| Literature DB >> 22649657 |
Capital Em Cyrillic М Ulyashova1, Yu I Khalilova, Capital Em Cyrillic Yu Rubtsova, Capital Em Cyrillic V Edelstein, I А Alexandrova, Capital A Cyrillic М Egorov.
Abstract
This work is a report on the development of a method of hybridization analysis on DNA microarrays for the simultaneous identification and typing of carbapenemase-encoding genes. These enzymes are produced by the microorganisms that are responsible for causing infectious diseases. The method involves several steps, including DNA extraction from clinical samples and amplification of carbapenemase genes by multiplex PCR with simultaneous labelling by biotin. Following that, hybridization of the labeled PCR products with oligonucleotide probes immobilized on the surface of a nitrocellulose-based DNA microarray occurs. The biotin molecules attached to the DNA duplexes are detected by using conjugates of streptavidin-horseradish peroxidase, which is then quantified by colorimetric detection of the enzyme. We have designed the required oligonucleotide probes and optimized the conditions of the membrane microarray-based hybridization analysis. Our method allows to identify 7 types of carbapenemase genes belonging to the molecular classes A, B, and D, and it also allows additional typing into genetic subgroups. The microarrays have been tested with the control strains producing the carbapenemase genes which have been characterized by sequencing. The developed method of hybridization analysis was employed to investigate clinical strains ofPseudomonasspp. andAcinetobacterspp., which produce carbapenemases of different classes based on phenotypic testing. All strains ofAcinetobacter baumaniiresistant to carbapenems were producers of two carbapenemase OXA-type genes (OXA-51, in combination with OXA-23 (1 strain), OXA-40 (5 strains), or OXA-58 (4 strains)). The metallo-β-lactamase VIM-2 type gene was detected in allPseudomonas aeruginosastrains resistant to carbapenems. Testing of carbapenem-sensitive strains did not detect any carbapenemase genes. The microarray method for the identification of carbapenemase genes is very accurate and highly productive. It can be employed in clinical microbiological laboratories for the identification and study of carbapenemase epidemiology.Entities:
Keywords: DNA microarrays; antibiotic resistance; carbapenemases; colorimetric detection; horseradish peroxidase
Year: 2010 PMID: 22649657 PMCID: PMC3347561
Source DB: PubMed Journal: Acta Naturae ISSN: 2075-8251 Impact factor: 1.845
Fig. 1Chemical structure of carbapenemes. β-Lactam ring in dashed lines.
Fig. 2Classification of carbapenemases into groups and subgroups based on the alignment of amino acid sequences and their correspondence to molecular classes of β-lactamases.
Sequences of the specific and control oligonucleotide probes
| Name | Nucleotide sequence, 5’>3’ | Length, nucleotides | G/C, % | Тm °С |
| Control oligonucleotides | ||||
| Immobilization control | TCTAGACAGCCACTCATA-Biotin | 18 | 44.4 | 60.4 |
| Positive hybridization control | GATTGGACGAGTCAGGAGC | 19 | 57.9 | 66.1 |
| Negative hybridization control | TCTAGACAGCCACTCATA | 18 | 44.4 | 60.4 |
| Oligonucleotide probes for determining the carbapenemase group | ||||
| KPC_direct | GCTTCCCACTGTGCAGCTCATTC | 23 | 56.5 | 72.0 |
| KPC_reverse | GAATGAGCTGCACAGTGGGAAGC | 23 | 56.5 | 72.0 |
| VIM_direct | GGAGATTGAAAAGCAAATTGGACT | 24 | 37.5 | 66.6 |
| VIM_reverse | AGTCCAATTTGCTTTTCAATCTCC | 24 | 37.5 | 66.6 |
| IMP_direct | GGAATAGAGTGGCTTAATTCTCG/A | 23 | 41.3 | 64.7 |
| IMP_reverse | C/TGAGAATTAAGCCACTCTATTCC | 23 | 41.3 | 64.7 |
| SPM_direct | GATGGGACCGTTGTCATTG | 19 | 52.6 | 64.9 |
| SPM_reverse | CAATGACAACGGTCCCATC | 19 | 52.6 | 64.9 |
| SIM_direct | CCTTGGCAATCTAAGTGACGCAA | 23 | 47.8 | 69.7 |
| SIM_reverse | TTGCGTCACTTAGATTGCCAAGG | 23 | 47.8 | 69.7 |
| GIM_direct | CACACTGGGAAATGGGCTTATA | 22 | 45.5 | 66.7 |
| GIM_reverse | TATAAGCCCATTTCCCAGTGTG | 22 | 45.5 | 66.7 |
| OXA_direct | CCACAA/GGTG/AGGC/TTGGTTG/AAC | 20 | 55.0 | 67.0 |
| OXA_reverse | GTC/AAACCAG/ACCC/TACT/CTGTGG | 20 | 55.0 | 67.0 |
| Oligonucleotide probes for determining the carbapenemase sub-group | ||||
| VIM-1_568 | TCAGCGAACGTGCTATACGG | 20 | 55.0 | 68.3 |
| VIM-1_590 | GTTGTGCCGTTCATGAGTTGT | 21 | 47.6 | 67.9 |
| VIM-2_568 | TCTGCGAGTGTGCTCTATGG | 20 | 55.0 | 67.9 |
| VIM-2_590 | GTTGTGCGATTTATGAGTTGT | 21 | 38.1 | 63.7 |
| VIM-7_127 | GTTCGGCTGTACAAGATTGGCG | 22 | 54.5 | 70.0 |
| VIM-7_181 | CTCGGTGACACGGTGTAC | 18 | 61.1 | 65.8 |
| IMP-1_135 | GTGGGGCGTTGTTCCTAAACATG | 23 | 52.2 | 70.2 |
| IMP-1_387 | GGTTCAAGCCACAAATTCATTTAGC | 25 | 40.0 | 67.8 |
| IMP-2_264 | TCAAAGGCACTATTTCCTCACATTTC | 26 | 38.5 | 68.2 |
| IMP-2_497 | TACCTGAAAAGAAAATTTTATTCGGTG | 27 | 29.6 | 65.7 |
| IMP-5_506 | AATAGAGTTTTGTTCGGTGGTT | 22 | 36.4 | 65.0 |
| IMP-5_459 | TGGTCCAGGGCACACTCC | 18 | 66.7 | 70.4 |
| IMP-11_570 | TGTTGAAGCATGGCCACATT | 20 | 45.0 | 67.6 |
| IMP-11_621 | TGCAAAACTGGTTGTTCCAAGCC | 23 | 47.8 | 70.9 |
| IMP-12_226 | AAATTAGTTGCTTGGTTTGTAGGG | 24 | 37.5 | 66.4 |
| IMP-12_495 | GCTACCTGAAAACAAAATTTTATTCG | 26 | 30.8 | 64.8 |
| IMP-14_292 | GGTGACAGTACGGCTGGAATAG | 22 | 54.5 | 68.4 |
| IMP-14_374 | AAAAAGACAATAAGGTACAAGCTA | 24 | 29.2 | 63.4 |
| OXA-23_225 | AAATACAGAATATGTGCCAGCCTCT | 25 | 40.0 | 68.8 |
| OXA-23_309 | GAAGGGCGAGAAAAGGTCATTTAC | 24 | 45.8 | 68.0 |
| OXA-40_225 | AAATAAAGAATATGTCCCTGCATCA | 25 | 32.0 | 65.6 |
| OXA-40_329 | GAACTTATCCTATGTGGGAGAAAG | 24 | 41.7 | 64.8 |
| OXA-51_225 | TTCGACCGAGTATGTACCTGCTTCG | 25 | 52.0 | 71.7 |
| OXA-51_578 | GCCCAAAAGTCCAAGATGAAG | 21 | 47.6 | 65.8 |
| OXA-58_225 | AAAAACAGCTTATATTCCTGCATCT | 25 | 32.0 | 66.0 |
| OXA-58_206 | GCACGCATTTAGACCGAGC | 19 | 57.9 | 67.7 |
Primer sequences for the multiplex PCR-amplification of carbapenemase genes
| Type | Sequence 5’→3’ | Length, nucleotide | G/C, % | Тm, °С | Length of PCR-product, bp | |
| KPC | direct | TTCTGCTGTCTTGTCTCTCATGG | 23 | 47.8 | 64.7 | 801 |
| reverse | CCTCGCTGTGCTTGTCATCC | 20 | 60.0 | 65.7 | ||
| IMP-1 | direct | GGCGTTTATGTTCATACTTCGTTTG | 25 | 40.0 | 64.4 | 584 |
| reverse | GTAAGTTTCAAGAGTGATGCGTCTCC | 26 | 46.2 | 65.6 | ||
| IMP-2 | direct | GGTGTTTATGTTCATACATCGTTCG | 25 | 40.0 | 63.8 | 584 |
| reverse | GTACGTTTCAAGAGTGATGCGTCCCC | 26 | 53.8 | 67.8 | ||
| IMP-5 | direct | GGTGTTTATGTTCATACTTCGTTTG | 25 | 36.0 | 62.5 | 584 |
| reverse | GTACGTTTCAAGAGTGATACATCTCC | 26 | 42.3 | 63.4 | ||
| IMP-11 | direct | GGTGTTTATGTTCATACATCGTTTG | 25 | 36.0 | 62.6 | 584 |
| reverse | GTAAGCTTCAAGAGCGACGCATCTCC | 26 | 53.8 | 67.8 | ||
| IMP-12 | direct | GGTGTTTATCTTCATACATCTTTTG | 25 | 32.0 | 60.5 | 584 |
| reverse | GTAAGTTTCAAGAGTGATGCGTTCCC | 26 | 46.2 | 66.0 | ||
| VIM-1 | direct | GTAGTTTATTGGTCTACATGACCGCGTC | 28 | 46.4 | 66.9 | 743 |
| reverse | CGCTGTGTGCTGGAGCAAGTC | 21 | 61.9 | 68.1 | ||
| VIM-2 | direct | GTAAGTTATTGGTCTATTTGACCGCGTC | 28 | 42.9 | 65.9 | 743 |
| reverse | CGTTGTGTGCTTGAGCAAGTC | 21 | 52.4 | 64.7 | ||
| VIM-7 | direct | AGCATATTCCGCACAGCCTGG | 21 | 57.1 | 67.5 | 685 |
| reverse | CCGGGCGGTCTGGAATTGCTC | 21 | 66.7 | 67.7 | ||
| SPM | direct | CGTTTTGTTTGTTGCTCGTTGCGGG | 25 | 52.0 | 67.4 | 648 |
| reverse | CCTTCACATTGGCATCTCCCAGATAAC | 27 | 48.1 | 67.2 | ||
| SIM | direct | GTTTGCGGAAGAAGCCCAGCC | 21 | 61.9 | 68.6 | 613 |
| reverse | CTCCGATTTCACTGTGGCTTGGG | 23 | 56.5 | 67.6 | ||
| GIM | direct | CTTGTAGCGTTGCCAGCTTTAGCTC | 25 | 52.0 | 67.8 | 638 |
| reverse | CTGAACTTCCAACTTTGCCATGCC | 24 | 50.0 | 66.9 | ||
| OXA-23 | direct | GAAACCCCGAGTCAGATTGTTCAAG | 25 | 48.0 | 65.8 | 686 |
| reverse | GGCATTTCTGACCGCATTTCC | 21 | 52.4 | 64.8 | ||
| OXA-40 | direct | GTTTCTCTCAGTGCATGTTCATC | 23 | 43.5 | 62.3 | 714 |
| reverse | CATTTCTAAGTTGAGCGAAAAGGGG | 25 | 44.0 | 64.6 | ||
| OXA-51 | direct | CGAAGCACACACTACGGGTG | 20 | 60.0 | 65.4 | 649 |
| reverse | CTCTTTTCGAACAGAGCTAGGTATTC | 26 | 42.3 | 63.4 | ||
| OXA-58 | direct | CTTGTGCTGAGCATAGTATGAGTC | 24 | 45.8 | 63.3 | 684 |
| reverse | CCACTTGCCCATCTGCCTTTTC | 22 | 54.5 | 66.5 | ||
Fig. 3Electrophoretic separation of multiplex PCR products after amplification of OXA-, KPC-type carbapenemases (a) and metallo-β-lactamases (b).
Fig. 4Layout of specific and control oligonucleotide probes on the surface of the DNA microarray for the identification of the A-, B-, D-class carbapenemase genes.
Fig. 5Results of a DNA microarray-based hybridization analysis for control Ps. aeruginosa (a, b) and A. baumanii (c) strains, producing carbapenemases VIM-1 (a), IMP-1(b), OXA-51 and OXA-40 (c).
Results on clinical sample testing on DNA microarrays
| Type of microorganism | Carbapenemase sensitivity as determined by phenotypical tests | Number of samples | Detected carbapenemase types | ||||
| OXA-23 | OXA-40 | OXA-51 | OXA-58 | VIM-2 | |||
| Resistant | 10 | 1 | 5 | 10 | 4 | - | |
| 11 | - | - | - | - | 11 | ||
| Sensitive | 2 | - | - | - | - | - | |
| 3 | - | - | - | - | - | ||
| 2 | - | - | - | - | - | ||