapillary renal cell carcinoma (translocation-associated)1.06
NM_009009Rad21RAD21 homolog (S. pombe)1.08
NM_009082Rpl29ribosomal protein L290.95
NM_018754Sfnstratifin0.89
NM_028232Sgol1shugoshin-like 1 (S. pombe)0.88
NM_016737Stip1stress-induced phosphoprotein 11.11
NM_177033Vwc2von Willebrand factor C domain containing 21.08
Development
NM_016845Acrbpproacrosin binding protein1.10
NM_023598Arid5bAT rich interactive domain 5B (MRF1-like)1.14
NM_008010Fgfr3fibroblast growth factor receptor 31.15
NM_008494LfngLFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase1.13
NM_023248SbdsShwachman-Bodian-Diamond syndrome homolog (human)1.08
Metabolism
NM_025590Acot11acyl-CoA thioesterase 111.13
NM_053115Acox2acyl-Coenzyme A oxidase 2, branched chain0.87
NM_021299Ak3adenylate kinase 31.11
NM_025275Amz2archaelysin family metallopeptidase 21.10
NM_001038699Fn3kfructosamine 3 kinase1.09
NM_008131Glul* glutamate-ammonia ligase (glutamine synthetase)1.06
NM_028894Lonrf3LON peptidase N-terminal domain and ring finger 31.24
NR_028353Nt5c25′-nucleotidase, cytosolic II1.07
NM_028794Nudt9nudix (nucleoside diphosphate linked moiety X)-type motif 91.09
NM_009787Pdia4protein disulfide isomerase associated 41.15
NM_027959Pdia6protein disulfide isomerase associated 61.20
NM_008832Phka1phosphorylase kinase alpha 11.17
NM_001083110Pja1praja1, RING-H2 motif containing1.08
NM_025882Pole4polymerase (DNA-directed), epsilon 4 (p12 subunit)0.94
NM_011275Rnaseh1ribonuclease H11.07
NM_025683Rperibulose-5-phosphate-3-epimerase1.08
NM_001163571Senp3SUMO/sentrin specific peptidase 31.10
NM_001177833Smoxspermine oxidase1.14
Phosphorylation, dephosphorylation
NM_013557Eif2ak1eukaryotic translation initiation factor 2 alpha kinase 11.07
NM_001004144Git1G protein-coupled receptor kinase-interactor 11.06
NM_144843Mtmr6myotubularin related protein 61.07
NM_001110218Ppm1hprotein phosphatase 1H (PP2C domain containing)1.15
NM_027673Tssk4testis-specific serine kinase 40.91
Protein folding
NM_009838Cct6achaperonin containing Tcp1, subunit 6a (zeta)1.08
NM_021422Dnaja4DnaJ (Hsp40) homolog, subfamily A, member 41.17
NM_198899Uggt1UDP-glucose glycoprotein glucosyltransferase 11.09
Protein ubiquitination, deubiquitination
NM_019927Arih1ariadne ubiquitin-conjugating enzyme E2 binding protein homolog 1 (Drosophila)1.05
NM_133247Usp33ubiquitin specific peptidase 331.08
Regulation of transcription
NM_017406Atf6bactivating transcription factor 6 beta1.08
NM_011714Baz1bbromodomain adjacent to zinc finger domain, 1B1.08
NM_019682Dynll1dynein light chain LC8-type 11.09
NM_008065GabpaGA repeat binding protein, alpha1.12
NM_001080817Prdm10PR domain containing 101.06
NM_027748Taf3TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor1.08
NM_001077364Tsc22d3TSC22 domain family, member 31.34
RNA-related function
NM_026623Nudt21nudix (nucleoside diphosphate linked moiety X)-type motif 211.13
NM_016813Nxf1nuclear RNA export factor 1 homolog (S. cerevisiae)1.09
NM_026045Prpf18PRP18 pre-mRNA processing factor 18 homolog1.08
NM_027911Raver1ribonucleoprotein, PTB-binding 10.93
NM_026886Srrm4serine/arginine repetitive matrix 41.12
NM_198102Tra2atransformer 2 alpha homolog (Drosophila)1.21
Signal transduction
NM_001128084Arhgap21Rho GTPase activating protein 211.04
NM_011332Ccl17chemokine (C-C motif) ligand 170.83
NM_009895Cishcytokine inducible SH2-containing protein1.13
NM_010172F7coagulation factor VII0.89
NM_181748Gpr120G protein-coupled receptor 1200.89
NM_008630Mt2metallothionein 20.93
NM_010934Npy1r * neuropeptide Y receptor Y11.23
NM_027571P2ry12purinergic receptor P2Y, G-protein coupled 120.92
NM_008882Plxna2plexin A21.05
NM_009067Ralbp1ralA binding protein 11.08
NM_001039089Sel1lsel-1 suppressor of lin-12-like (C. elegans)1.07
NM_008507Sh2b3SH2B adaptor protein 31.05
Translation
NM_013854Abcf1ATP-binding cassette, sub-family F (GCN20), member 11.07
NM_029735Eprsglutamyl-prolyl-tRNA synthetase1.06
NM_030722Pum1pumilio 1 (Drosophila)1.07
Transport
NM_001122820Ap3m2adaptor-related protein complex 3, mu 2 subunit1.06
NM_025828Lman2lectin, mannose-binding 21.10
NM_001013374Lman2llectin, mannose-binding 2-like1.09
NM_019983Rabgef1RAB guanine nucleotide exchange factor (GEF) 11.08
NM_009199Slc1a1solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 11.12
NM_011394Slc20a2solute carrier family 20, member 20.92
NM_011400Slc2a1solute carrier family 2 (facilitated glucose transporter), member 11.13
NM_028064Slc39a4solute carrier family 39 (zinc transporter), member 40.89
NM_172269Vps18vacuolar protein sorting 18 (yeast)1.06
Others
NM_027907Agxt2l1alanine-glyoxylate aminotransferase 2-like 11.64
NM_025675Atpbd4ATP binding domain 40.92
NM_177759Ccdc60coiled-coil domain containing 600.84
NM_001081345Chd2chromodomain helicase DNA binding protein 21.08
NM_030137CstadCSA-conditional, T cell activation-dependent protein0.79
NM_145570Fam176afamily with sequence similarity 176, member A1.19
NM_001033440Gm1587predicted gene 15870.89
NM_001024720Hmcn1hemicentin 10.85
NM_033322Lztfl1leucine zipper transcription factor-like 11.09
NM_001102613Phldb3pleckstrin homology-like domain, family B, member 30.86
NM_027241Polr3glpolymerase (RNA) III (DNA directed) polypeptide G like1.07
NM_175388Rnf169ring finger protein 1691.07
NM_022324Sdf2l1stromal cell-derived factor 2-like 11.24
NM_183136Spink8serine peptidase inhibitor, Kazal type 81.22
NM_175106Tmem177transmembrane protein 1771.12
NM_029074Tmem188transmembrane protein 1881.09
NM_153525Tmem41btransmembrane protein 41B1.15
NM_025749Zfp474zinc finger protein 4740.90
NM_146203Zfp764zinc finger protein 7640.90

Fold change greater than 1.0 represents increases, while less than 1.0 indicates decreases in lactating versus virgin mice.

Indicates gene expression result obtained from microarray analysis was further verified using qPCR.

Fold change greater than 1.0 represents increases, while less than 1.0 indicates decreases in lactating versus virgin mice. Indicates gene expression result obtained from microarray analysis was further verified using qPCR.

Verification of Microarray Results by Quantitative Real-time PCR Analysis

Consistent with the findings from microarray analysis, mRNA levels of three representative genes, Glul (P = 0.023), Igfbp3 (P = 0.004) and Sstr1 (P = 0.048) were identified as being significantly up-regulated in maternal mice as compared to virgin mice, whereas Fabp7 (P<0.001) and Gal (P = 0.023) were significantly down-regulated (Fig. 1). While Npy1r mRNA levels were found to be significantly increased in lactating versus virgin mice in the microarray analysis, we did not confirm a difference between the two groups using highly sensitive real-time PCR technique (Fig. 1).
Figure 1

Quantitative real-time PCR analysis of Fabp7, Gal, Glul, Igfbp3, Npy1r and Sstr1 expression in the septum.

Relative expression distribution of mRNA (y-axis) represented as a ratio of maternal versus virgin mice, was calculated using Ywhaz and CycA as reference genes, and shown by box-and-whisker plot as medians (dashed lines), interquartile range (boxes) and ranges (whiskers). Ratios over one indicate genes with higher expression in maternal relative to virgin mice, and ratios of less than one indicate genes with lower expression in maternal as opposed to virgin mice. Confirming array results, postpartum mice exhibited increased Glul, Igfbp3, Sstr1and decreased Fabp7 and Gal mRNA levels relative to virgin control mice. Npy1 was not confirmed. *P<0.05 maternal mice versus virgin control.

Quantitative real-time PCR analysis of Fabp7, Gal, Glul, Igfbp3, Npy1r and Sstr1 expression in the septum.

Relative expression distribution of mRNA (y-axis) represented as a ratio of maternal versus virgin mice, was calculated using Ywhaz and CycA as reference genes, and shown by box-and-whisker plot as medians (dashed lines), interquartile range (boxes) and ranges (whiskers). Ratios over one indicate genes with higher expression in maternal relative to virgin mice, and ratios of less than one indicate genes with lower expression in maternal as opposed to virgin mice. Confirming array results, postpartum mice exhibited increased Glul, Igfbp3, Sstr1and decreased Fabp7 and Gal mRNA levels relative to virgin control mice. Npy1 was not confirmed. *P<0.05 maternal mice versus virgin control.

Gene Set Enrichment Analysis Results

When evaluating genes upregulated in postpartum mice, 177 unique regions involved in transcriptional regulation reached significance (corrected P-value <0.05). The majority of these were miRNA binding sites (67%; 119 out of 177). For example, the site with the fifth highest p-value was a binding site for miRNA, Mir-183. For some binding sites, multiple miRNAs were listed. For example, for the 10th most significant region is the conserved binding site of AGCACTT, which can be bound by multiple miRNAs, including Mir-93 and Mir-302B. A partial (Table 2) and full list (Table S2) of the GSEA results are provided. The binding sites for 29 different transcription factors were identified as significantly upregulating gene expression in maternal mice (Table 3, Table S2). The database includes target data from multiple species and in some cases a given transcription factor (e.g., YY1) reached significance with multiple species. Here we only counted each transcription factor once and only list those associated with mammals (e.g., mouse, human). Twenty seven additional conserved binding sites in close proximity to genes were also identified as being linked with upregulated expression in maternal mice (Table S2). For these regions, no known transcription factor or miRNA has been identified that target these regions.
Table 2

List of all miRNAs found to be significantly linked with upregulated gene expression in postpartum mice using GSEA.

MIR-1MIR-30E-5PMIR-138MIR-195MIR-301MIR-381MIR-501
MIR-9MIR-31MIR-139MIR-197MIR-302A-DMIR-382MIR-505
MIR-15A-BMIR-32MIR-141MIR-199A-BMIR-320MIR-409-3PMIR-512-3P
MIR-16MIR-33MIR-142-3PMIR-200A-CMIR-323MIR-409-5PMIR-512-5P
MIR-17-3PMIR-34A-CMIR-142-5PMIR-202MIR-324-3PMIR-410MIR-515-3P
MIR-17-5PMIR-92MIR-143MIR-203MIR-326MIR-422A-BMIR-516-5P
MIR-18A-BMIR-93MIR-144MIR-204MIR-329MIR-424MIR-518A-2
MIR-19A-BMIR-96MIR-145MIR-205MIR-335MIR-429MIR-518C
MIR-20A-BMIR-101MIR-148A-BMIR-206MIR-337MIR-432MIR-519A-D
MIR-21MIR-103MIR-149MIR-211MIR-346MIR-448MIR-520A-H
MIR-22MIR-105MIR-150MIR-212MIR-361MIR-449MIR-524
MIR-24MIR-106A-BMIR-152MIR-214MIR-363MIR-452MIR-526B
MIR-25MIR-107MIR-153MIR-216MIR-365MIR-485-3PMIR-527
MIR-26A-BMIR-122AMIR-154MIR-218MIR-367MIR-485-5P
MIR-27A-BMIR-124AMIR-155MIR-219MIR-369-3PMIR-487
MIR-28MIR-125A-BMIR-181A-DMIR-221MIR-372MIR-493
MIR-30A-3PMIR-128A-BMIR-182MIR-222MIR-373MIR-494
MIR-30A-5PMIR-129MIR-183MIR-223MIR-374MIR-495
MIR-30B-DMIR-130A-BMIR-186MIR-224MIR-377MIR-496
MIR-30E-3PMIR-132MIR-194MIR-299-5PMIR-378MIR-497

For a given binding site near an upregulated gene, in some cases only one miRNA is identified, but for other sites multiple miRNAs are identified. In the list, if a dash separates two letters, that indicates all miRNAs within those letters were also significant (e.g., MIR-181A-D indicates miRNAs 181A, 181B, 181C, and 181D). Table S2 provides additional information on the binding sites for the miRNAs and p-values.

Table 3

List of transcription factors (and corrected p-values) that are significantly linked to upregulation of subsets of genes in maternal mice using GSEA.

ELK10.0000RFX10.0000MAX0.0080TFDP20.0210
YY10.0000GABPB20.0010MYC0.0080ERR10.0220
NRF20.0000E2F0.0010SOX90.0080FOXN10.0230
ATF20.0000HSF10.0020HLF0.0080PAX30.0250
E4F10.0000HIF1A0.0020ZF50.0090E2F40.0390
E4BP40.0000ATF40.0040HSF20.0130
NFMUE10.0000E2F10.0060NMYC0.0130
NRF10.0000SREBF10.0070TFDP10.0190

GSEA website (http://www.broadinstitute.org/gsea/index.jsp) provides information on the conserved binding motif along with all gene targets. Table S2 provides information on p-values and names used by GSEA. Abbreviations: ATF, activating transcription factor; E2F, E2F transcription factor; E4F, E4F transcription factor; ELK1, ELK1, member of ETS oncogene family; ERR1, oestrogen receptor related 1; GABPB2, GA repeat binding protein, beta 2; HIF1, hypoxia inducible factor 1; HLF, hepatic leukemia factor; HSF, heat shock factor; MAX, max protein; MYC, myelocytomatosis oncogene; NMYC, neuroblastoma myc-related oncogene; NRF1, nuclear respiratory factor 1; PAX3, paired box gene 3; RFX1, regulatory factor X, 1; SF1, splicing factor 1; SOX9, SRY-box containing gene 9; SREBF1, sterol regulatory element binding transcription factor 1; TFDP, transcription factor Dp; YY1, YY1 transcription factor; ZF5, zinc finger protein 5.

For a given binding site near an upregulated gene, in some cases only one miRNA is identified, but for other sites multiple miRNAs are identified. In the list, if a dash separates two letters, that indicates all miRNAs within those letters were also significant (e.g., MIR-181A-D indicates miRNAs 181A, 181B, 181C, and 181D). Table S2 provides additional information on the binding sites for the miRNAs and p-values. GSEA website (http://www.broadinstitute.org/gsea/index.jsp) provides information on the conserved binding motif along with all gene targets. Table S2 provides information on p-values and names used by GSEA. Abbreviations: ATF, activating transcription factor; E2F, E2F transcription factor; E4F, E4F transcription factor; ELK1, ELK1, member of ETS oncogene family; ERR1, oestrogen receptor related 1; GABPB2, GA repeat binding protein, beta 2; HIF1, hypoxia inducible factor 1; HLF, hepatic leukemia factor; HSF, heat shock factor; MAX, max protein; MYC, myelocytomatosis oncogene; NMYC, neuroblastoma myc-related oncogene; NRF1, nuclear respiratory factor 1; PAX3, paired box gene 3; RFX1, regulatory factor X, 1; SF1, splicing factor 1; SOX9, SRY-box containing gene 9; SREBF1, sterol regulatory element binding transcription factor 1; TFDP, transcription factor Dp; YY1, YY1 transcription factor; ZF5, zinc finger protein 5.

Discussion

This study used Affymetrix microarray analysis and real-time PCR techniques to examine CNS gene expression changes in the septum during lactation. We identified 116 genes (P<0.0025 as analyzed by PLIER) and 2844 genes (using a lower cutoff of P<0.05) which were distributed across a number of categories in biological process, as being differentially expressed in lactating versus virgin mice. Some of the genes identified are consistent with previous studies testing gene expression changes during lactation. Our study also found a list of novel genes that may play a role in the transition from a non-parental to a parental state. Further, using data mining approaches and GSEA we identified a number of miRNAs and transcription factors that may play a role in producing the maternal brain.

Identification of Expression Changes During Lactation Consistent with Previous Studies

In the septum, mRNA of Igfbp3 increased about 30% during lactation (Table 1), and was confirmed by qPCR (Fig. 1). This result is consistent with previous findings that Igfbp3 was increased in the arcuate nucleus of hypothalamus (Arc)/ventromedial nucleus of hypothalamus (VMH) [33], and in large hypothalamic CNS regions in previous maternal array studies [34]. Igfbp3 is a member of the superfamily of insulin-like growth factor (IGF) binding proteins and is expressed in the brain. In vivo studies show that Igfbp3 inhibits IGF action by modulating the bioavailability and distribution of IGFs [35]. One possibility is that increased Igfbp3 in the septum during lactation would result in reduced IGF action, but this would need to be determined. Given that IGF negatively regulates food intake and body weight [36], the increased expression of Igfbp3 would be expected to increase food intake through an IGF-mediated mechanism, consistent with the low levels of IGF in association with the metabolic adaptations that occur during lactation [37]. Based on its role in neurogenesis [38], Igfbp3 has been linked to the involvement in certain disease processes, such as ischemia, hypoxia and autism [39], [40]. There are multiple pathways by which Igfbp3 could possibly interact with maternal circuitry. Fabp7 transcript was reduced about 30% during lactation in this study and was also found to be significantly decreased in maternal rodents in Arc [33] and hypothalamic CNS regions [34] in previous array studies. The mammalian Fabp7 is expressed in radial glial cells, astrocytes, and neuronal cell precursors, functioning as a modulator of cell differentiation, proliferation, and neurogenesis [41]. Interestingly, Fabp7 was preferentially expressed in numerous astrocytes in the amygdala and septum, regions known to be critically involved in the regulation of fear and anxiety [42]. In addition, previous studies show that this gene modulates the processes of sleep, memory, and anxiety [42], [43]. Several lines of evidence associate Fabp7 with neuropsychiatric diseases such as schizophrenia [44]. Fabp7-deficient mice displayed enhanced fear memory and anxiety in adulthood [42]. Together with the functional significance of the septum in fear, anxiety and memory [15], [20], [21], these findings suggest the possibility that Fabp7 plays an important role in emotional changes that occur during the postpartum period. We found a decrease of galanin in the gene array, which was confirmed by qPCR. Significant reduction of galanin during lactation has been observed in previous array studies [33], [34]. Galanin is a 29 amino-acid (30 in humans) neuropeptide and is richly expressed in the CNS. Although galanin was not listed in the top identified genes in terms of significance (P = 0.018), it was selected as a gene of interest since this peptide has been known to regulate a variety of behavioral processes, including food intake, sexual behavior, learning, memory, reward, cognition, sleep, seizure, as well as emotion/mood-related behaviors, such as stress, fear, anxiety and depression [45]–[47]. Given that LS has many roles in common with galanin in the processes of fear, anxiety and depression, galanin may be an interesting candidate gene for regulation of LS-mediated affective processes.

Identification of Novel Genes During Lactation

The upregulation of Glul mRNA in the septum of maternal mice was noteworthy for a few reasons. The astrocytic Glul or enzyme glutamine synthetase (GS), is a key enzyme involved in the glutamate-glutamine cycle. Glutamate is metabolized mainly to glutamine by the catalyzation of Glul. Further, glutamine may also be utilized for de novo synthesis of GABA, a major inhibitory neurotransmitter. Thus, Glul modulates levels of glutamate, glutamine, and GABA in the brain [48], and influences GABAergic neurotransmission [49]. As GABA signaling regulates maternal defense [11], it may be that Glul plays a role in the emergence of offspring protection during the postpartum period. Research on the role of excitatory neurotransmitter glutamate in maternal behavior has so far received little attention, but future work evaluating glutamate and maternal care appears to be merited. We identified increased Sstr1 transcript in the septum during lactation. The neuropeptide, somatostatin, has been linked to hormone release, cell proliferation, and many pathophysiological processes of brain disorders [50]. Somatostatin exerts its actions by interacting with specific G-protein coupled receptors. Sstr1 acts as an inhibitory autoreceptor located on somatostatin neurons and is involved in the modulation of the ultradian release of growth hormone from pituitary [51]. As somatostatin has been shown to regulate GABA receptor functions [52], and GABA signaling is involved in maternal defense, it will be interesting to know whether and how Sstr1 regulates this aspect of maternal care. It should be noted that many genes implicated in metabolism, cell differentiation, or proliferation exhibited altered expression pattern during lactation, suggesting that septum may be an important neural site for lactation-induced metabolic and structural alterations. As can be seen in Table 1, 18 out of 116 genes were linked to cell division, death, or proliferation, while about 16% were metabolism-related genes. However, the mechanism by which these genes regulate metabolic and structural adaptations during lactation remains to be evaluated. This study provides potential candidate genes for future research to answer these questions.

Genes Previously Shown to be Differentially Expressed During Lactation Not Identified in the Present Study

Expression of neuropeptide Y, preproenkephalin, and oxytocin has been reported to be increased during lactation [22], [24], [33], [34], whereas proopiomelanocortin was down-regulated [53]. Although these changes were not observed in this study, one possible explanation for negative results is a region-specific effect as these neuropeptides were examined in other brain regions such as hypothalamus and Arc, while the septum was tested in this study. Alternatively, as discussed below, using the whole septum as a target, rather than subregions of septum, may contribute to the lack of difference. In addition to the above two possible factors, time lapse between the parturition and the gene analysis may be another contributing factor. Previous studies have shown that gene expression in specific brain regions undergoes a time-course change from parturition through lactation [24], [54], [55]. For example, preproenkephaline mRNA in the anterior arcuate nucleus of lactating versus virgin females significantly increased on postpartum day 10, but did not differ on postpartum day 3 [24], suggesting that gene expression is dynamic and alters during the postpartum period. Future study will be directed towards understanding the time-course effect on gene expression during the postpartum period.

Gene Set Enrichment Analysis

One surprising result from this study was the finding of a large number of miRNAs and transcription factors (N = 177) that were significantly linked to the upregulation of genes in maternal mice, whereas no significant links were found with downregulated maternal expression. Why so many regulators for upregulation, but not one for downregulation were found is not clear, but the finding may reflect the underlying processes of developing the maternal brain. It was also surprising to find a high number of miRNAs that were linked to upregulated gene expression. miRNAs are mostly linked with downregulation of gene expression as they can bind to mRNA transcripts, leading to degradation or suppressed translation [56]. Therefore, one explanation could be that in the process of developing the maternal brain, a number of miRNAs are themselves downregulated and this, in turn, leads to elevated expression of select genes. MiRNAs appear to play important roles in mammalian females in both developments of the placenta and mammary glands [31], [32]. Thus, an important role for miRNAs in reproduction has already been documented. To our knowledge, this study is the first to suggest that miRNAs may also play an important role in producing the maternal brain, but direct studies are needed to address this possibility. The identification of 29 transcription factors, including Elk-1, YY1, and HSF1, that were linked to upregulated genes provides possible new insight into how the maternal brain may be produced. Although key roles for estrogen and progesterone receptors have been found in producing the maternal brain [27], [28], steroid receptors were not identified here, with the exception of estrogen related receptor 1 (Err1). One explanation is that steroid receptors alter expression of other transcription factors and the ones identified here may be key agents for some of the final changes in maternal gene expression in septum. Some of the transcription factors identified by GSEA were also found to have altered expression from the PLIER array analysis (P<0.05), such as Hsf1. It is not necessarily surprising that transcription factors or miRNAs linked by GSEA to altered expression are themselves not found to be differentially expressed because their action could have occurred prior to the day of tissue collection (e.g., during pregnancy or early postpartum). It was also noteworthy that some conserved binding sites were found that were linked to maternally upregulated genes, although there are currently no known factors that bind to these sites. Future studies that determine whether or how these sites are acted upon will be critical for developing an understanding of the relevance of these binding sites.

Methodological Considerations and Limitations

A number of factors contribute to the formation of the maternal brain, including the experience of mating, pregnancy, parturition, lactation, and the sensory input from the pups. All these factors orchestrate many of changes in gene expression that occur during the postpartum period. This study seeks to explore the results of this constellation of experiences by examining the differences in gene expression between virgin mice, who have never been exposed to any of these experiences, and lactating mice, who have been exposed to all of them. Thus, the observed changes in gene expression in postpartum female mice do not simply reflect maternal care or lactation, but rather the integration of multiple factors. In this study, we did not discriminate between virgins at different stages of the estrus cycle although estrous stage can influence gene expression [57]. Virgin mice were either in estrus, diestrus I and diestrus II (periods of relatively consistent estradiol and progesterone levels), but not proestrus. In this way, only differences large enough to rise above any noise created by varying estrus states appear in the results. While this noise may obscure differences in gene expression, the present approach serves to highlight general differences in virgin and postpartum mice. However, subtler difference between the virgin and lactating mice may be missed. It should be noted that virgin female mice were fed a breeder diet to provide identical food to both groups. This feeding paradigm may have had a somewhat different effect on gene expression changes relative to regular rodent chow as breeder diet differentially modulates expression of genes implicated in food intake and energy balance due to its high fat content [58], [59]. One limitation of using whole septum is that we are unable to determine whether changes occur throughout septum or are specific to subregions. Future studies examining subregions can address this issue. Also, if changes in gene expression occur in opposite directions within these subregions, then the difference may be missed as false negatives. A related general issue is that microarray analysis can produce false negatives. The chips target a subset of regions along a given mRNA transcript and it is possible with different targeting that significant differences may have been found. Although different algorithms produce different false negative rates [60], [61], the approach used here, PLIER, is the current recommended algorithm as it introduces a higher sensitivity to changes in abundance for targets near background [60]. One example of a possible false negative is that we recently glutamic acid decarboxylase (GAD67) mRNA in the septum to be upregulated in lactating versus virgin mice (unpublished observation), while no difference was observed in this study. Microarray technology has become a useful tool for analyzing gene expression profiling and in identifying new genes or molecular pathways involved in multiple processes [62]–[64]. Five out of six genes identified as being differentially expressed (except Npy1r) in this study were confirmed by real-time PCR, validating our microarray analysis as reliable means to evaluate gene expression.

Conclusions

Using high density oligonucleotide microarrays, we observed a distinct gene expression profile in the septum of maternal mice. Given that the identified genes may play a role in diverse biological processes, this study provides new insights into the genes linked to the septum and brain changes that promote the emergence of maternal care during the postpartum period. Our findings suggest a potential key role for miRNAs in creating the maternal brain and could open an important new area of research. Future studies could involve directly evaluating and manipulating miRNAs to determine the relative importance of miRNAs in producing a maternal brain.

Schematic representation of the brain regions (boxed areas) dissected for gene array analysis.

Distance from Bregma in the rostrocaudal planes is indicated. Reprinted and modified from The Allen Mouse Brain Atlas (reference atlas version 1, 2008). Abbreviations: LSc, caudal part of lateral septal nucleus; LSr, rostral part of lateral septal nucleus; MS, medial septal nucleus; VL, lateral ventricle; aco, anterior commissure, olfactory limb. CycA primer sequences were described in published literature [74].

Materials and Methods

Animals

Untested nulliparous female mice from a line of mice previously selected for high maternal defense (original stock was outbred hsd:ICR mice) (Mus domesticus) (Harlan, Madison, WI) were used. Selected mice were used because they exhibit the reliable emergence of a number of maternal characteristics, including nursing and offspring protection, and thus provide a solid platform for comparing maternal and non-maternal brains. As for any work that uses one strain, there is a limitation in knowing whether results apply to other strains. Only with comparisons across strains and species can reliable alterations with the postpartum period be identified, but here we provide a start for examining septal changes in gene expression with maternal behavior in mice. All animals were age matched (∼70 days old at time of dissection). For mating, females were housed with a breeder male (hsd:ICR strain) for 2 weeks. At the same time, virgin females were co-housed to provide similar social stimuli. When breeder males were removed, all females (pregnant and virgin) were housed individually and provided precut nesting material until dissections. Thus, virgin and postpartum females experienced similar levels of co-housing and single housing. The timing of cohousing and isolation was performed to minimize the effects of isolation-induced stress. Polypropylene cages were changed once weekly, but when pups were born (postpartum Day 0), cages were not changed for the postpartum female or the age matched virgin control for the remainder of the experiment. All animals were housed in the same room and cages of virgin and lactating females were alternated with one another on the same shelves. A 14∶10 light/dark cycle with lights on at 06∶00 h CST was used. Female mice were given ad lib access to breeder chow (Harlan) and tap water. All procedures were carried out in strict accordance with the guidelines of the National Institutes of Health Guide for the Care and Use of Laboratory Animals, and studies were approved by the University of Wisconsin Animal Care and Use Committee.

Tissue Collection and RNA Extraction

On postpartum Days 6–8, brains were removed from lactating females between 10∶00 and 12∶00 h. Brains from age-matched, virgin females were also removed on the same day and dissections were alternated between the two groups so that an equal number of dissections from each group were obtained. The animals were lightly anaesthetized with isoflurane, killed by cervical dislocation and then decapitated. Following decapitation, virgin females were examined for stage of estrous cycle using a vaginal lavage [65], [66]. Female mice in vaginal proestrus were not used because this stage is associated with mating in mice. For the microarray study, the stages of the six virgin mice were estrous, diestrous I, and diestrous II (N = 2 each). Although estrous stage can influence gene expression [57], the use of mice from different estrous states (excluding proestrus) provides a generic view of the virgin female and should provide insights into reliable differences between maternal and virgin mice. The whole brain was removed, snap frozen in isopentane on dry ice, and then stored at −80°C until sliced. Brain sections were sliced in a cryostat (Leica, CM1850, Bannockburn, IL, USA) with the first two sections at 300 microns and the last section at 200 microns and then mounted on glass slides. Target tissue was captured using a micropunch technique [67]. Microdissection of frozen brain sections was made with Brain Punch Set (Stoelting, Wood Dale, IL, USA) under a dissecting microscope. The whole septum including lateral and medial parts (Fig. 2) was collected bilaterally from Bregma 1.10 to 0.14 and pooled, so that each mouse provided one sample of the septum. Microdissections from ten animals in each group were flash frozen on dry ice and stored at −80°C until being processed for either gene array analysis or real-time PCR. Total RNA was extracted and prepared in matched pairs (virgin versus lactating) using an Aurum Total RNA Fatty and Fibrous Tissue Kit (Bio-Rad, Hercules, CA, USA) according to the manufacturer’s instructions. Following isolation, the integrity of RNA was assessed using Agilent RNA 6000 Nano Chips with Agilent Bioanalyzer 2100 (Agilent Technologies, Palo Alto, CA). The purity of RNA was tested, and the yield of RNA was determined using NanoDrop 1000 spectrophotometer (Thermo Scientific, Wilmington, DE, USA). Purified total RNA was stored at −80°C until processed.
Figure 2

Schematic representation of the brain regions (boxed areas) dissected for gene array analysis.

Distance from Bregma in the rostrocaudal planes is indicated. Reprinted and modified from The Allen Mouse Brain Atlas (reference atlas version 1, 2008). Abbreviations: LSc, caudal part of lateral septal nucleus; LSr, rostral part of lateral septal nucleus; MS, medial septal nucleus; VL, lateral ventricle; aco, anterior commissure, olfactory limb.

High-Density Oligonucleotide Array Hybridization

Six out of ten samples in each group (n = 6 per group) were randomly chosen for use in the microarray experiment. Microarray analysis was performed with the GeneChip Mouse Gene 1.0 ST array (Affymetrix, Santa Clara, CA, USA) using targets derived from total RNA isolated from septum as described above. cDNA for array hybridization was synthesized from 200 ng of total RNA using an Ambion GeneChip WT Expression Kit (Ambion, Austin, TX, USA) according to the manufacturer’s specifications. Briefly, total RNA was used to synthesize double-stranded cDNA, which was then used as a template for single-stranded cRNA synthesis. This cRNA was in turn used as a template for a second round of single-stranded cDNA synthesis, and the resultant DNA-RNA hybrids were then degraded using RNase H. Amplified cDNA was then fragmented and biotinylated using an Affymetrix WT Terminal Labeling Kit (Affymetrix, Santa Clara, CA, USA) according to the manufacturer’s specifications. Fragmented and labeled cDNA samples were hybridized with the arrays at 45°C for 16 hours. The hybridized arrays were then washed and stained according to manufacturer specifications, and arrays were scanned at 570 nm on an Affymetrix GC3000 G7 Scanner. Data were extracted and processed from scans using Affymetrix Command Console v. 3.1.1.1229. cDNA synthesis, fragmentation, labeling, array hybridization, staining, and scanning were performed by the Gene Expression Center at the University of Wisconsin–Madison.

Probeset Level Summarization and Microarray Statistical Analysis

Probeset level summarization and data normalization were performed with the PLIER algorithm with GC bin background correction using Affymetrix Power Tools v. 1.12.0. The microarray data discussed in this publication, both raw and summarized, have been deposited in NCBI’s Gene Expression Omnibus [68], and are accessible through GEO Series accession number GSE30836 (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE30836). GEO reporting fulfills the requirements of the MIAME. Inferential statistics for differential expression between maternal and virgin samples were calculated using the array-specific empirical Bayesian implementation of ANOVA in the BioConductor package limma v.3.6.9 [69]. Both nominal and false discovery rate corrected p-values were calculated, and fold-change differences for each gene were calculated in Excel by dividing the limma-calculated average maternal expression by the limma-calculated average virgin expression.

Verification of Microarray Results with Quantitative Real-time PCR (qPCR)

To confirm gene expression results obtained from microarray analysis, six genes: fatty acid binding protein 7 (Fabp7), galanin (Gal), glutamate-ammonia ligase (Glul)/glutamine synthetase (GS), insulin-like growth factor binding protein 3 (Igfbp3), neuropeptide Y receptor 1 (Npy1r), and somatostatin receptor 1 (Sstr1) were evaluated using qPCR. These genes were chosen because of their possible involvement in multiple lactation-induced processes and the function of the genes is described in the Discussion. A SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen, Carlsbad, CA, USA) was used to reverse transcribe 100 ng of RNA to cDNA in an Eppendorf MasterCycler Personal PCR machine (Eppendorf, Hamburg, Germany) using poly-T 20mer primers. The cDNA was then amplified using a SsoFast EvaGreen Supermix kit (Bio-Rad, Hercules, CA, USA) in a StepOnePlus real-time PCR system (Applied Biosystems, Foster City, CA, USA). The amplification mixtures (20 µL) contained 1x SsoFast EvaGreen Supermix, 160 ng template cDNA, and 500 nM forward and reverse primers. Each sample was run in triplicate and standard amplification procedures were used. The cycling profile is as follows: an initial melting step at 95°C for 30 Sec followed by 40 cycles of a 95°C melting step for 5 sec, a 58°C annealing step except Fabp7 (at 60°C) for 20 sec, and a 72°C elongation step for 20 sec. Primers for genes of interest and reference genes (Table 4) were designed and screened for specificity using NCBI Primer-BLAST. Ywhaz and CycA were used as reference genes, as they are found to be among the most stable genes in rodent brain [70], [71] and found not to be different between lactating and virgin females in our arrays results. Following amplification, a standard curve was generated to assess the empirical PCR reaction efficiency, and a dissociation curve analysis was performed to insure specificity of PCR products. Ct values were calculated using the StepOnePlus software. The expression ratio of mRNA of genes in lactating relative to virgin (normalized to the reference genes Ywhaz and CycA) was calculated using a relative expression software tool REST 2009, which corrects for empirical PCR efficiency, allows for the use of multiple reference genes, and utilizes a randomization test of significance [72]. The N’s used for qPCR were as follows: virgin, N = 10; maternal, N = 10. Four females were added to each group from the array mice and the virgin states were estrous (N = 2), diestrous I (N = 4), and diestrous II (N = 4).
Table 4

Primers of interest and reference genes used for quantitative real-time PCR assay.

GeneFull nameNCBI accession numberPrimerPrimer position
CycACyclophilin ANM_008907.1Forward 5′-TGCTGGACCAAACACAAACG-3′
Reverse 5′-GCCTTCTTTCACCTTCCCAAA-3′
Fabp7Fatty acid binding protein 7NM_021272.3Forward 5′-TAAGTCTGTGGTTCGGTTGG-3′ 329–348
Reverse 5′-CCCAAAGGTAAGAGTCACGAC-3′ 429–449
GalGalaninNM_010253.3Forward 5′-GAGAGCAACATTGTCCGCAC-3′ 396–415
Reverse 5′-ATGGTCTCAGGACTTCTCTAGG-3′ 505–527
GlulGlutamate-ammonia ligaseNM_008131.3Forward 5′-TGAGAGAACCATCCTATTCACTG-3′ 1927–1949
Reverse 5′-TAAGCAGTAATGAAGCTGAGACC-3′ 2045–2067
Igfbp3Insulin-like growth factor binding protein 3NM_008343.2Forward 5′-GGAAACCCATAACCGAGTGAC-3′ 1475–1495
Reverse 5′-TCCCACAGTTCCCAAGTAGATC-3′ 1585–1606
Npy1rNeuropeptide Y receptor 1NM_010934.4Forward GCGACTCAGAGCATTTCTAAC 2547–2567
Reverse GCAGTGAAGGATAAATGGTGAG 2637–2658
Sstr1Somatostatin receptor 1NM_009216.3Forward 5′-GCTGTCCAATTGAGTATGCTGC-3′ 3419–3440
Reverse 5′-CAGGTCAGTGTGAACTTGCG-3′ 3527–3546
YwhazTyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptideNM_011740.3Forward 5′-TCCTTATTCCCTCTTGGCAG-3′ 2432–2451
Reverse 5′-ATGGAAGCTACATTAGCGGTTT-3′ 2502–2523

CycA primer sequences were described in published literature [74].

Gene Set Enrichment Analysis (GSEA)

GSEA is a technique that calculates up or down regulation of precompiled lists of genes and was performed using GSEA software v. 2.07 [30]. The specific gene sets described here came from the MSigDB C3 computationally-curated gene set of miRNA and transcription factor binding sites. For transcription factor binding sites, data from multiple species were used, including mice, humans, and rats. For miRNA, only human data sets were available, but binding sites for given miRNAs in mice and humans are highly conserved [73]. The analysis used z-transformed values for PLIER-normalized array intensities, t-tests to calculate individual gene inferential statistics, gene set permutation, and a weighted test statistic. The GSEA output provides both nominal and corrected p-values for each target. Full list of all targets, their relative expression and value ranking using PLIER algorithm. (XLS) Click here for additional data file. List of target sites linked significantly with upregulation of subsets of genes in postpartum mice by GSEA. (DOC) Click here for additional data file.
  72 in total

Review 1.  Nutritional regulation of IGF-I and IGF binding proteins.

Authors:  D R Clemmons; L E Underwood
Journal:  Annu Rev Nutr       Date:  1991       Impact factor: 11.848

Review 2.  Connections of the rat lateral septal complex.

Authors:  P Y Risold; L W Swanson
Journal:  Brain Res Brain Res Rev       Date:  1997-09-19

3.  Expression of intracellular progesterone receptors in rat brain during different reproductive states, and involvement in maternal behavior.

Authors:  M Numan; J K Roach; M C del Cerro; A Guillamón; S Segovia; T P Sheehan; M J Numan
Journal:  Brain Res       Date:  1999-06-05       Impact factor: 3.252

4.  Effects of a high-fat diet and strain on hypothalamic gene expression in rats.

Authors:  Andrea O Schaffhauser; Abram M Madiehe; Hugh D Braymer; George A Bray; David A York
Journal:  Obes Res       Date:  2002-11

5.  Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles.

Authors:  Aravind Subramanian; Pablo Tamayo; Vamsi K Mootha; Sayan Mukherjee; Benjamin L Ebert; Michael A Gillette; Amanda Paulovich; Scott L Pomeroy; Todd R Golub; Eric S Lander; Jill P Mesirov
Journal:  Proc Natl Acad Sci U S A       Date:  2005-09-30       Impact factor: 11.205

6.  Altered expression of agouti-related protein and its colocalization with neuropeptide Y in the arcuate nucleus of the hypothalamus during lactation.

Authors:  P Chen; C Li; C Haskell-Luevano; R D Cone; M S Smith
Journal:  Endocrinology       Date:  1999-06       Impact factor: 4.736

7.  Effect of lactation on hypothalamic preproenkephalin gene expression.

Authors:  M A Ottinger; K L Rosewell; N G Weiland; K T Margaretten; P M Wise
Journal:  J Neuroendocrinol       Date:  1995-05       Impact factor: 3.627

8.  Insulin restores GH responsiveness during lactation-induced negative energy balance in dairy cattle: effects on expression of IGF-I and GH receptor 1A.

Authors:  S T Butler; A L Marr; S H Pelton; R P Radcliff; M C Lucy; W R Butler
Journal:  J Endocrinol       Date:  2003-02       Impact factor: 4.286

9.  Estrogen regulation of proenkephalin gene expression in the ventromedial hypothalamus of the rat: temporal qualities and synergism with progesterone.

Authors:  G J Romano; C V Mobbs; R D Howells; D W Pfaff
Journal:  Brain Res Mol Brain Res       Date:  1989-01

10.  Prolactin receptor gene expression in the forebrain of pregnant and lactating rats.

Authors:  Phyllis E Mann; Robert S Bridges
Journal:  Brain Res Mol Brain Res       Date:  2002-09-30
View more
  15 in total

1.  Glutamate, GABA, and glutamine are synchronously upregulated in the mouse lateral septum during the postpartum period.

Authors:  Changjiu Zhao; Stephen C Gammie
Journal:  Brain Res       Date:  2014-10-23       Impact factor: 3.252

2.  The circadian gene Nr1d1 in the mouse nucleus accumbens modulates sociability and anxiety-related behaviour.

Authors:  Changjiu Zhao; Stephen C Gammie
Journal:  Eur J Neurosci       Date:  2018-08-07       Impact factor: 3.386

3.  Mu opioid receptors in the medial preoptic area govern social play behavior in adolescent male rats.

Authors:  Changjiu Zhao; Liza Chang; Anthony P Auger; Stephen C Gammie; Lauren V Riters
Journal:  Genes Brain Behav       Date:  2020-05-18       Impact factor: 3.449

4.  Metabotropic glutamate receptor 3 is downregulated and its expression is shifted from neurons to astrocytes in the mouse lateral septum during the postpartum period.

Authors:  Changjiu Zhao; Stephen C Gammie
Journal:  J Histochem Cytochem       Date:  2015-03-04       Impact factor: 2.479

5.  Down-regulation of fatty acid binding protein 7 (Fabp7) is a hallmark of the postpartum brain.

Authors:  Terri M Driessen; Changjiu Zhao; Marissa Saenz; Sharon A Stevenson; Yuji Owada; Stephen C Gammie
Journal:  J Chem Neuroanat       Date:  2018-08-01       Impact factor: 3.052

6.  MicroRNA expression is altered in lateral septum across reproductive stages.

Authors:  M C Saul; C Zhao; T M Driessen; B E Eisinger; S C Gammie
Journal:  Neuroscience       Date:  2015-11-17       Impact factor: 3.590

Review 7.  Genetic and neuroendocrine regulation of the postpartum brain.

Authors:  Stephen C Gammie; Terri M Driessen; Changjiu Zhao; Michael C Saul; Brian E Eisinger
Journal:  Front Neuroendocrinol       Date:  2016-05-13       Impact factor: 8.606

8.  Large scale expression changes of genes related to neuronal signaling and developmental processes found in lateral septum of postpartum outbred mice.

Authors:  Brian E Eisinger; Changjiu Zhao; Terri M Driessen; Michael C Saul; Stephen C Gammie
Journal:  PLoS One       Date:  2013-05-22       Impact factor: 3.240

9.  Evidence for functional interactions between the placenta and brain in pregnant mice.

Authors:  Susanta K Behura; Andrew M Kelleher; Thomas E Spencer
Journal:  FASEB J       Date:  2018-12-06       Impact factor: 5.834

10.  Medial prefrontal cortex: genes linked to bipolar disorder and schizophrenia have altered expression in the highly social maternal phenotype.

Authors:  Brian E Eisinger; Terri M Driessen; Changjiu Zhao; Stephen C Gammie
Journal:  Front Behav Neurosci       Date:  2014-04-02       Impact factor: 3.558

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.