DNA Barcoding and Molecular Phylogeny of Drosophila lini and Its Sibling Species.

Drosophila lini and its two sibling species, D. ohnishii and D. ogumai, are hardly distinguishable from one another in morphology. These species are more or less reproductively isolated. The mitochondrial ND2 and COI-COII and the nuclear ITS1-ITS2 regions were sequenced to seek for the possibility of DNA barcoding and to reconstruct the phylogeny of them. The character-based approach for DNA barcoding detected some diagnostic nucleotides only for monophyletic D. ogumai, but no informative sites for the other two very closely species, D. lini and D. ohnishii, of which strains intermingled in the molecular phylogenetic trees. Thus, this study provides another case of limited applicability of DNA barcoding in species delineation, as in other cases of related Drosophila species. The molecular phylogenetic tree inferred from the concatenated sequences strongly supported the monophyly of the cluster of the three species, that is, the lini clade. We propose some hypotheses of evolutionary events in this clade.

1. Introduction

Studies of just diverging populations or species shed light on speciation mechanisms. An important evolutionary process in speciation is the diversification of genes between populations. Most comprehensive information on gene (DNA) evolution associated with speciation has been accumulated for the Drosophila melanogaster species subgroup, especially the D. simulans clade (e.g., [1-6]), and the D. obscura species group [7, 8]. In comparison, speciation mechanisms have been less explored in the D. montium species subgroup, in spite of its highest species diversity (= 89) [9] in the melanogaster group, with a variety of species at different stages of speciation process. On the other hand, molecular markers have been used to detect cryptic species under incipient speciation process. In the D. montium subgroup as well, such a molecular approach has recently been employed to reveal the presence of a cryptic species in the D. serrata species complex [10]. “DNA barcoding” is proposed as a promising tool not only for rapid identification of known species, that is, “species identification,” but also for discovery and delimitation of species, that is, “species discovery” or “DNA taxonomy” [11-13].

Discovery of a sibling species of Drosophila lini is one of cases in which molecular characters were used for “species discovery” in early days. It was first recognized as a species closely related to but different from D. lini based on the results of electrophoretic analyses [14]. Then, the studied “D. lini-like” strain, MMY326, from Pyinoolwin in central Myanmar, along with another strain (MMY307) from the same locality, was described as D. ohnishii [15]. At the same time, another sibling species, D. ogumai, was described for two strains (RGN3 and RGN206) from southern Myanmar [15]. It is, however, hard to morphologically distinguish among the three species, D. lini, D. ohnishii, and D. ogumai, especially between the former two, although 80–100% correct classification was achieved for them by discriminant analyses using 13 or 15 quantitative characters [15]. The evidence from cross-tests supports the presence of three sibling species. More or less strong postmating isolation is present among them: no F1 hybrids could be obtained from crosses between D. ogumai and D. ohnishii, while the other interspecific crosses produced fertile hybrid females but sterile males [16]. In addition, strong premating isolation was detected between D. ohnishii and D. lini or between D. ohnishii and D. ogumai, but not between D. lini and D. ogumai [16-18]. When the D. kikkawai species complex was established in the D. montium species subgroup of the D. melanogaster species group, D. lini was included in it [19]. Subsequent molecular phylogenetic studies consistently supported the close relationships between D. lini (and its siblings) and D. kikkawai (and its siblings, D. bocki and D. leontia) [14, 20–24]. However, the relationships between D. lini and its siblings have not been resolved yet.

Up to date, it is known that D. ohnishii is distributed in central Myanmar to southwestern China (Xishuangbanna), just occupying the intermediate range between the ranges of the two allopatric species, D. lini distributed in southern China to Taiwan and D. ogumai in southern Myanmar [18]. Thus, the premating isolation is seen between the parapatric neighbors of the three species. Based on this biogeographical evidence, a hypothesis that the premating isolation has evolved through the process of reinforcement in the secondary contact zone between D. ohnishii and either neighboring species has been proposed [18]. To test or refine this hypothesis, the present study aims at revealing reliable phylogenetic relationships among these three species based on DNA sequence data. In addition, molecular diagnostics are searched to apply the DNA barcoding “species identification” to these sibling species that are hard to be distinguished morphologically from one another.

When focusing on very closely related species, one should select rapidly evolving regions, for example, mitochondrial genes [25] or nuclear rDNA internal transcribed spacer (ITS) [26], as markers. The mitochondrial cytochrome c oxidase subunit I (COI) gene has been widely used as DNA barcoding for “species identification”: its 648-base pair (bp) fragment is the standard marker in the Barcode of Life project [11, 12]. In the present study, we employed two mitochondrial loci, NADH dehydrogenase subunit 2 (ND2) and cytochrome c oxidase subunit I and II (COI-COII), and one nuclear locus, rDNA internal transcribed spacer 1 and 2 (ITS1-ITS2), to examine the phylogenetic relationships among isofemale strains of D. lini and its sibling species and to find possible molecular diagnostics for each species of them.

2. Materials and Methods

Seven isofemale strains of D. lini, four strains of D. ohnishii, and two strains of D. ogumai were used as focal OTUs, and one strain each of D. kikkawai, D. bocki, D. leontia, and D. barbarae of the kikkawai complex, and one strain each of D. jambulina and D. seguyi belonging to the montium subgroup were added as ingroup OTUs (Table 1). Three of these isofemale strains (MLN24 and MLN45 of D. ohnishii and MLN260 of D. barbarae) were established in 2003 from Menglun, southern part of Yunnan Province, China, but all the others derived from the stocks of Tokyo Metropolitan University and have been maintained in laboratory on cornmeal-malt medium at 23°C under continuous light for more than 12 years. The species status of the closely related species, that is, D. lini/D. ohnishii/D. ogumai and D. kikkawai/D. bocki/D. leontia, was confirmed by cross-tests in previous studies [16, 27].

Table 1

List of experimental strains.

Species	Lines	Collection locality
D. lini	3146.1	Taiwan, China
	DHS315	Dinghushan, Guangdong, China
	DHS410	Dinghushan, Guangdong, China
	DHS501	Dinghushan, Guangdong, China
	NKS9212	Nankunshan, Guangdong, China
	NKS9231	Nankunshan, Guangdong, China
	NK9242	Nankunshan, Guangdong, China
D.  ohnishii	MMY309	Pyinoolwin, Myanmar
	MMY326	Pyinoolwin, Myanmar
	MLN24	Menglun, Yunnan, China
	MLN45	Menglun, Yunnan, China
D.  ogumai	RGN3	Yangon, Myanmar
	RGN206	Yangon, Myanmar
D.   bocki	Y163	?
D.   leontia	AO-2	?
D. kikkawai	OGS4	?
D. barbarae	MLN260	Menglun, Yunnan, China
D. jambulina	NH115	?
D. seguyi	K2	?

Total DNA was extracted from a single fly using a rapid method [28]. The target regions (Table 2) were amplified on an iCycler Thermal Cycler (Bio-Rad) with the PCR cycle program comprised a 5 min of predenaturation at 94°C, 35 cycles of amplification (1 min of denaturing at 94°C; 1 min of annealing at 53°C for COI-II and ND2, 56°C for ITS1-ITS2, 1 min of extension at 72°C), and final extension at 72°C for 5 min. The amplicons were purified by precipitation with isopropanol and then subjected to sequencing reaction using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) following the recommended protocol. The sequences were analyzed on the 3100-Avant Genetic Analyzer (Applied Biosystems).

Table 2

Target regions and primer sequences in the present study.

Target region	Primer sequence (5′–3′)	Length (bp)
Mitochondrial loci
ND2	AAGCTACTGGGTTCATACC	926
	ATATTTACAGCTTTGAAGG
COI-COII	ATACCTCGACG(AT)TATTGA	842
	GTTTAAGAAACCAGTACTTG
Nuclear locus
ITS1-ITS2	TCCGTAGGTGAACCTGCGG	650
	GTTAGTTTCTTTTCCTC
Total		2418

The ITS1-ITS2 sequences of three species of the montium subgroup were downloaded from GenBank, AY278412 for D. barbarae; AY278419 for D. jambulina, and AY278431 for D. seguyi. For the three species of the D. melanogaster subgroup employed as outgroups, the corresponding sequences were also downloaded from GenBank: AF200829 for ND2 and COI-COII and M21017 for ITS1-ITS2 of D. melanogaster; AF200846 for ND2 and COI-COII and Z28413 for ITS1-ITS2 of D. simulans; AF200831 for ND2 and COI-COII, Z28538 for ITS1-ITS2 of D. mauritiana.

DNA sequences were edited and analyzed using MEGA 5.05 [29]. Phylogenetic trees were constructed by the Neighbor-Joining (NJ) method with bootstrap test (1000 replicates) using the Kimura 2-parameter model, with gaps treated by pairwise deletion. For searching DNA barcoding diagnostics, we focused only on the three sibling species with multiple test strains, and applied both of tree- and character-based methods to each of different loci separately. We used the phylogeny-based approach in the former method, examining the monophyly of each species on a phylogenetic tree [30-33]. The character-based method identifies a set of diagnostic nucleotides in the DNA barcode sequence: the four standard nucleotides (A, T, C, G) if found in fixed states in one species can be used as simple pure diagnostics for identifying that species [34]. To examine molecular genealogies for the focal OTUs, we constructed an NJ tree based on the concatenated sequences of the three loci, and applied an estimated divergence time, 5.4 million years ago (Mya) [35], between D. melanogaster and D. simulans as a calibration point to estimate the divergence time of each node. Before the analysis using the concatenated sequence data, we conducted a Bayesian concordance analysis to test the concordance among the three regions, that is, ND2, COI-COII, and ITS1-ITS2, using BUCKy [36]. The DNA sequences of each region were analyzed using MrBayes 3.1.2 [37] for Bayesian phylogenetic estimation. Firstly, phylogenetic trees were constructed for each region via the Markov chain Monte Carlo (MCMC) method (number of generations for runs = 1,000,000, nucleotide substitution model = GTR (general time-reversible)), and then, the output of MrBayes was summarized using the mbsum program of BUCKy, and the primary concordance tree was generated with sample-wide concordance factors using default setting in BUCKy.

3. Results

3.1. DNA Barcoding for D. lini and Its Sibling Species

We sequenced the ND2 gene in D. lini and its siblings and some other species of the montium subgroup. The whole sequence of this gene is 1206 bp in most species of the D. obscura species group [38]. Our obtained sequences covered most of this region (from the site 34 to 959). The alignment of the sequences included no indel. The GenBank accession numbers of these sequences are AY739939-AY739956. The NJ tree for 13 strains of D. lini and its siblings showed that D. ogumai was monophyletic but that D. lini and D. ohnishii were nonmonophyletic with overlap of strains of these two species (Figure 1). There were 20 informative sites in the aligned 13 sequences of D. lini and its siblings. Of these sites, 11 nucleotides were specific to D. ogumai, and thus can be used as diagnostic nucleotides for identification of this species among the siblings (Table 3). However, there was no species-specific, fixed nucleotide for either D. lini or D. ohnishii.

Figure 1

Neighbor-joining (NJ) tree inferred from ND2 sequences of 13 strains of D. lini and its sibling species (D. ohnishii and D. ogumai). Numbers below branches indicate the bootstrap percentages.

Table 3

Nucleotides at 20 informative sites in ND2 sequences of 13 strains of D. lini and its sibling species (D. ohnishii and D. ogumai). Diagnostic nucleotides for DNA barcoding are indicated with an asterisk. N is the number of strains sequenced. The positions of nucleotide sites are based on the sequence of D. obscura [38]. Polymorphic sites are shown with code letters R (A/G,), Y (T/C), S (C/G), W (A/T), and M (A/C).

Position
Species	N	ND2 (sites 34–959)																				Phylogeny
		1	2	3	3	4	4	4	4	5	5	6	6	7	7	7	8	8	9	9	9
		1	5	4	4	0	1	3	8	4	5	6	6	4	8	9	2	9	0	3	5
		4	5	2	5	8	1	4	7	3	2	7	9	7	1	6	9	5	0	4	4
D. lini	7	R	T	C	A	Y	A	G	S	T	A	W	W	R	T	C	M	C	T	C	C	Non-monophyletic
D. ohnishii	4	A	T	C	A	C	A	G	S	T	R	A	A	G	T	C	A	C	T	C	C	Non-monophyletic
D. ogumai	2	G	C*	T*	R	T	G*	A*	G	C*	A	A	A	G	C*	T*	A	T*	C*	T*	T*	Monophyletic

The whole COI and COII sequences are 1536 and 684 bp, respectively, in D. yakuba [39]. The COI-COII region we sequenced covered 130 bp of COI and 639 bp of COII. The GenBank accession numbers of these sequences are AY737604-AY737622. The NJ tree based on the COI-COII sequences of the 13 strains of D. lini and its siblings showed the monophyly of D. ogumai but nonmonophyly for either D. lini or D. ohnishii (Figure 2). Twelve informative sites were detected from this region, among which five were species-specific, diagnostic nucleotides for D. ogumai (Table 4). The character-based approach failed to distinguish between the two non-monophyletic species for the COI-COII sequences as well.

Figure 2

Neighbor-joining (NJ) tree inferred from COI-COII sequences of 13 strains of D. lini and its sibling species (D. ohnishii, and D. ogumai). Numbers below branches indicate the bootstrap percentages.

Table 4

Nucleotides at 12 informative sites in COI-COII sequences of 13 strains of D. lini and its sibling species (D. ohnishii and D. ogumai). Diagnostic nucleotides for DNA barcoding are indicated with an asterisk. The positions of nucleotide sites are based on the whole length of the COI (1536 bp) and COII (684 bp) sequences of D. yakuba [39]. See Table 3 for further explanations.

Position

Species

N

COI (sites 1407–1536)

COII (sites 1–639)

Phylogeny

1407

1485

1503

69

72

231

232

234

399

435

486

570

D. lini

7

C

Y

T

T

C

C

T

R

Y

W

A

R

Non-monophyletic

D. ohnishii

4

C

C

T

T

C

C

Y

A

T

A

A

A

Non-monophyletic

D. ogumai

2

Y

T

C*

C*

T*

T*

T

A

T

A

G*

A

Monophyletic

Sequences of the ITS region covering a part of ITS1, the whole 5.8S rDNA, ITS2a, 2S rDNA, and a part of ITS2 were amplified from 10 strains of D. lini and its siblings and some other species of the montium subgroup. The positions of nucleotides in the sequence were determined by alignment with the ITS sequence of D. simulans [26]. The GenBank accession numbers for these sequences are AY739939-AY739956. The 5.8S rDNA, ITS2a, and 2S rDNA were very conservative in all compared species, without variation in the sequence length. On the other hand, the ITS1 and ITS2 diverged largely in respect of either nucleotide substitution or sequence length. The NJ tree for the 10 strains of D. lini and its siblings showed the monophyly of D. ogumai but non-monophyly for either D. lini or D. ohnishii (Figure 3). Four informative sites were present in this region, of which two nucleotide substitutions and one insertion were diagnostic for D. ogumai (Table 5); the remaining one, a 14-bp indel (sites 312–325) of ITS2, was polymorphic in D. ohnishii. For this region as well, no diagnostic nucleotide was found in either D. lini or D. ohnishii.

Figure 3

Neighbor-joining (NJ) tree inferred from ITS1-ITS2 sequences of ten strains of D. lini and its sibling species (D. ohnishii and D. ogumai). Numbers below branches indicate the bootstrap percentages.

Table 5

Nucleotides at four informative sites in ITS1-ITS2 sequences of ten strains of D. lini and its sibling species (D. ohnishii and D. ogumai). Diagnostic nucleotides for DNA barcoding are indicated with an asterisk. The positions of nucleotide sites are based on the sequence of D. ogumai. Determination of each region in the sequence is based on the whole sequence of D. simulans (Z28413), ITS1: 690 bp; 5.8S: 123 bp; ITS2a: 26 bp; 2S: 30 bp; ITS2: 383 bp [26]. The partial or whole sequence of each region was obtained in D. ogumai as: ITS1: last 81 bp; 5.8S: 123 bp; ITS2a: 28 bp; 2S: 30 bp; ITS2: first 392 bp. See Table 3 for further explanations.

Position
Species	N	ITS1 (last 81 bp)	ITS2 (first 392 bp)			Pylogeny
		16	307	312–325	326
D. lini	6	G	T	GTCAATAATAAAAT	—	Non-monophyletic
D. ohnishii	2	G	T	GTCAATAATAAAAT/deletion	—	Non-monophyletic
D. ogumai	2	A*	G*	GTCAATAATAAAAT	T*	Monophyletic

3.2. Molecular Phylogeny

The primary concordance tree (Figure 4) resulting from the Bayesian concordance analysis for the three loci (ND2, COI-COII, and ITS1-ITS2) was not discordant, especially the same for the strains of D. lini and its sibling species, in topology from the NJ tree (Figure 5) constructed using the concatenated sequences of the three regions (ND2 + COI-COII + ITS1-ITS2, 2442 bp in length), indicating that the mitochondrial and nuclear loci are concordant in the genealogies. The estimated divergence times based on a calibration point of 5.4 Mya divergence between D. melanogaster and D. simulans [35] were also shown in Figure 5. The three focal sibling species, D. lini, D. ohnishii, and D. ogumai, formed a monophyletic group supported by a high bootstrap value, 96%. This clade (henceforth termed the lini clade) formed another, strongly supported (100%) clade with D. kikkawai and its siblings, D. leontia and D. bocki, although the monophyly of the latter three sibling species was not supported. The relationships between the lini-kikkawai clade, D. barbarae (another species sampled from the kikkawai complex), and D. jambulina of the jambulina complex were not resolved. Within the lini clade, two distinct subclades, D. ogumai and D. lini + D. ohnishii, were recognized, with high support values, 100% and 98%, respectively. Within the subclade of D. lini + D. ohnishii, either species did not form a monophyletic branch: the strain DHS315 of D. lini branched off first (bootstrap value 93%), followed by the strain MMY326 of D. ohnishii (66%), but there was no nucleotide variation in the concerned sequences among the rest strains including those of D. lini from Taiwan, Dinghushan (DHS) and Nankunshan (NKS) in Guangdong Province, and MLN24 of D. ohnishii from southern Yunnan.

Figure 4

The primary concordance tree resulting from the Bayesian concordance analysis for the three regions, ND2, COI-COII, and ITS1-ITS2. Numbers above branches are the concordance factors.

Figure 5

NJ tree inferred from the concatenated sequences (2442 bp) of three regions, ND2 (926 bp), COI-COII (842 bp), and ITS1-ITS2 (674 bp). The time scale (in Mya) was given to the tree on the basis of an estimated time, 5.4 Mya, for the divergence between D. melanogaster and D. simulans [35] as a calibration point. MEGA 5.05 [29] was used for constructing the tree (bootstrap test: 1000 replications; model: Kimura 2-parameter; gaps: treated by pairwise deletion). Numbers in parentheses above branches indicate divergence times (Mya), and those below branches bootstrap percentages.

The ancestor of the lini clade was estimated to have appeared about 2.23 Mya. Within the lini clade, the divergence between D. ogumai and D. lini was estimated to have first occurred 1.42 Mya, and then D. ohnishii was estimated to have speciated from D. lini very recently, at least after 0.17 Mya.

4. Discussion

In this study, we tested the applicability of DNA barcoding “species identification” to the lini clade consisting of three sibling species, which are morphologically almost indistinguishable [15] but have proved to be more or less reproductively isolated from one another [16, 18]. We took two approaches, the phylogeny-based and character-based methods for DNA barcoding “species identification.” However, neither method succeeded in identifying all these three species. The phylogeny-based method revealed the monophyly of D. ogumai and the character-based method found some diagnostic nucleotides for D. ogumai, which can be, if not easily, distinguished from the other two species by a few morphological diagnostic characters [15].

However, we failed to get informative sites for DNA barcoding of two very closely related species, D. lini and D. ohnishii. This provides another evidential case that DNA barcoding is not always effective in species delineation, which has been corroborated in a number of cases of the genus Drosophila as a model system [40]. One possible problem is what genes are to be selected for DNA barcoding. Machado and Hey [41] pointed out that the well-established mutual monophyly of two closed related species, D. pseudoobscura and D. persimilis, was not recovered by phylogeny reconstruction based on nonrecombining molecules (particularly mitochondrial genome), but was strongly supported by that based on recombining molecules (five X-linked loci). The reason for the former is gene introgression between the species [41]. This may or may not be the case between D. lini and D. ohnishii as well. On the other hand, recombining molecules (inversions regions) may have contributed to the speciation process by affecting the hybrid fitness [42]. So-called speciation genes involved in the pre- and postmating isolations might be good candidate genes for DNA barcoding and, of course, are very important to understand speciation mechanisms of such species at initial speciation. However, DNA barcoding based on such a standard marker as the 648-bp fragment of COI in the Barcode of Life project [11, 12] should be a promising tool for nonexperts to easily and rapidly identify most of known species.

The inferred phylogenetic tree based on the concatenated sequences of the three regions did not support the monophyly of the kikkawai complex, although the taxon sampling was quite limited, covering only seven out of 12 species of this complex, in this study. Other studies, though under limited taxon sampling as well, suggested nonmonophyly of this species complex [14, 22, 23, 43]. The delimitation of this species complex should be revised on the basis of molecular phylogenetic analyses under more comprehensive taxon sampling. However, the tree strongly supported the lini clade comprising the three sibling species, D. lini, D. ohnishii, and D. ogumai, and placed it close to D. kikkawai and its sibling species, in consistence with previous studies [14, 20–23].

With respect to the evolution of the lini clade, a hypothesis that the premating isolation has evolved through the process of reinforcement in the secondary contact zone between parapatric neighbors, D. ohnishii/D. lini or D. ohnishii/D. ogumai, has been proposed, since the premating isolation is absent between allopatric species, D. lini and D. ogumai [18]. Based on the phylogeny inferred from the present study and all available biological information from previous studies, we refine or revise the above hypothesis.

The ancestor of the lini clade should have derived as a close relative to D. kikkawai and/or its sibling species about 2.23 Mya presumably in the subtropics of the Oriental Region. Then, the first speciation event producing D. ogumai and D. lini may have occurred about 1.42 Mya, and, finally, D. ohnishii may have diverged from D. lini very recently (at least after 0.17 Mya). This speciation order seems to be congruent with the morphological differentiation among the three species: D. ogumai can be distinguished from the other two species by a few diagnostic qualitative characters of the male genitalia and also is most remote from the other two species in terms of morphological distance based on metric characters [15]. In addition, variation in the strength of postmating isolation among the three species seems to be congruent as well with the speculated speciation order: the complete postmating isolation (production of no F1 hybrids) is present between the most diverged species, D. ogumai and D. ohnishii, while the postmating isolation is partial, producing F1 fertile female but sterile male hybrids, between the other pairs of species [16].

As a cue for the premating isolation caused by female repelling behavior, the frequency of sine song generated by males in their copulatory courtships has strongly been suggested from the evidence that it is different among the three species (significantly lower in D. ohnishii than in D. lini and D. ogumai) in accordance with the modes of sexual isolation between them [18]. Furthermore, wing-cut and playback experiments have provided crucial evidence for that the sine song frequency is used as a sexual cue for mate recognition in the lini clade [44, 45]. In light of the inferred phylogeny, it is most parsimonious to consider that the lower frequency sine song has evolved in D. ohnishii. If so, the first speciation between D. ogumai and D. lini should have occurred allopatrically, because sympatric or parapatric speciation seems to be inconceivable under the absence of premating isolation. As for the second speciation of D. ohnishii from D. lini, two hypotheses can be conceived with respect to the evolutionary sequence of post- and premating isolations: (1) if the postmating isolation has first evolved, it should have been established between geographically isolated populations as in the first speciation event. Then, the premating isolation, that is, the lower frequency sine song, may have evolved through the process of reinforcement in the secondary contact zone with either neighboring species in D. ohnishii. Even in the light of the phylogeny inferred from the present study, we cannot determine the secondary contact to which species has promoted this evolution. (2) If the premating isolation has evolved first, the change in frequency of sine song has occurred and fixed in D. ohnishii as a consequence of adaptation to specific, but unknown, environmental conditions or as a neutral change irrespective of any adaptation and has secondarily come to function, actually or potentially, as a cue for mate recognition by females in this group. If this is the case, D. ohnishii would have speciated from a small local population, where such (a) mutant gene(s) causing differentiation of sexual character(s) are apt to be fixed, within the range of D. lini. However, the mtDNA haplotype polymorphism observed in D. ohnishii (Figures 1 and 2) seems to be inconsistent with this hypothesis, although it does not rule out the possibility of gene introgression after speciation, especially from southern China (DHS and NKS) populations of D. lini to southwestern China (MLN) population of D. ohnishii.

For the establishment of postmating isolation, another possibility is infection of microorganisms that cause cytoplasmic incompatibility [46-48]. However, Wolbachia infection has never been detected from any strains of the lini clade (M. Watada, personal communication). From another aspect, however, there remain large areas lacking distribution data between the ranges of the three species, especially between Xishuangbanna, southern Yunnan (the eastmost population of D. ohnishii) and Dinghushan, central Guangdong (the westmost population of D. lini). Filling this gap of data will prompt us to revise the hypothesis about the evolution of these two species seemingly having diverged very recently. In addition, studies of speciation genes relating to the post- and premating isolations, especially those underlying the differentiation of sine song frequency, are needed.