| Literature DB >> 22690120 |
Khaled K Abu-Amero1, Taif Anwar Azad, George L Spaeth, Jonathan Myers, L Jay Katz, Marlene Moster, Thomas M Bosley.
Abstract
PURPOSE: To investigate the expression level of the optineurin gene (OPTN) in the blood of primary open angle glaucoma (POAG) patients to determine if altered expression is playing a role in primary open angle glaucoma systemically.Entities:
Mesh:
Substances:
Year: 2012 PMID: 22690120 PMCID: PMC3370688
Source DB: PubMed Journal: Mol Vis ISSN: 1090-0535 Impact factor: 2.367
Primer sequences, PCR annealing temperature and amplicon size for OPTN.
| 57 | 420 | ||
| 57 | | ||
| 59 | 351 | ||
| 59 | | ||
| 57 | 253 | ||
| 57 | | ||
| 57 | 391 | ||
| 57 | | ||
| 59 | 376 | ||
| 59 | | ||
| 57 | 402 | ||
| 57 | | ||
| 57 | 382 | ||
| 57 | | ||
| 57 | 272 | ||
| 57 | | ||
| 59 | 352 | ||
| 59 | | ||
| 57 | 302 | ||
| 57 | | ||
| 57 | 315 | ||
| 57 | | ||
| 59 | 349 | ||
| 59 | | ||
| 57 | 293 | ||
| 57 | | ||
| 57 | 358 | ||
| 57 | | ||
| 55 | 330 | ||
| 55 | | ||
| 59 | 279 | ||
| 59 | | ||
| 57 | 777 | ||
| 57 | | ||
| 57 | 777 | ||
| 57 | | ||
| 57 | 777 | ||
| 57 | | ||
| 57 | 630 | ||
| 57 |
F=forward; R=reverse. Bold and underlined sequences are those of the M13.
Primer sequences and annealing temperature β-globulin and OPTN fluorescent labeled primers.
| β-globulin F | (6-FAM)AGCCTCGCCTTTGCCGA | 57 |
| β-globulin R | CTGGTGCCTGGGGCG | |
| (6-FAM)GCAGGTTCCCTGGTCAGC | 59 | |
| CAGGCAGCTGTTTCAAAGGT |
F=forward; R=reverse. The forward primers were labeled with 6-FAM.
OPTN gene expression in POAG patients and controls.
| OPTN expression; mean (SD) | 38:19 | 102205 (33682) | 90885 (45922) | 0.35 |
| β-globulin expression; mean (SD) | 44:24 | 109533 (31355) | 103885 (31047) | 0.48 |
| OPTN/β-globulin; mean (SD) | 38:19 | 1.0571 (0.606) | 1.0196 (0.671) | 0.83 |
| OPTN expression in Caucasians; mean (SD) | 20:18 | 101113 34580) | 92916 (46368) | 0.54 |
| β-globulin expression in Caucasians; mean (SD) | 22:20 | 104941 (31552) | 99392 (32171) | 0.58 |
| OPTN/β-globulin in Caucasians; mean (SD) | 20:18 | 1.1091 (0.648) | 1.0512 (0.675) | 0.79 |
POAG=primary open angle glaucoma; OPTN=Optineurin gene; SD=standard deviation. Ψ the number of patients or controls tested were limited to available samples and their RNA quality and quantity.
Correlation between clinical parameters and OPTN/β-globulin ratios.
| Age in years | 0.146 | 0.40 |
| Sex | −0.131 | 0.45 |
| Ethnicity | −0.120 | 0.49 |
| Visual acuity [OD] | 0.328 | 0.05 |
| Visual acuity [OS] | 0.331 | 0.05 |
| Maximum IOP [OD] | −0.026 | 0.88 |
| Maximum IOP [OS] | −0.099 | 0.57 |
| Vertical c/d ratio [OD] | −0.065 | 0.71 |
| Vertical c/d ratio [OS] | −0.091 | 0.60 |
| MD [OD] | 0.210 | 0.23 |
| MD [OS] | 0.185 | 0.30 |
| PSD [OD] | −0.135 | 0.43 |
| PSD [OS] | −0.157 | 0.37 |
OPTN/β-globulin column contains correlation coefficients; OD=right eye; OS=left eye; IOP=intraocular pressure; c/d=cup to disk; MD=Humphrey visual field mean deviation; PSD=Humphrey visual field pattern standard deviation.