| Literature DB >> 22312271 |
Mian Zhao1, Ruiping Zhang1, Chenliang Li1, Taiyang Mu1, Shichao Wei1, Xiong Li1, Hua Wu1.
Abstract
Eleven novel microsatellite markers were developed and characterized for the Omei treefrog (Rhacophorus omeimontis) using the fast isolation by AFLP of sequences containing repeats method. Polymorphism of each locus was tested in 24 individuals from two wild populations. The number of alleles per locus ranged from 4 to 15, the average observed and expected heterozygosity per locus ranged from 0.250 to 0.839 and from 0.562 to 0.914, respectively. Two of the 11 microsatellite loci showed significant deviations from Hardy-Weinberg equilibrium. Two locus pairs showed significant linkage disequilibrium. Neither evidence of scoring error due to stuttering nor evidence of large allele dropout was found at all of the 11 loci, but evidence of null alleles was indicated at two loci because of general excess of homozygotes for most allele size classes. These polymorphic loci will be useful markers in studying mate choice of the Omei treefrog.Entities:
Keywords: Omei treefrog (Rhacophorus omeimontis); heterozygosity; mate choice; microsatellite markers
Mesh:
Year: 2012 PMID: 22312271 PMCID: PMC3269705 DOI: 10.3390/ijms13010552
Source DB: PubMed Journal: Int J Mol Sci ISSN: 1422-0067 Impact factor: 6.208
Characteristics of eleven polymorphic microsatellite loci in the Omei treefrog (Rhacophorus omeimontis). Ta, annealing temperature; A, number of alleles; HO, observed heterozygosity; HE, expected heterozygosity.
| Locus | Primer sequence (5′-3′) (F, forward; R, reverse) | Repeat motif | Labelling dye | Size range (bp) | GenBank Accession no. | ||||
|---|---|---|---|---|---|---|---|---|---|
| OMTF1 | F:CAGGGTGACATCATAGACAA | (TG)13 | FAM | 60 | 5 | 220–236 | 0.542 | 0.631 | JQ031742 |
| OMTF2 | F: CCAAGCGATGTCCCAATC | (CA)32 | TAMRE | 62 | 14 | 199–255 | 0.458 | 0.914 | JQ031743 |
| OMTF3 | F:AAAACACTATCATATCACCATC | (AGAT)3 | FAM | 54 | 7 | 108–128 | 0.583 | 0.642 | JQ031744 |
| OMTF4 | F: GCTGGGCTGATCCTACTCTT | (AGAT)16 | TAMRA | 60 | 10 | 243–283 | 0.833 | 0.888 | JQ031745 |
| OMTF5 | F: ATTCAGCCATTCAGGAGAC | (AGAT)16 | HEX | 54 | 10 | 192–232 | 0.839 | 0.902 | JQ031746 |
| OMTF6 | F: AGCCATCAGATAGTTCAGG | (TCTA)18 | FAM | 60 | 11 | 96–160 | 0.791 | 0.852 | JQ031747 |
| OMTF7 | F: GTTTGGCTTTCAGTTAGA | (TCTA)11 | HEX | 53 | 13 | 168–232 | 0.767 | 0.887 | JQ031748 |
| OMTF8 | F:GTGGTCAGCCAAGGAAACATAA | (TCTA)15 | TAMRA | 50 | 4 | 282–294 | 0.250 | 0.562 | JQ031749 |
| OMTF9 | F: TGGATGAACGAGTTTGGT | (AGAT)19 | HEX | 56 | 11 | 168–220 | 0.808 | 0.910 | JQ031750 |
| OMTF10 | F: GCCTGGGGCAATGGATAC | (AGAT)15 | TAMRA | 63 | 15 | 204–280 | 0.825 | 0.895 | JQ031751 |
| OMTF11 | F: GCCAGGAGCAGAATAATG | (TCTA)10 | FAM | 56 | 12 | 156–216 | 0.833 | 0.898 | JQ031752 |
The values of polymorphism information content (PIC) and non-exclusion probability (NE) of paternity and identity for the eight microsatellite loci in the Omei treefrog (Rhacophorus omeimontis). NE-1P, NE of first parent; NE-2P, NE of second parent; NE-PP, NE of parent pair; NE-I, NE of identity; NE-SI, NE of sib identity.
| Locus | PIC | NE-1P | NE-2P | NE-PP | NE-I | NE-SI |
|---|---|---|---|---|---|---|
| OMTF1 | 0.574 | 0.786 | 0.615 | 0.430 | 0.190 | 0.488 |
| OMTF3 | 0.559 | 0.790 | 0.644 | 0.481 | 0.207 | 0.488 |
| OMTF4 | 0.859 | 0.405 | 0.252 | 0.092 | 0.028 | 0.322 |
| OMTF6 | 0.820 | 0.477 | 0.309 | 0.129 | 0.042 | 0.343 |
| OMTF7 | 0.855 | 0.415 | 0.260 | 0.100 | 0.030 | 0.323 |
| OMTF9 | 0.883 | 0.348 | 0.211 | 0.067 | 0.020 | 0.309 |
| OMTF10 | 0.865 | 0.394 | 0.245 | 0.090 | 0.027 | 0.318 |
| OMTF11 | 0.868 | 0.392 | 0.243 | 0.090 | 0.026 | 0.317 |
| Combined | 0.785 | 2.68 × 10−3 | 1.01 × 10−4 | 1.30 × 10−7 | 1.96 × 10−11 | 2.66 × 10−4 |