Literature DB >> 22690114

A novel in vitro three-dimensional retinoblastoma model for evaluating chemotherapeutic drugs.

Moutushy Mitra1, Chandana Mohanty, Anju Harilal, Uma K Maheswari, Sanjeeb Kumar Sahoo, Subramanian Krishnakumar.   

Abstract

PURPOSE: Novel strategies are being applied for creating better in vitro models that simulate in vivo conditions for testing the efficacy of anticancer drugs. In the present study we developed surface-engineered, large and porous, biodegradable, polymeric microparticles as a scaffold for three dimensional (3-D) growth of a Y79 retinoblastoma (RB) cell line. We evaluated the effect of three anticancer drugs in naïve and nanoparticle-loaded forms on a 3-D versus a two-dimensional (2-D) model. We also studied the influence of microparticles on extracellular matrix (ECM) synthesis and whole genome miRNA-gene expression profiling to identify 3D-responsive genes that are implicated in oncogenesis in RB cells.
METHODS: Poly(D,L)-lactide-co-glycolide (PLGA) microparticles were prepared by the solvent evaporation method. RB cell line Y79 was grown alone or with PLGA-gelatin microparticles. Antiproliferative activity, drug diffusion, and cellular uptake were studied by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide, a yellow tetrazole (MTT) assay, fluorescent microscope, and flow cytometry. Extra cellular matrix (ECM) synthesis was observed by collagenase assay and whole genome miRNA-microarray profiling by using an Agilent chip.
RESULTS: With optimized composition of microparticles and cell culture conditions, an eightfold increase from the seeding density was achieved in 5 days of culture. The antiproliferative effect of the drugs in the 3-D model was significantly lower than in the 2-D suspension, which was evident from the 4.5 to 21.8 fold differences in their IC(50) values. Using doxorubicin, the flow cytometry data demonstrated a 4.4 fold lower drug accumulation in the cells grown in the 3-D model at 4 h. The collagen content of the cells grown in the 3-D model was 2.3 fold greater than that of the cells grown in the 2-D model, suggesting greater synthesis of the extracellular matrix in the 3-D model as the extracellular matrix acted as a barrier to drug diffusion. The microarray and miRNA analysis showed changes in several genes and miRNA expression in cells grown in the 3-D model, which could also influence the environment and drug effects.
CONCLUSIONS: Our 3-D retinoblastoma model could be used in developing effective drugs based on a better understanding of the role of chemical, biologic, and physical parameters in the process of drug diffusion through the tumor mass, drug retention, and therapeutic outcome.

Entities:  

Mesh:

Substances:

Year:  2012        PMID: 22690114      PMCID: PMC3369889     

Source DB:  PubMed          Journal:  Mol Vis        ISSN: 1090-0535            Impact factor:   2.367


Introduction

A suitable three dimensional (3-D) culture system provides a more physiologically relevant approach to the analysis of gene function, regulation, and cell phenotype ex vivo [1]. It has previously been shown that engineering the cell culture micro-environment to create growth conditions that more accurately mimic the in vivo behavior of cells is an essential step for improving the predictive accuracy of the drug discovery process [2]. Evidence suggests that modification of cell growth conditions can radically influence the behavior of cells in response to chemical reagents [3]. Many important studies have been done on cell proliferation, differentiation, and function in vitro; however, experience with cells in a flat tissue culture flask is different from the complexities of tissues within the body. In tissues, cells connect to each other as well as to the extracellular matrix (ECM), which is a key regulator of normal homeostasis and tissue phenotype [1]. Receptor complexes on the surface of cells facilitate interactions with their neighbors, with the ECM, and with other exogenous factors to enable cells to interpret the multitude of biochemical and physical cues from the immediate environment. The metastatic potential of tumor cells is believed to be regulated by interactions between the tumor cells and their extracellular environment (i.e., ECM). These interactions can be modified by the accumulation of genetic changes and by the transient alterations in gene expression induced by the local tumor microenvironment [4]. Given this intricate mechanical and biochemical interplay; important biologic properties may be missed if cells are studied within an in vitro culture system [5]. It has also been suggested that many important signals, key regulators, and tissue phenotypes are lost when cells are cultured on substrates such as culture plates [6]. Therefore, developing an in vitro model of a tumor that in many aspects would resemble an actual tumor to obtain a realistic assessment of drug efficacy before their testing in animal models or patients is important [7]. Based on previous reports [7] we hypothesized that the cells grown with poly(D,L)-lactide-co-glycolide (PLGA)–gelatin microparticles behave differently than cells grown without PLGA–gelatin microparticles because of the structural, molecular, and genetic variations in cells grown in two different structural configurations. We selected three model anticancer drugs (doxorubicin, carboplatin, and etoposide), which are currently used in clinical practice for the treatment of retinoblastoma, and drug-loaded nanoparticles to determine the drug efficacy in both models. We studied drug diffusion and cellular uptake to understand the discrepancy in drug efficacy in cells grown with or without PLGA–gelatin microparticles. In addition we studied the influence of microparticles on ECM synthesis and whole genome miRNA-microarray profiling to identify 3-D-responsive genes that have been implicated in oncogenesis, survival, and growth of in vivo tumor.

Methods

Materials

PLGA (copolymer ratio 50:50, molecular weight [MW]=34,000 Da, inherent viscosity=0.41) was purchased from Birmingham polymers, Inc. (Birmingham, AL). Carboplatin, doxorubicin hydrochloride (DOXHCL), etoposide, polyvinyl alcohol (PVA; average MW 30,000–70,000 Da), BSA (fraction V), sucrose, chitosan from crab shells (85% deacetylated), and gelatin were purchased from Sigma-Aldrich (St. Louis, MO). All other chemicals used were of analytical grade obtained from Sigma-Aldrich. Media and fetal bovine serum (FBS) were purchased from Gibco-BRL (Rockville, MD). Y79 cells were cultured in RPMI 1640 medium (Biocolor Ltd, County Antrim, UK). The Sircol Soluble Collagen Assay kit was purchased from Biocolor Ltd. TRIZOL reagent was purchased from Invitrogen (Carlsbad, CA). TURBO DNase was purchased from Ambion (Genetix Biotech Asia Pvt. Ltd., New Delhi, India).

Preparation of different drug-loaded nanoparticles

Carboplatin-loaded nanoparticles

Nanoparticles containing carboplatin (CNPs) were prepared as decribed by Parveen et al. [8]. Briefly, an aqueous solution of 2 ml sodium alginate (0.625 mg/ml) was added dropwise into 8 ml of chitosan solution (0.5 mg/ml dilute solution of HCl, with pH adjusted to approximately 5.5 with 0.1 M NaOH) containing carboplatin (1.25 mg). After overnight stirring of the emulsion, the CNPs were recovered by ultracentrifugation (Sorvall Ultraspeed Centrifuge; Kendro, Asheville, NC) at 30,000× g for 30 min at 4 °C. The nanoparticles were formed as a result of the interaction between negative groups of alginate and positively charged amino groups of chitosan. The pellets were dispersed in double-distilled water and lyophilized (LYPHLOCK 12; Labconco, Kansas City, MO) for 48 h and then stored at 4 °C for further studies.

Etoposide-loaded nanoparticles

Etoposide-loaded nanoparticles (ENP) were formulated by using the single emulsion–solvent evaporation technique. In this method, etoposide (equivalent to 10% weight [w]/w dry weight of polymer) was dissolved in 3 ml organic solvent (chloroform) containing 90 mg of polymer (PLGA) to form a primary emulsion. The emulsion was further emulsified in an aqueous PVA solution (12 ml, 5% w/volume [v]) to form an oil-in-water emulsion. The emulsification was performed using a microtip probe sonicator (VC 505; Vibracell Sonics, Newton, CT) at 39 W of energy for 2 min in an ice bath. The emulsion was stirred using a magnetic stirrer overnight to evaporate the organic solvent. The resultant nanoparticles were ultracentrifuged at 125,000× g for 20 min at 4 °C with twice washing with double-distilled water to remove the excess amount of PVA and unencapsulated etoposide. The obtained particles were resuspended in double-distilled water and lyophilized for 48 h to obtain the powder form and then stored at 4 °C for further use.

Doxorubicin-loaded nanoparticles

Doxorubicine-loaded nanoparticles (DNP) were prepared by using the single emulsion–solvent evaporation technique. In brief, a solution of 100 mg of PLGA polymer and 10 mg of doxorubicin (DOX) in 3 ml of 12.5% (v/v) methanol in chloroform solution was emulsified in 12 ml of 2% w/v aqueous solution of PVA to form an oil-in-water emulsion. The emulsification was performed using a microtip probe sonicator set at 55 W of energy output for 2 min over an ice bath. The emulsion was stirred overnight at room temperature on a magnetic stirring plate to allow evaporation of the organic solvent and formation of DNPs. DNPs were recovered by ultracentrifugation at 125,000× g for 20 min at 4 °C, washed twice with double-distilled water to remove unbound PVA and unencapsulated drug, and then lyophilized for 2 days to obtain the powdered DNPs. The lyophilized DNPs were stored at 4 °C until further use.

Formulation of gelatin microparticles

PLGA microparticles were prepared by the solvent evaporation method with slight modifications [9]. In brief, 800 μl of an aqueous phase (W1) was prepared with BSA (2.5% w/v), sucrose (10% w/v), chitosan (1.25% w/v), gelatin (5% w/ v), and PVA (5% w/v) and emulsified with polymer solution (O; 200 mg PLGA in 4 ml of dichloromethane), using an homogenizer (Biospec Product Inc., Bartlesville, OK) at 80× g to form an oil-in-water primary emulsion. The resultant primary emulsion was added dropwise into a 1% w/v aqueous solution of PVA containing 10% w/v sucrose (W2) under constant magnetic stirring on a stirring plate to form a multiple emulsion (W1/O/W2). The emulsion was stirred overnight on a magnetic stir plate to evaporate the organic solvent. The resultant microparticles were recovered by centrifugation at 15,000× g, washed three times with distilled water, and then lyophilized for 48 h the lyophilized microparticles were stored at 4 °C until further use.

Characterization of different drug-loaded nanoparticles

Mean particle size and size distribution of the different drug-loaded nanoparticles were determined by using a Malvern Zeta-sizer Nano ZS (Malvern Instrument, Malvern, Worcestershire, UK) based on quasi-elastic light scattering. Briefly, approximately 1 mg/ml of different formulations of the nanoparticle solutions were prepared in double-distilled water and sonicated for 30 s in an ice bath. Size measurements were performed in triplicate following the dilution (100 ml diluted to 1 ml) of the NP suspensions in MilliQ water at 25 °C. The Zeta potential was measured in the same instrument at 25 °C using the above protocol. All measurements were performed in triplicate.

Characterization of gelatin microparticles

The shape and surface morphology of gelatin microparticles were characterized by scanning electron microscopy (SEM, Hitachi S-3400N; Hitachi High-Technologies, Krefeld, Germany). The powdered microparticles were attached to a brass stub through double adhesive tape and were gold coated using a sputter gold coater at 20 KV (Hitachi, E-1010, Ion Sputter; Hitachi High-Technologies). The stub was fixed in a sample holder and placed in the vacuum chamber of the SEM (Hitachi S-3400N; Hitachi High-Technologies) and observed under low vacuum. The average particle diameters of microparticles were determined from the SEM picture.

Cell culture and cell seeding for gelatin microparticle composition optimization

Y79 cells RCB1645 were obtained from the RIKEN cell bank (Ibaraki, Japan) and maintained in RPMI-1640 media supplemented with 10% FBS and 1% penicillin streptomycin in T-75 cm2 flasks in an incubator (Thermo Electron Corporation, Asheville, NC) at 37 °C and 5% CO2. Fresh retinoblastoma tumor cells were isolated from RB-enucleated eyeballs (Vision Research Foundation, Sankara Nethralaya, Chennai, India) and cultured as described above. All samples were collected with the approval of the institutional review board at VRF (Vision Research Foundation) and in accordance with the Declaration of Helsinki. Each formulation of PLGA microparticles was weighed (approximately 2 mg/ml) and soaked for 3 h at 37 °C in 70% alcohol. Microparticles were centrifuged to remove alcohol and washed twice with media. Fifty percent FBS was added, and the solution was kept in a CO2 incubator for 3 h. For studying the effects of microparticle composition on cell growth, 1 ml of the microparticle suspension prepared as above was transferred to separate wells of 6-well plates. The medium from each well was aspirated carefully, leaving microparticles in the wells before cell seeding. A 500-μl aliquot of Y79 cell suspension (1×106 cells/ml)/fresh RB cell suspension in RPMI 1640 medium was added directly onto microparticles in each well. After 3 h of incubation at 37 °C in a CO2 incubator, an additional 1.5 ml of medium was added to each well and cells were allowed to grow in the incubator. The medium was changed on alternate days, and cells were counted at 7 days post seeding to determine the effect of microparticle composition on Y79 cell growth. To study the total number of cells grown in gelatin microparticles, the adherence cells from a microparticle clump was recovered after 10 days of post seeding. Cell detachment was done by treating the microparticles with 1 ml of 0.1 M citrate buffer containing 0.1% crystal violet for 1 h at 37 °C. After detachment, the total number of cells grown with a different formulation of microparticles was counted separately using a hemocytometer. Photomicrographs of selected plates with cells attached to microparticles were taken with a phase-contrast inverted microscope fitted with a digital camera. The fluorescent images of Y79/RB cells labeled with CellTracker™ CM-DiI reagent (Molecular probes, Invitrogen, Bangalore, India) grown with the scaffold were captured.

Antiproliferative effects of anticancer drugs and drug-loaded nanoparticles

The antiproliferative effects of drugs, both in the native form and encapsulated inside nanoparticles, were analyzed using the methodology of Horning et al. [7]. For this study the Y79/RB cells were allowed to grow in a 2-D suspension (tissue culture-treated Petri dishes) and a 3-D model (in microparticles). The tissue culture-treated Petri dishes (100 mm×20 mm; #353003; Becton Dickson, Franklin Lakes, NJ) taken for the 2-D study provided more surface area for cells to grow without reaching confluency. For the 3-D model, nontissue culture Petri dishes (100 mm×15 mm; #08–757–13; Fisher Scientific, Mumbai, India) were used; these enabled better cellular attachment and growth onto microparticles compared to the surface of a Petri dish. Cell seeding in the case of the 2-D monolayer was performed the second day post seeding on microparticles at a cell density of 0.5×106 cells/ml. This protocol for cell seeding and growth was optimized to obtain approximately the same cell count in both sets of experiments at the time of drug treatment for a better comparison of drug efficacy. Three model anticancer drugs, i.e., doxorubicin, carboplatin and etoposide, were selected to determine their IC50 values in Y79/RB cells grown on 2-D as well as 3-D models. The chosen drugs are currently being used in the treatment of retinoblastoma and are well known DNA intercalating anticancer agent. For the cell toxicity study the stock solutions of drugs were prepared in DMSO and diluted appropriately in tissue culture medium to obtain the desired concentration [8]. Similarly, equivalent concentrations of drug encapsulated in nanoparticles (doxorubicin and etoposide in PLGA nanoparticles, carboplatin in chitosan nanoparticles) were prepared with RPMI medium. On day 5 of post seeding, media was carefully removed and replaced with 5 ml of media containing different concentrations of drugs and drug-loaded nanoparticles. After 48 h the treated cells (2-D and 3-D culture) were collected and filtered through 35 µm nylon mesh to separate cells from microparticles. The detached cells were stained using 0.4% (w/v) trypan blue in deionized water, and viable cells (unstained) were counted using a hemocytometer.

Collagen assay

Collagen content was assayed using the manufacturer’s protocol. Cells with/without PLGA–gelatin microparticles were suspended in PBS (137 mM NaCl, 2.7 mM KCl, 10 mM sodium phosphate dibasic, 2 mM potassium phosphate monobasic and a pH of 7.4). The preparations were centrifuged at 80× g using an Eppendorf microcentrifuge (5417R; Eppendorf-Netheler-Hinz-GmbH, Hamburg, Germany), and the sediment was treated with 1 ml of 0.5 M acetic acid for 18 h at 4 °C. One milliliter of the dye reagent supplied with the assay kit was added to 100 μl of the acid extract in 1.5 ml Eppendorf tubes and mixed gently for 30 min at room temperature. The collagen-bound dye complex was recovered after centrifugation at 7,800 ×g for 10 min as above. The complex was solubilized in 1 ml of the alkali reagent provided with the assay kit. The absorbance of the samples was measured at 550 nm using a microwell plate reader (Fisher Biotech, Pittsburgh, PA). A standard plot of collagen was prepared under similar conditions. Either microparticles without cells or PBS was used as controls. The amount of collagen present in the native microparticles was deduced from the actual collagen amounts obtained in 2-D and 3-D culture experiments. Therefore the there was no interference of the polymer used in microparticles in the assay.

Recovery of cells from poly(D,L)-lactide-co-glycolide–gelatin microparticles following freezing

To determine whether the cells grown in the 3-D model could be rescued after freezing, microparticles were seeded (seeding density) 0.5×106 cells/mg of microparticles) and cultured as above in noncell culture Petri dishes for 5 days. Cells with PLGA–gelatin microparticles were washed with RPMI-1640 medium, resuspended in 1 ml of cryopreservation media (DMSO, 10%; FBS, 90%), transferred into cryovials, and then frozen in liquid nitrogen. After 24 h of freezing, cells were thawed and the entire content of each cryovial was transferred into Petri dishes and recultured for 48 h in RPMI medium. Cells with PLGA–gelatin microparticles cultured as above for the same time period but not subjected to the freezing step, were used as the control. Cells cultured without PLGA–gelatin microparticles (0.5×106 cells/ml of cryopreservation media) were also frozen and recultured as above. Cell viability for each sample was determined using trypan blue as above. The percentages of cells with or without PLGA–gelatin microparticles rescued were calculated from the cell numbers with and without the freezing step.

Flow cytometry

Doxorubicin was used for this study because of its inherent fluorescent property. Fluorescent intensity as a measure of drug uptake by cells with or without PLGA–gelatin microparticles was determined using a FACSCalibur flow cytometer (Becton Dickson) at 488 nm excitation and a 585/42 filter (564–606 nm) to match the emission spectra of doxorubicin. On day 5 post seeding, media were carefully removed and 5 ml of doxorubicin solution (2,500 ng/ml) was added to each Petri dish and placed at 37 °C for 4 and 8 h each with triplicates. Cells were trypsinized from microparticles and monolayered as described above, centrifuged, and resuspended into a single cell suspension in DPBS + 2% FBS at concentrations of either 2×106 cells/ml or 1×106 cells/ml. The cell suspensions containing microparticles were filtered twice through a 35-μm nylon mesh tube cap into a 12×75 mm round-bottom tube (#352235; Becton Dickson) to remove microparticles from the cell suspension.

Oligonucleotide arrays

Total RNA used for the microarray analysis was isolated from cultured cells using TRIZOL reagent and treated with TURBO DNase to remove the DNA contamination. The RNA samples (10 μg each) in a 50-μl reaction were treated with 1 μl of TURBO DNase (2 U) in 1× TURBO DNase buffer at 37 °C for 30 min. After incubation, the RNA sample was extracted with phenolchloroform to inactivate the TURBO DNase. Agilent's Low RNA Input Linear Amplification Kit PLUS (Agilent Technologies Genotypic, Bangalore, India) was used to generate fluorescent complementary RNA (cRNA). This method uses T7 RNA polymerase, which simultaneously amplifies the target material and incorporates cyanine 3-labeled cytidine tri-phosphate. Qiagen’s RNeasy mini spin columns (Qiagen, New Delhi, India) were used for purification of the amplified cRNA samples, and the samples were then hybridized to the Human Whole Genome 44K Oligo Microarray for 17 h at 65 °C, as recommended by the manufacturer (Agilent Technologies). Data analysis was done using Genespring GX version 10 (Agilent Technologies). Agilent Feature Extraction software (G25677AA; Agilent Technologies) was used to analyze the microarray data. Two biologic replicates were used for gene expression microarray analysis.

MicroRNA isolation and expression analysis

RNA extraction

Total RNA was isolated using TRI-Reagent (Ambion, Austin, TX). RNA concentration and purity were quantified using a Nanodrop (Nanodrop, Santa Clara, CA) spectrophotometer with the nanodrop ribogreen assay, and the quality of the total RNA was determined on an Agilent bioanalyzer (Agilent, Santa Clara, CA).

MicroRNA array hybridization and detection

Two biologic replicate samples were used for the miRNA microarray analysis. Human miRNA V2 8×15k Agilent arrays, which represent 723 human and 76 human viral miRNAs, were used for the miRNA analysis. Total RNA underwent phosphatase treatment. The 3′ end of the dephosphorylated RNA was ligated with one molecule of cyanine 3-cytidine bisphosphate (3-pCp), as this reagent selectively labels and hybridizes mature miRNAs with greater than 30% efficiency. A hybridization cocktail was added to the arrays, and hybridization was performed in the hybridization oven set at 55 °C for 20 h. The microarrays were washed using Agilent wash buffer. Scanning and extraction was performed using Agilent feature extraction software. The study was done in three biologic replicates. Data analysis was done using Genespring GX version 10. Agilent Feature Extraction software (G25677AA) was used to analyze the microarray data. The sum of background-subtracted signals for each repeated miRNA was calculated and log transformed to log base 2. The cut off was greater than 1 (log-transformed value) and less than 1 (log-transformed value).

Real-time quantitative reverse-transcriptase (RT)-PCR

RNA was extracted by the guanidine isothiocyanate and chloroform method (TRI Reagent; Sigma-Aldrich, Bangalore, India). All RNA samples were treated with DNase (Turbo; Ambion, Genetix Biotech Asia Pvt. Ltd). For all samples, 1 μg of total RNA was used to synthesize first-strand cDNA with reverse transcriptase (SuperScript II; Invitrogen, Joyvel, Chennai, India) and random primers. The cDNA synthesis was performed at 37 °C for 60 min after heat inactivation at 95 °C for 10 min. The primer sequences of the selected genes from the microarray are listed in Table 1. PCR was performed using 1× SYBR Green PCR Master Mix (Applied Biosystems, Lab India, Chennai, India) on a real-time PCR system (Prism 7300; Applied Biosystems). Cycling conditions were as follows: 2 min at 50 °C, 10 min at 95 °C, and 40 cycles of 15 s at 95 °C, plus 1 min at 60 °C. Commercial software (SDS ver.2.3; Applied Biosystems) was used to calculate ΔΔCt relative expression values for all the genes studied, normalized to the GAPDH endogenous control.
Table 1

List of Primers used for Real time Quantitative RT–PCR.

Gene namePrimer sequencesTm
ABCC6
FP 5′TTGGATTCGCCCTCATAGTC 3′
65 °C
 
RP 3′GGTAGCTGGCAAGACAAAGC 5′
 
HMGA2
FP 5′GGCCAGCTCATAAAATGGAA 3′
61 °C
 
RP 3′TACTGTTCCATTGGCCACAA 5′
 
MMP9
FP 5′TTGACAGCGACAAGAAGTGG 3′
64 °C
 
RP 3′GCCATTCACGTCGTCCTTAT 5′
 
ABCA3
FP 5′AGGAAAGGAGGCTGAAGGAG 3′
65 °C
 
RP 3′GTGCTGACCATGAAGCTGAA 5′
 
ERBB3
FP 5′GCCAATGAGTTCACCAGGAT 3′
64 °C
 
RP 3′ACGTGGCCGATTAAGTGTTC 5′
 
BCL2
FP 5′GGATGCCTTTGTGGAACTGT 3′
63 °C
 
RP 3′AGCCTGCAGCTTTGTTTCAT 5′
 
MYCN
FP 5′CTTCGGTCCAGCTTTCTCAC 3′
64 °C
 
RP 3′GTCCGAGCGTGTTCAATTTT 5′
 
APAF-1
FP 5′TTCTGATGCTTCGCAAACAC 3′
63 °C
 
RP 3′CTGGCAAATCTGCCTTCTTC 5′
 
CDKN2A
FP 5′ATATGCCTTCCCCCACTACC 3′
67 °C
 
RP 3′CCCCTGAGCTTCCCTAGTTC 5′
 
CDKN1A
FP 5′ATGAAATTCACCCCCTTTCC3′
65 °C
 
RP 3′CCCTAGGCTGTGCTCACTTC5′
 
PDCD2
FP 5′GCATTGCCACCATAAATCCT3′
63 °C
 RP 3′GCAGTTTCCCATATGGTGCT5′ 

Statistical analysis

The statistical analysis included the independent Student t test. Statistical analysis was performed using SPSS version 12.0 software (Chicago, IL). P values less than 0.05 were considered significant.

Results

The size distribution and surface charge of different drug-loaded nanoparticles were measured by dynamic light scattering analysis. This study revealed that ENPs, CNPs, and DNPs have an average diameter of 256 nm, 507 nm, and 249 nm, respectively, as shown in Figure 1 and have an average Zeta potential of −13 mV, –36 mV, and −5.56 mV, respectively.
Figure 1

This figure shows the size distribution of different drug-loaded nanoparticles measured by dynamic light scattering analysis. A: Etoposide loaded nanoparticles (ENPs) showing an average diameter of 256 nm. B: Carboplatin loaded nanoparticles (CNPs) showing an average diameter of 507 nm. C: Doxorubicin loaded nanoparticles (DNPs) showing an average diameter of 249 nm.

This figure shows the size distribution of different drug-loaded nanoparticles measured by dynamic light scattering analysis. A: Etoposide loaded nanoparticles (ENPs) showing an average diameter of 256 nm. B: Carboplatin loaded nanoparticles (CNPs) showing an average diameter of 507 nm. C: Doxorubicin loaded nanoparticles (DNPs) showing an average diameter of 249 nm.

Formulation and characterization of poly(D,L)-lactide-co-glycolide microparticles

In the current study, we prepared a 3-D tumor model with PLGA–gelatin microparticles for in vitro evaluation of different anticancer drugs (native and loaded in nanoparticles). It was previously well documented that gelatin is a suitable candidate for scaffold materials because of its biocompatibility, low immunogenicity, and biodegradability. Gelatin contains ArgGlyAsp (RGD)-like sequences that promote cell adhesion and migration by forming a polyelectrolyte complex. Furthermore, the anionic cell surface provided by the gelatin–chitosan-blended microparticles provide better cell adhesion and cellular bioactivity for proliferating cells. A successful microparticle formulation was achieved with a highly porous matrix to facilitate the infiltration of proliferating cells. As evidenced from the SEM image, the formulated microparticle showed a porous infrastructure with interconnected void structures and had a spherical shape covered with a thin film of polymer (Figure 2). This rough surface could be due to deposition of cationic chitosan on the anionic microparticle surface, which is apparent from the surface characteristics [7]. Similarly, particle size is an important parameter that could affect the degradation of the polymer matrix [10]. To achieve a microparticle of a desired diameter, the conditions for emulsification and formulation composition were optimized. The average diameter of the formulated microparticle in this study ranged from 145 μm to 162 μm.
Figure 2

This figure shows the scanning electron microscope picture of a Poly(D,L-lactide-co-glycolide) (PLGA) scaffold microparticle containing 1.25% chitosan and 5% gelatin (100 mg PLGA, 1.25 mg chitosan, and 5 mg gelatin). Surface morphology of microparticles was characterized by scanning electron microscopy (SEM). The average diameter of formulated microparticle in this study ranged from 145 μm to 162 μm.

This figure shows the scanning electron microscope picture of a Poly(D,L-lactide-co-glycolide) (PLGA) scaffold microparticle containing 1.25% chitosan and 5% gelatin (100 mg PLGA, 1.25 mg chitosan, and 5 mg gelatin). Surface morphology of microparticles was characterized by scanning electron microscopy (SEM). The average diameter of formulated microparticle in this study ranged from 145 μm to 162 μm.

Effect of composition of the scaffold and influence of cell seeding density on Y79 cell growth

We studied the effect of gelatin concentration (used in microparticle composition) on the proliferation of Y79 cells. The Y79 growth kinetic results on the gelatin microparticle demonstrated that the composition of the formulated microparticle facilitated profound Y79 cell proliferation (Figure 3). It was further seen that the microparticles formulated with a higher gelatin content (5% w/v) demonstrated better cell growth than those formulated with a lower gelatin content (3% w/v; Figure 4). Therefore, PLGA microparticles fabricated with 5% gelatin were chosen as a suitable formulation for further studies.
Figure 3

This figure shows the growth kinetics of Y79 cells with different seeding densities (104 to 105 cells) co-cultured with a gelatin scaffold for 20 days. The cells were harvested and counted on 2nd, 5th, 8th, 15th, and 20th day. The Y79 growth kinetics results on gelatin microparticle demonstrated the composition of formulated microparticle facilitated profound Y79 cell proliferation.

Figure 4

This figure shows the growth kinetics of Y79 cells co-cultured with microparticles formulated with different concentrations of gelatin (3% and 5% gelatin). The graph shows increased cell concentrations on 15th and 20th. Day of Y79 cell culture on microparticles coated with 5% gelatin (p<0.01) when compared to that of 3% gelatin coated microparticles 0.01).

This figure shows the growth kinetics of Y79 cells with different seeding densities (104 to 105 cells) co-cultured with a gelatin scaffold for 20 days. The cells were harvested and counted on 2nd, 5th, 8th, 15th, and 20th day. The Y79 growth kinetics results on gelatin microparticle demonstrated the composition of formulated microparticle facilitated profound Y79 cell proliferation. This figure shows the growth kinetics of Y79 cells co-cultured with microparticles formulated with different concentrations of gelatin (3% and 5% gelatin). The graph shows increased cell concentrations on 15th and 20th. Day of Y79 cell culture on microparticles coated with 5% gelatin (p<0.01) when compared to that of 3% gelatin coated microparticles 0.01). The optimized composition of microparticles, which consisted of 5% gelatin and 1.25% chitosan, demonstrated cell growth from an initial seeding cell density of 0.05×106 to a cell density of 0.4×106 cells/mg of microparticles, which is an eightfold increase in cell density after 6 days of culture. Cells attached more to the microparticles rather than to the surface of the nontissue culture Petri dish. Initially, cells were seen attached to the microparticle surface, and with time cells engulfed the microparticles completely, forming a 3-D tumor-like structure (Figure 5A-C phase contrast and Figure 5D fluorescence-labeled Y79 cells). Either a single microparticle or a cluster of two to three microparticles were witnessed to form the 3-D tumor-like structure.
Figure 5

This figure shows the phase contrast and fluorescent microscope images of Y79 cells grown on Poly(D,L-lactide-co-glycolide) (PLGA) scaffold microparticles. A: Phase contrast microscope picture of Gelatin-coated PLGA microparticles under 10× magnification. B: Phase-contrast images showing cells attached to the microparticles (white arrows pointing Y79 cells attached to microparticles) forming a three-dimensional growth over the microparticles under 10× magnification. C: Phase contrast microscopic image of 3-D growth of Y79 cells over scaffold microparticles (black arrow pointing to Y79 cells attaché to microparticles) under 40× magnification. D: Fluorescent microscopic image showing the 3-D growth of Y79 cells (labeled with Celltracker dye) over scaffold microparticle (white arrows pointing Y79 cells attached to microparticle) under 40× magnification.

This figure shows the phase contrast and fluorescent microscope images of Y79 cells grown on Poly(D,L-lactide-co-glycolide) (PLGA) scaffold microparticles. A: Phase contrast microscope picture of Gelatin-coated PLGA microparticles under 10× magnification. B: Phase-contrast images showing cells attached to the microparticles (white arrows pointing Y79 cells attached to microparticles) forming a three-dimensional growth over the microparticles under 10× magnification. C: Phase contrast microscopic image of 3-D growth of Y79 cells over scaffold microparticles (black arrow pointing to Y79 cells attaché to microparticles) under 40× magnification. D: Fluorescent microscopic image showing the 3-D growth of Y79 cells (labeled with Celltracker dye) over scaffold microparticle (white arrows pointing Y79 cells attached to microparticle) under 40× magnification.

Extracellular matrix synthesis and retrieval of cells from a three-dimensional model following freezing

After 5 days of growth, cells in the 3-D model synthesized 59.8±1.2 µg of collagen per 1×106 cells, which was significantly higher than the 25.29±0.7 µg of collagen synthesized for the same number of cells in the 2-D monolayer (p<0.05, n=5). Following the freezing step, cell viability was slightly higher in the 3-D model compared to that in the 2-D monolayer (41% versus 35%; Figure 6).
Figure 6

This figure shows the comparison of post freeze and thaw viability of Y79 cells between Y79 cell culture without microparticles (2-D) and Y79 cells co-cultured with microparticles (3-D). The bar diagram shows the viability of Y79 cultured cells with (3-D) and without (2-D) microparticles retrieved from freezing. The Y79 cells viability was slightly higher in 3-D model compared to that in 2-D monolayer (41% versus 35%). Error bars represent standard deviation obtained from triplicates.

This figure shows the comparison of post freeze and thaw viability of Y79 cells between Y79 cell culture without microparticles (2-D) and Y79 cells co-cultured with microparticles (3-D). The bar diagram shows the viability of Y79 cultured cells with (3-D) and without (2-D) microparticles retrieved from freezing. The Y79 cells viability was slightly higher in 3-D model compared to that in 2-D monolayer (41% versus 35%). Error bars represent standard deviation obtained from triplicates.

Antiproliferative activity of drugs and drug-loaded nanoparticles on Y79 cells grown with or without a scaffold

Cytotoxicity of model anticancer drugs was determined in Y79/RB cells grown with or without PLGA–gelatin microparticles following 48 h of drug treatment. Cell numbers were similar in both models at the time of treatment, and the inhibition in cell growth was calculated according to the respective untreated controls. IC50 values of drugs and drug-loaded nanoparticles were significantly higher in Y79 cells with PLGA–gelatin microparticles than in cells grown without PLGA–gelatin microparticles (Figure 7). The differences in the IC50 values observed were 4.5 to 21.8 fold depending upon the drug and drug-loaded nanoparticles (Table 2). Similarly, we observed significantly higher IC50 values of native drugs in RB tumor cells with PLGA–gelatin microparticles compared to RB cells grown without PLGA–gelatin microparticles (Figure 7G-I). The differences in the IC50 values of native drugs in RB tumor cells observed were 2.4 to 13.4 fold (Table 2).
Figure 7

This figure shows the anti-proliferative effect of drug loaded nanoparticles on Y79 cells cultures in Two-dimensional (2-D) or three dimensional (3-D) patterns. A: Y79 cells co-cultured with microparticles (3-D) shows decreased sensitivity (p<0.001) to native carboplatin when compared to Y79 cells cultured without microparticles (2-D). B: Y79 cells co-cultured with microparticles (3-D) shows decreased sensitivity (p<0.0001) to Carboplatin loaded nanoparticles when compared to Y79 cells cultured without microparticles (2-D). C: Y79 cells co-cultured with microparticles (3-D) shows decreased sensitivity (p<0.001) to native etoposide when compared to Y79 cells cultured without microparticles (2-D). D: Y79 cells co-cultured with microparticles (3-D) shows decreased sensitivity (p<0.001) to etoposide-loaded Np when compared to Y79 cells cultured without microparticles (2-D). E: Y79 cells co-cultured with microparticles (3-D) shows decreased sensitivity (p<0.001) to native doxorubicin when compared to Y79 cells cultured without microparticles (2-D). F: Y79 cells co-cultured with microparticles (3-D) shows decreased sensitivity (p<0.001) to doxorubicin loaded nanoparticles when compared to Y79 cells cultured without microparticles (2-D). G: Fresh retinoblastoma tumor cells co-cultured with microparticles (3-D) shows decreased sensitivity (p<0.001) to native carboplatin when compared to Y79 cells cultured without microparticles (2-D). H: Fresh retinoblastoma tumor cells co-cultured with microparticles (3-D) shows decreased sensitivity (p<0.0001) to native etoposide when compared to Y79 cells cultured without microparticles (2-D). I: Fresh retinoblastoma tumor cells co-cultured with microparticles (3-D) shows decreased sensitivity (p<0.001) to native doxorubicin when compared to Y79 cells cultured without microparticles (2-D). Error bars represent standard deviation obtained from triplicates.

Table 2

Comparison of IC50 values of respective native drugs and drug loaded nanoparticles between Y79 cells co-cultured with microparticles (3-D0 and Y79 cells cultured without microparticles (2-D).

 
IC50
 
Drug2-D3-DFold change
Native doxorubicin
154.8
1202
7.76
Np doxorubicin
9.54
102.3
10.7
Native etoposide
17.66
159.2
9.01
Np etoposide
3.86
17.37
4.5
Native carboplatin
138
1584
11.47
Np carboplatin28.8463021.84
This figure shows the anti-proliferative effect of drug loaded nanoparticles on Y79 cells cultures in Two-dimensional (2-D) or three dimensional (3-D) patterns. A: Y79 cells co-cultured with microparticles (3-D) shows decreased sensitivity (p<0.001) to native carboplatin when compared to Y79 cells cultured without microparticles (2-D). B: Y79 cells co-cultured with microparticles (3-D) shows decreased sensitivity (p<0.0001) to Carboplatin loaded nanoparticles when compared to Y79 cells cultured without microparticles (2-D). C: Y79 cells co-cultured with microparticles (3-D) shows decreased sensitivity (p<0.001) to native etoposide when compared to Y79 cells cultured without microparticles (2-D). D: Y79 cells co-cultured with microparticles (3-D) shows decreased sensitivity (p<0.001) to etoposide-loaded Np when compared to Y79 cells cultured without microparticles (2-D). E: Y79 cells co-cultured with microparticles (3-D) shows decreased sensitivity (p<0.001) to native doxorubicin when compared to Y79 cells cultured without microparticles (2-D). F: Y79 cells co-cultured with microparticles (3-D) shows decreased sensitivity (p<0.001) to doxorubicin loaded nanoparticles when compared to Y79 cells cultured without microparticles (2-D). G: Fresh retinoblastoma tumor cells co-cultured with microparticles (3-D) shows decreased sensitivity (p<0.001) to native carboplatin when compared to Y79 cells cultured without microparticles (2-D). H: Fresh retinoblastoma tumor cells co-cultured with microparticles (3-D) shows decreased sensitivity (p<0.0001) to native etoposide when compared to Y79 cells cultured without microparticles (2-D). I: Fresh retinoblastoma tumor cells co-cultured with microparticles (3-D) shows decreased sensitivity (p<0.001) to native doxorubicin when compared to Y79 cells cultured without microparticles (2-D). Error bars represent standard deviation obtained from triplicates.

Drug uptake by cells with or without poly(D,L)-lactide-co-glycolide-gelatin microparticles

After treatment with doxorubicin (2,500 ng/ml), significantly fewer (p<0.05) cells with PLGA–gelatin microparticles exhibited drug uptake compared to cells grown without microparticles. The difference in fluorescence intensity was 4.4 fold at 4 h (Figure 8A), which increased to 15.9 fold at 24 h (Figure 8B).
Figure 8

This figure shows the uptake of doxorubicin drug by Y79 cells either or not co-cultured with microparticles using flow cytometry. A: The flow cytometry histogram shows decreased uptake of drug by Y79 cells co-cultured with microparticles (3-D) when compared to Y79 cells cultured without microparticles at 4 h. B: Flow cytometry histogram shows decreased uptake of a drug by Y79 cells co-cultured with microparticles (3-D) when compared to Y79 cells cultured without microparticles at 24 h. The x-axis represent fluorescein isothiocyanate (FITC) intensity and the y-axis represents cell counts.

This figure shows the uptake of doxorubicin drug by Y79 cells either or not co-cultured with microparticles using flow cytometry. A: The flow cytometry histogram shows decreased uptake of drug by Y79 cells co-cultured with microparticles (3-D) when compared to Y79 cells cultured without microparticles at 4 h. B: Flow cytometry histogram shows decreased uptake of a drug by Y79 cells co-cultured with microparticles (3-D) when compared to Y79 cells cultured without microparticles at 24 h. The x-axis represent fluorescein isothiocyanate (FITC) intensity and the y-axis represents cell counts.

Microarray analysis

Results of the cDNA microarray revealed changes in the expression of 4,490 genes (overexpression of 2,490 genes; downregulation of 2,000 genes) in cells grown with PLGA–gelatin microparticles compared to those grown without microparticles (Figure 9A). Only genes with p≤0.05 and a log ratio of at least 2.0 for upregulation (≥1 fold) and a log ratio of 0.5 for downregulation (≤0.5 fold), keeping a median log ratio of 1 in both biologic replicates, were considered for expression analysis [11]. The important upregulated (Table 3 and Table 4) and downregulated (Table 5) genes are provided. We classified the altered transcripts based on their biologic roles. The data also identified several candidate genes that are found to be highly overexpressed in retinoblastoma tumors and that keep tumors in a proliferation state, such as Homo sapiens v-myc myelocytomatosis viral-related oncogene (MYCN) [12,13], H. sapiens jun oncogene (Jun) [11], H. sapiens v-erb-b2 (ERBB3) [14], and H. sapiens insulin-like growth factor binding protein 5 (IGFBP5) [15]. We also found enhanced expression of collagen, integrins, fibronectin, and laminin, which crosslink and stiffen the tissue stroma to promote transformation, tumor growth, motility, and invasion and enhance cancer cell survival [16].
Figure 9

This figure represents microarray heat map displaying deregulated genes and microRNAs in Y79 cells either or not co-cultured with microparticles. A: Heat map shows significantly upregulated and down-regulated genes in Y79 cells co-cultured with microparticles (3-D) when compared with Y79 cells cultured without microparticles (2-D). B: Heat map shows significantly upregulated and down-regulated microRNAs in Y79 cells co-cultured with microparticles (3-D) when compared with Y79 cells cultured without microparticles (2-D). Green color represents upregulated genes or microRNAs and red color represents down-regulated genes or microRNAs. Heat map shows gene IDs or microRNA names and their respective expression fold changes in Y79 cells co-cultured with microparticles (3-D) when compared with Y79 cells cultured with microparticles (2-D).

Table 3

Showing the upregulated genes in Y79 cells grown with microparticles compared to cells without microparticles.

Gene IDGene nameChromosome locationFold changesignificant p-value <0.05Category
COL2A1
Homo sapiens collagen, type II, alpha 1 [NM_001844]
chr12
3.9837
0.0007
Extracellular matrix protein
COL1A1
H.sapiens mRNA for prepro-alpha1(I) collagen. [Z74615]
17q21.33
1.1663
0.0026
Extracellular matrix protein
COL1A2
Homo sapiens collagen, type I, alpha 2 (COL1A2), mRNA [NM_000089]
7q21.3
1.5104
0.0496
Extracellular matrix protein
COL13A1
Homo sapiens collagen, type XIII, alpha 1 [NM_005203]
chr10
3.2391
0.0337
Extracellular matrix protein
COL5A3
Homo sapiens collagen, type V, alpha 3 [NM_015719]
chr19
1.6284
0.0145
Extracellular matrix protein
COL16A1
Homo sapiens collagen, type XVI, alpha 1 [NM_001856]
chr1
1.4568
0.0005
Extracellular matrix protein
COL13A1
Homo sapiens collagen, type XIII, alpha 1 [NM_005203]
chr10
1.3769
0.0337
Extracellular matrix protein
COL23A1
Homo sapiens collagen, type XXIII, alpha 1 [NM_173465]
chr5
1.206
0.0033
Extracellular matrix protein
COL18A1
Homo sapiens collagen, type XVIII, alpha 1 [NM_030582]
chr21
1.1288
0.0058
Extracellular matrix protein
ITGB4
Homo sapiens integrin, beta 4 [NM_000213]
chr17
1.6027
0.0008
Extracellular matrix protein
CIB2
Homo sapiens calcium and integrin binding family member 2 [NM_006383]
chr15
1.1749
0.0001
Extracellular matrix protein
ITGA2
Homo sapiens integrin, alpha 2 [NM_002203]
chr5
1.1054
0.0036
Extracellular matrix protein
FNDC4
Homo sapiens fibronectin type III domain containing 4 [NM_022823]
chr2
1.2791
0.005
Extracellular matrix protein
LAMC2
Homo sapiens laminin, gamma 2 [NM_005562]
chr1
1.0315
0
Extracellular matrix protein
MYCN
Homo sapiens v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) [NM_005378]
chr2
1.271
0.0003
oncogene
JUN
Homo sapiens jun oncogene [NM_002228]
chr1
1.108
0.0002
oncogene
BCL2
Human B-cell leukemia/lymphoma 2 (bcl-2) proto-oncogene [M13995]
chr18
1.2855
0.0007
oncogene
ERBB3
Homo sapiens v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) [NM_001982]
chr12
1.03
0.0148
oncogene
MAFA
Homo sapiens v-maf musculoaponeurotic fibrosarcoma oncogene homolog [NM_201589]
chr8
1.3354
0.0009
oncogene
ERG
Homo sapiens v-ets erythroblastosis virus E26 oncogene homolog (avian) [NM_004449]
chr21
1.421
0.0185
oncogene
RAB34
Homo sapiens RAB34, member RAS oncogene family [NM_031934]
chr17
3.3803
0.0001
oncogene
RAB37
Homo sapiens RAB37, member RAS oncogene family [NM_175738]
chr17
2.695
0.0017
oncogene
RAB31
Homo sapiens RAB31, member RAS oncogene family [NM_006868]
chr18
2.2873
0.0051
oncogene
RAB13
Homo sapiens RAB13, member RAS oncogene family [NM_002870]
chr1
1.5812
0.0182
oncogene
RAB26
Homo sapiens RAB26, member RAS oncogene family [NM_014353]
chr16
1.4142
0.0004
oncogene
LCN2
Homo sapiens lipocalin 2 (oncogene 24p3) [NM_005564]
chr9
1.2526
0.0029
oncogene
KRAS
Homo sapiens v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog, mRNA (cDNA clone IMAGE:5301134). [BC029545]
chr12
1.3272
0.0059
oncogene
RAB9B
Homo sapiens RAB9B, member RAS oncogene family, [BC018033]
chrX
1.1607
0.0197
oncogene
RAB32
Homo sapiens RAB32, member RAS oncogene family [NM_006834]
chr6
1.102
0.0124
oncogene
RAB36
Homo sapiens RAB36, member RAS oncogene family [NM_004914]
chr22
1.101
0.0043
oncogene
RAB31
Homo sapiens RAB31, member RAS oncogene family [NM_006868]
chr18
1.0456
0.0051
oncogene
ABCG1
Homo sapiens ATP-binding cassette, sub-family G (WHITE), [NM_207630]
chr21
1.3562
0.0018
ATP binding cassette
ABCG4
Homo sapiens ATP-binding cassette, sub-family G (WHITE), [NM_022169]
chr11
1.2119
0.0006
ATP binding cassette
ABCC4
Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 4 [NM_005845]
chr13
1.0357
0.0104
ATP binding cassette
ABCA3
Homo sapiens ATP-binding cassette, sub-family A (ABC1), [NM_001089]
chr16
1.0245
0.0012
ATP binding cassette
ABCC6
Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), [NM_001079528]
chr16
1.0239
0.0033
ATP binding cassette
IGFBP5
Homo sapiens insulin-like growth factor binding protein 5 (IGFBP5), mRNA [NM_000599]
chr2
1.5048
0.0001
Cell proliferation
MMP17
Homo sapiens matrix metallopeptidase 17 (membrane-inserted) (MMP17), mRNA [NM_016155]
chr12
1.4897
0.0036
invasion
MMP 13     
Table 4

Genes upregulated by more than 0.5 fold but less than 1 fold in Y79 cells grown with microparticles compared with cells grown without microparticles. These genes were considered based on the biologic and statistical significance (p<0.05).

Gene IDGene nameChromosome locationFold changesignificant p-value <0.05category
MCC
Homo sapiens mutated in colorectal cancers (MCC), mRNA [NM_002387]
chr5
0.5848
0.0041
oncogene
HMGA2
Homo sapiens high mobility group AT-hook 2 (HMGA2), transcript variant 1, mRNA [NM_003483]
chr12
0.8396
0.0035
oncogene
MMP9
Homo sapiens matrix metallopeptidase 9 (gelatinase B, 92 kDa gelatinase, 92 kDa type IV collagenase) (MMP9), mRNA [NM_004994]
chr20
0.6921
0.0041
Matrix metallo protease
DDX1Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypeptide 1 (DDX1), mRNA [NM_004939]chr20.69860.0003oncogene
Table 5

Genes down-regulated in Y79 cell grown with microparticles (3-D) compared to those without microparticles (2-D).

Gene nameProtein nameFold changeP valuefunction
APAF-1
Homo sapiens apoptotic peptidase activating factor 1 (APAF1), transcript variant 3, mRNA [NM_181861]
−1.9839
0.0012
Apaf-1, a cell-death effector that acts with cytochrome c and caspase-9 to mediate p53-dependent apoptosis
PIK3R3
Homo sapiens phosphoinositide-3-kinase, regulatory subunit 3 (p55, gamma) (PIK3R3), mRNA [NM_003629]
−1.644
0.0008
Pro-apoptosis.
SFRS1
Homo sapiens splicing factor, arginine/serine-rich 1 (splicing factor 2, alternate splicing factor) (SFRS1), transcript variant 1, mRNA [NM_006924]
−1.0263
0.0001
Pro-cell death
FKBP14
Homo sapiens FK506 binding protein 14, 22 kDa (FKBP14), mRNA [NM_017946]
−0.9243
0.0099
Pro-apoptosis
PPP1R1B
Homo sapiens protein phosphatase 1, regulatory (inhibitor) subunit 1B (dopamine and cAMP regulated phosphoprotein, DARPP-32) (PPP1R1B), transcript variant 1, mRNA [NM_032192]
−1.5266
0.0007
Pro-apoptosis
ANXA5
Homo sapiens annexin A5 (ANXA5), mRNA [NM_001154]
−3.7394
0.0002
Pro- apoptosis
TCF12
Homo sapiens transcription factor 12 (HTF4, helix–loop–helix transcription factors 4) (TCF12), transcript variant 4, mRNA [NM_207038]
−1.0896
0.0028
Pro apoptosis
PDCD2
Homo sapiens programmed cell death 2 (PDCD2), transcript variant 1, mRNA [NM_002598]
−1.3256
0.0011
Pro apoptosis
ACTN4
Homo sapiens actinin, alpha 4 (ACTN4), mRNA [NM_004924]
−1.3227
0
Pro apoptis
MAPK6
Homo sapiens mitogen-activated protein kinase 6 (MAPK6), mRNA [NM_002748]
−1.1824
0.0236
Pro apoptosis
EIF5A2
Homo sapiens eukaryotic translation initiation factor 5A2 (EIF5A2), mRNA [NM_020390]
−1.4533
0.0001
Pro apoptosis
MAP3K13
Homo sapiens mitogen-activated protein kinase kinase kinase 13 (MAP3K13), mRNA [NM_004721]
−1.4791
0.0138
Pro apoptosis
HIST2H2BE
Homo sapiens histone cluster 2, H2be (HIST2H2BE), mRNA
−1.8046
0.001
Pro apoptosis
HIST1H1C
Homo sapiens histone cluster 1, H1c (HIST1H1C), mRNA [NM_005319]
−1.1425
0.0002
Pro apoptosis
PDCD6IP
Homo sapiens programmed cell death 6 interacting protein (PDCD6IP), mRNA [NM_013374]
−1.2727
0.0073
Pro apoptosis
CFL1
Homo sapiens cofilin 1 (non-muscle) (CFL1), mRNA [NM_005507]
−1.1578
0.0068
Pro apoptosis
EIF2AK3
Homo sapiens eukaryotic translation initiation factor 2-alpha kinase 3 (EIF2AK3), mRNA [NM_004836]
−1.502
0.0013
Proapoptosis
BUB3
Homo sapiens mRNA for BUB3 budding uninhibited by benzimidazoles 3 isoform a variant, clone: hg01710. [AK226060]
−1.7701
0.003
Pro apoptosis
ARHGAP21
Homo sapiens Rho GTPase activating protein 21 (ARHGAP21), mRNA [NM_020824]
−1.4986
0.0001
Anti metastasis
KRT17
Homo sapiens keratin 17 (KRT17), mRNA [NM_000422]
−1.5924
0.0057
Anti metastasis
CD46
Homo sapiens CD46 molecule, complement regulatory protein (CD46), transcript variant a, mRNA [NM_002389]
−1.3955
0.0004
Anti metastasis
SERPINH1
Homo sapiens serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1) (SERPINH1), mRNA [NM_001235]
−1.1452
0
Anti-metastasis
BRMS1L
Homo sapiens breast cancer metastasis-suppressor 1-like (BRMS1L), mRNA [NM_032352]
−1.0558
0
Anti-metastasis
PANK3
Homo sapiens pantothenate kinase 3 (PANK3), mRNA [NM_024594]
−0.9712
0.0019
Anti-metastasis
LGALS7
Homo sapiens lectin, galactoside-binding, soluble, 7 (galectin 7) (LGALS7), mRNA [NM_002307]
−1.0622
0.0002
Anti-metastasis
STK4
Homo sapiens serine/threonine kinase 4, mRNA (cDNA clone IMAGE:3950315), complete cds. [BC005231]
−0.9328
0.0002
Tumor supression
PARP9
Homo sapiens poly (ADP-ribose) polymerase family, member 9 (PARP9), mRNA [NM_031458]
−1.4829
0.038
Tumor supression
CDKN1A
Homo sapiens cyclin-dependent kinase inhibitor 1A (p21, Cip1) (CDKN1A), transcript variant
−2.0045
0.0027
Tumor supression
CDKN1C

−4.2038
0.0002
Tumor supression
CDKN2C
Homo sapiens cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) (CDKN2C), transcript variant 1, mRNA [NM_001262]
−2.9462
0
Tumor supression
CDKN2A
Homo sapiens cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) (CDKN2A), transcript variant 3, mRNA [NM_058197]
−2.2861
0.0002
Tumor supression
KREMEN1
Homo sapiens kringle containing transmembrane protein 1 (KREMEN1), transcript variant 1, mRNA [NM_153379]
−1.3621
0.0034
Tumor supression
SASH1
Homo sapiens SAM and SH3 domain containing 1 (SASH1), mRNA [NM_015278]
−4.8233
0
Tumor supression
RRM2Homo sapiens ribonucleotide reductase M2 polypeptide (RRM2), mRNA [NM_001034]−1.3090.0032angiogenesis
This figure represents microarray heat map displaying deregulated genes and microRNAs in Y79 cells either or not co-cultured with microparticles. A: Heat map shows significantly upregulated and down-regulated genes in Y79 cells co-cultured with microparticles (3-D) when compared with Y79 cells cultured without microparticles (2-D). B: Heat map shows significantly upregulated and down-regulated microRNAs in Y79 cells co-cultured with microparticles (3-D) when compared with Y79 cells cultured without microparticles (2-D). Green color represents upregulated genes or microRNAs and red color represents down-regulated genes or microRNAs. Heat map shows gene IDs or microRNA names and their respective expression fold changes in Y79 cells co-cultured with microparticles (3-D) when compared with Y79 cells cultured with microparticles (2-D).

MicroRNA analysis

Results of the microRNA analysis revealed changes in the expression of 52 miRNAs (overexpression of 6 miRNAs; downregulation of 46 miRNAs) in cells grown with PLGA–gelatin microparticles compared to those grown without microparticles (Figure 9B). The important differentially regulated miRNAs are provided in Table 6. We classified the altered miRNAs based on their biologic roles (oncomirs and tumor suppressors). Our data has identified downregulated tumor suppressor miRNAs in cells with PLGA–gelatin microparticles, such as let-7 miRNAs (let-7 family) and miR-34a (which may enhance retinoblastoma tumor proliferation) [17,18] and miR-15a and miR-16, which have been implicated in cell-cycle control and apoptosis [19]. We also identified upregulated miRNAs, such as miR-198, which may play significant roles in regulating retinoblastoma tumor genesis [20]; miR-18a and miR-19b, which are upregulated in various carcinomas and increased expression of this cluster contributes to cancer formation [21]; and miR-106a, which is a potential biomarker in the diagnosis of gastric carcinoma [22].
Table 6

MicroRNAs deregulated in Y79 cells grown with microparticles (3-D compared to cells without microparticles (2-D).

miRNAFold changeFunctionp-value
miR-15a
−1.0695
TS
0.0294
miR-16–1
−1.5218
TS
0.0429
miR-143
−1.5218
TS
0.0429
miR-145
−0.9849
TS
0.0168
hsa-let-7a
−1.5014
TS
0.0231
hsa-let-7a*
−1.0175
TS
0.0010
hsa-let-7b
−1.4151
TS
0.0134
hsa-let-7c
−1.2288
TS
0.0346
hsa-let-7c*
−1.2534
TS
0.0429
hsa-let-7d
−1.3859
TS
0.0132
hsa-let-7e
−1.0035
TS
0.0480
hsa-let-7e*
−1.2534
TS
0.0429
hsa-let-7f
−1.4460
TS
0.0229
hsa-let-7f-1*
−0.9678
TS
0.0054
hsa-let-7f-2*
−1.2534
TS
0.0429
hsa-let-7g
−1.0258
TS
0.0152
hsa-let-7g*
−1.2534
TS
0.0429
hsa-let-7i*
−1.2534
TS
0.0429
hsa-miR-125b
−1.2534
TS
0.0429
hsa-miR-221
−1.5218
TS
0.0429
hsa-miR-19b
1.0548
OG
0.0386
hsa-miR-106a
1.0828
OG
0.0011
hsa-miR-18a
1.0100
OG
0.0053
hsa-miR-34a
−1.4787
TS
0.0159
hsa-miR-34b
−1.5218
TS
0.0429
hsa-miR-34c-5p
1.0000
OG
0.0483
hsa-miR-483–5p1.1500OG0.0317

TS: tumor suppressor, OG: oncogene.

TS: tumor suppressor, OG: oncogene.

Real-time quantitative RT–PCR

Seven upregulated genes-erythroblastic leukemia viral oncogene homolog 3(ERBB-3), B-cell leukemia/lymphoma 2 (BCL-2), v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (MYCN), ATP-binding cassette, sub-family C-member 6 (ABCC6), High mobility group AT-hook 2 (HMGA-2), Matrix metallopeptidase 9 (MMP-9), ATP-binding cassette, sub-family A-member 3 (ABCA-3) and four down-regulated genes- Cyclin-dependent kinase inhibitor 2A (CDKN-2), Cyclin-dependent kinase inhibitor 1A (CDKN-1A), Programmed cell death 2 (PDCD-2) and apoptotic peptidase activating factor 1 (APAF-1)-from the microarray data have been confirmed by real-time quantitative RT–PCR. The results are consistent with the microarray data. The fold changes of all the genes studied was only slightly higher when measured using quantitative RT–PCR compared to the microarray fold changes, reflecting the better dynamic range of quantitative RT–PCR (Figure 10).
Figure 10

This figure shows the real time quantitative PCR validation of selected genes from microarray results. A: Graph shows real time quantitative PCR analysis showing upregulated genes (dark bars) in Y79 cells co-cultured with microparticles (3-D) when compared with Y79 cells cultured without microparticles (2-D). The fold change of respective genes in microarray was also displayed (gray bars) for comparison. The genes that were upregulated in microarray analysis were also found to be upregulated in quantitative real time PCR analysis. B: Graph shows real time quantitative PCR analysis showing down-regulated genes (dark bars) in Y79 cells co-cultured with microparticles (3-D) when compared with Y79 cells cultured without microparticles (2-D). The fold change of respective genes in microarray was also displayed (gray bars) for comparison. The genes that were down-regulated in microarray analysis were also found to be down-regulated in quantitative real time PCR analysis. The error bars represent the data in triplicates.

This figure shows the real time quantitative PCR validation of selected genes from microarray results. A: Graph shows real time quantitative PCR analysis showing upregulated genes (dark bars) in Y79 cells co-cultured with microparticles (3-D) when compared with Y79 cells cultured without microparticles (2-D). The fold change of respective genes in microarray was also displayed (gray bars) for comparison. The genes that were upregulated in microarray analysis were also found to be upregulated in quantitative real time PCR analysis. B: Graph shows real time quantitative PCR analysis showing down-regulated genes (dark bars) in Y79 cells co-cultured with microparticles (3-D) when compared with Y79 cells cultured without microparticles (2-D). The fold change of respective genes in microarray was also displayed (gray bars) for comparison. The genes that were down-regulated in microarray analysis were also found to be down-regulated in quantitative real time PCR analysis. The error bars represent the data in triplicates.

Discussion

Owing to excellent biocompatibility and high mechanical strength, the biodegradable polyester PLGA has been frequently used (as biomaterial) for drug delivery systems as well as for tissue engineering applications. However, due to its hydrophobic properties it is difficult to wet the microparticles (constituent of PLGA) in cell culture medium and hence this limits the adhesion of proliferating cells [7,23]. To circumvent this problem, our formulated microparticles were coated with a hydrophilic polymer of natural origin, i.e., gelatin. Further, with a view to promoting better cell adhesion, we incorporated PVA in the internal phase of the primary emulsion. Here, the amphiphilic PVA could anchor at the interface of the microparticle with its hydrophobic portion embedded in the PLGA matrix structure and its hydrophilic portion available for hydration in the cell culture media [7,24]. Furthermore, the anchored PVA can provide functional OH groups, which have been reported as being helpful in cell attachment [25]. Beside PVA, another polymerchitosan—was incorporated in the internal matrix structure for better cell growth of cultured cells in our formulated microparticles. Here, chitosan can support cell attachment owing to its chemical structure resembling glycosaminoglycans, which is abundant in extracellular matrix components [26]. Similarly, sucrose was added (in the internal phase of the primary emulsion sucrose) to increase the surface tension of water [27]. Formation of larger water droplets upon leaching out can generate more porous microparticles, which in turn provided more surface area to promote cell adhesion, proliferation, and growth, as found in our study. Tumor progression ensues within a 3-D microenvironment, and the metastatic potential of tumor cells is believed to be regulated by interactions between the tumor cells and their extracellular environment (i.e., ECM). These interactions can be modified by the accumulation of genetic changes and by the transient alterations in gene expression induced by the local tumor microenvironment, which consists of cellular and noncellular components. Noncellular aspects of the tumor microenvironment, such as ECM, have been shown to influence tumor progression either directly by destabilizing tissue integrity and promoting tumor cell motility, invasion, and survival [28] or indirectly by inducing tumor angiogenesis and enhancing tumor cell survival and selection [29,30]. 3-D tumor models using different substrates, such as Matrigel [31], laminin-rich extracellular matrix [1], irradiated HeLa cells [32], or teflon membrane [33,34], have been developed to study the various aspects of, for example, tumor biology, phenotypic alterations, and invasive and migratory behavior of cells. Y79 cells when grown on porous microparticles tend to synthesize extracellular matrix proteins, such as collagens (including type I and III) and fibronectin, which together contribute to the mechanical strength of the tissue. Collagenase assay analysis also showed significantly higher collagen synthesis by Y79 cells grown on microparticles. It is known that in tumor masses not all cancer cells are exposed to the same concentration of drugs because of poor drug diffusion through the extracellular matrix of the tumor [35]; this causes the tumor to relapse or develop drug resistance [8]. Our study also demonstrated significantly slow diffusion and heterogeneous distribution of drugs and drugs encapsulated in nanoparticles in the cells grown on PLGA–gelatin microparticles compared to cells grown without. The important application of our study will be to predict the efficacy of drugs in vivo. Our study also reports significant genomic variations in the cells when grown with porous microparticles. Enhanced expression of the collagen family members laminin and fibronectin were observed in our study, which strongly supports our initial findings. In response to collagen synthesis, we observed increased expression of matrix metalloproteinases (MMPs), such as MMP-13 [36] and MMP-9 [37,38], the latter facilitates the tumor cells to invade the extracellular matrix. Several candidate genes, such as MYCN, ERBB3, JUN, and IGFBP5, were also significantly upregulated, which keeps the tumor in a proliferative state [11-15]. Changes in the upregulation of genes were coupled with downregulation of a few genes that function as tumor suppressor/apoptotic inducers. Homo sapiens APAF-1, transcript variant 3, mRNA (Apaf-1) is a central component of the intrinsic pathway of apoptosis and is important for cellular responses to DNA damage [39]. When DNA is damaged by chemotherapeutic agents, oncogenic stimuli, ultraviolet and ionizing radiation, and hypoxia, cytochrome c is released from the mitochondria, binds to Apaf-1 in the cytosol, and in association with dATP/ATP facilitates a conformational change of Apaf-1 to expose its CARD domain [40]. It has been shown that inactivation of Apaf-1 substantially reduces the number of cells required to form tumors in nude mice transplanted with Myc/Ras-transformed fibroblasts, implying that Apaf-1 actually acts as a tumor suppressor [41]. Homo sapiens cyclin-dependent kinase inhibitor 2A (CDKN2A; melanoma, p16, inhibits CDK4), a major CDK inhibitor, is the product of a tumor-suppressor gene that has been found inactivated in different cancer types. CDK inhibitor p21 (CDKN1A) is induced by both p53-dependent and p53-independent mechanisms following stress, and induction of p21 may cause cell-cycle arrest; as a proliferation inhibitor, p21 is poised to play an important role in preventing tumor development [42]. This notion is supported by data indicating that p21 null mice are more prone to spontaneous and induced tumorigenesis and that p21 synergizes with other tumor suppressors to protect against tumor progression in mice. Homo sapiens programmed cell death 2 (PDCD2), transcript variant 1, mRNA promotes apoptosis in several human lymphomas. Repression of PDCD2 expression by BCL6, which in turn leads to downregulation of apoptosis, is one mechanism involved in BCL6-associated lymphomatous transformation [43]. MicroRNAs are short (20–23 nucleotides in length) noncoding RNAs that mediate coordinated cellular programs by posttranscriptional mRNA silencing and protein translation inhibition [44]. A growing number of miRNAs have been implicated in promoting or suppressing tumorigenesis in a variety of tissues [45,46], suggesting that they may play a role as a novel class of oncogenes or tumor suppressor genes. Our study revealed alterations in miRNA expression when a Y79 cell line is grown with microparticles. We observed enhanced expression of oncogenic microRNAs, such as miR-18a, miR-19b [47], miR-106a [22], and miR-198 [20], which subsequently promote proliferation, inhibit apoptosis, and promote tumor angiogenesis. There was also decreased expression in miRNAs, such as let-7 family [48], miR 15a and miR16–1 [49], and miR 34a [50] which act as tumor suppressors in various carcinomas, including retinoblastoma. Let-7 downregulates oncogenes, such as Ras, Myc, and HMGA2, and inhibits proliferation and tumorigenesis when ectopically expressed [51]. In this study, we fabricated porous microparticles with a composite interface containing PLGA and chitosan, which causes cancer cells to develop into a tumor-like structure in vitro. The drug efficacy was significantly lower in cells grown with microparticles than in cells grown without microparticles, suggesting a role of cellular architecture on drug uptake, distribution, and efficacy. Our tumor model could potentially be applicable in developing effective drugs based on a better understanding of the role of chemical, biologic, and physical parameters in the process of drug diffusion through the tumor mass, drug retention, and therapeutic outcome. A correlation between the drug effects seen in the tumor model to the in vivo efficacy would further establish the usefulness of our model in drug discovery. In conclusion, we developed a novel, retinoblastoma, in vitro, 3-D model that could be used for evaluating chemotherapeutic drugs in the future.
  49 in total

1.  Measurement of extravascular drug diffusion in multicellular layers.

Authors:  W R Wilson; K O Hicks
Journal:  Br J Cancer       Date:  1999-03       Impact factor: 7.640

2.  Tumor-associated retinal astrocytes promote retinoblastoma cell proliferation through production of IGFBP-5.

Authors:  Xiaoliang L Xu; Thomas C Lee; Nneka Offor; Christine Cheng; Aihong Liu; Yuqiang Fang; Suresh C Jhanwar; David H Abramson; David Cobrinik
Journal:  Am J Pathol       Date:  2010-05-27       Impact factor: 4.307

Review 3.  The role of the cyclin-dependent kinase inhibitor p21 in apoptosis.

Authors:  Andrei L Gartel; Angela L Tyner
Journal:  Mol Cancer Ther       Date:  2002-06       Impact factor: 6.261

4.  Lysyl oxidase is essential for hypoxia-induced metastasis.

Authors:  Janine T Erler; Kevin L Bennewith; Monica Nicolau; Nadja Dornhöfer; Christina Kong; Quynh-Thu Le; Jen-Tsan Ashley Chi; Stefanie S Jeffrey; Amato J Giaccia
Journal:  Nature       Date:  2006-04-27       Impact factor: 49.962

5.  Biocompatibility of Poly(epsilon-caprolactone) scaffold modified by chitosan--the fibroblasts proliferation in vitro.

Authors:  Na Mei; Guang Chen; Ping Zhou; Xin Chen; Zheng-Zhong Shao; Luan-Feng Pan; Chun-Gen Wu
Journal:  J Biomater Appl       Date:  2005-04       Impact factor: 2.646

6.  Correlation of overexpression of HMGA1 and HMGA2 with poor tumor differentiation, invasion, and proliferation associated with let-7 down-regulation in retinoblastomas.

Authors:  Guoying Mu; Han Liu; Fang Zhou; Xiaoyi Xu; Hua Jiang; Yan Wang; Yi Qu
Journal:  Hum Pathol       Date:  2009-12-11       Impact factor: 3.466

7.  Differential microRNA-34a expression and tumor suppressor function in retinoblastoma cells.

Authors:  Clifton L Dalgard; Marco Gonzalez; Jennifer E deNiro; Joan M O'Brien
Journal:  Invest Ophthalmol Vis Sci       Date:  2009-05-14       Impact factor: 4.799

8.  The stabilization of proteins by sucrose.

Authors:  J C Lee; S N Timasheff
Journal:  J Biol Chem       Date:  1981-07-25       Impact factor: 5.157

9.  Gelatinase expression in retinoblastoma: modulation of LH(BETA)T(AG) retinal tumor development by anecortave acetate.

Authors:  M Livia Bajenaru; Yolanda Piña; Timothy G Murray; Colleen M Cebulla; William Feuer; Maria-Elena Jockovich; Maria-Encarna Marin Castaño
Journal:  Invest Ophthalmol Vis Sci       Date:  2010-01-27       Impact factor: 4.799

10.  Tumor-derived matrix metalloproteinase-13 (MMP-13) correlates with poor prognoses of invasive breast cancer.

Authors:  Bin Zhang; Xuchen Cao; Yanxue Liu; Wenfeng Cao; Fei Zhang; Shiwu Zhang; Hongtao Li; Liansheng Ning; Li Fu; Yun Niu; Ruifang Niu; Baocun Sun; Xishan Hao
Journal:  BMC Cancer       Date:  2008-03-28       Impact factor: 4.430

View more
  11 in total

Review 1.  Consistent Inclusion of Mesenchymal Stem Cells into In Vitro Tumor Models.

Authors:  Luís P Ferreira; Vítor M Gaspar; João F Mano
Journal:  Methods Mol Biol       Date:  2021

Review 2.  Expression profiles and prognostic value of miRNAs in retinoblastoma.

Authors:  Lara Elis Alberici Delsin; Karina Bezerra Salomao; Julia Alejandra Pezuk; Maria Sol Brassesco
Journal:  J Cancer Res Clin Oncol       Date:  2018-10-22       Impact factor: 4.553

Review 3.  3D tissue-engineered model of Ewing's sarcoma.

Authors:  Salah-Eddine Lamhamedi-Cherradi; Marco Santoro; Vandhana Ramammoorthy; Brian A Menegaz; Geoffrey Bartholomeusz; Lakesla R Iles; Hesham M Amin; J Andrew Livingston; Antonios G Mikos; Joseph A Ludwig
Journal:  Adv Drug Deliv Rev       Date:  2014-08-07       Impact factor: 15.470

Review 4.  Nanoparticle characterization: state of the art, challenges, and emerging technologies.

Authors:  Eun Jung Cho; Hillary Holback; Karen C Liu; Sara A Abouelmagd; Joonyoung Park; Yoon Yeo
Journal:  Mol Pharm       Date:  2013-03-21       Impact factor: 4.939

Review 5.  A microphysiological system model of therapy for liver micrometastases.

Authors:  Amanda M Clark; Sarah E Wheeler; Donald P Taylor; Venkateswaran C Pillai; Carissa L Young; Rachelle Prantil-Baun; Transon Nguyen; Donna B Stolz; Jeffrey T Borenstein; Douglas A Lauffenburger; Raman Venkataramanan; Linda G Griffith; Alan Wells
Journal:  Exp Biol Med (Maywood)       Date:  2014-05-12

6.  Novel Phenotypic Fluorescent Three-Dimensional Platforms for High-throughput Drug Screening and Personalized Chemotherapy.

Authors:  Changge Fang; Ingalill Avis; David Salomon; Frank Cuttitta
Journal:  J Cancer       Date:  2013-06-26       Impact factor: 4.207

7.  Novel Phenotypic Fluorescent Three-Dimensional Co-Culture Platforms for Recapitulating Tumor in vivo Progression and for Personalized Therapy.

Authors:  Changge Fang; Yan-Gao Man; Frank Cuttitta; William Stetler-Stevenson; David Salomon; Andrew Mazar; Piotr Kulesza; Steve Rosen; Itzhak Avital; Alexander Stojadinovic; Anahid Jewett; Bin Jiang; James Mulshine
Journal:  J Cancer       Date:  2013-12-01       Impact factor: 4.207

8.  Development of Useful Biomaterial for Bone Tissue Engineering by Incorporating Nano-Copper-Zinc Alloy (nCuZn) in Chitosan/Gelatin/Nano-Hydroxyapatite (Ch/G/nHAp) Scaffold.

Authors:  Juan Carlos Forero; Eduardo Roa; Juan G Reyes; Cristian Acevedo; Nelson Osses
Journal:  Materials (Basel)       Date:  2017-10-17       Impact factor: 3.623

Review 9.  Applications of Non-Coding RNAs in Patients With Retinoblastoma.

Authors:  Daniel Fernandez-Diaz; Cristina Rodriguez-Vidal; Paula Silva-Rodríguez; Laura Paniagua; María José Blanco-Teijeiro; María Pardo; Antonio Piñeiro; Manuel Bande
Journal:  Front Genet       Date:  2022-03-31       Impact factor: 4.599

10.  AlgiMatrix™ based 3D cell culture system as an in-vitro tumor model for anticancer studies.

Authors:  Chandraiah Godugu; Apurva R Patel; Utkarsh Desai; Terrick Andey; Alexandria Sams; Mandip Singh
Journal:  PLoS One       Date:  2013-01-18       Impact factor: 3.240

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.