| Literature DB >> 22312269 |
Hong Ma1, Lan Wang2, Youming Wan1, Hongzhe Li3, Zhenghong Li1, Xiuxian Liu1, Ning Liang1, Wenjuan Li1.
Abstract
The genus Luculia Sweet contains about five species of small trees or shrubs and is a member of the family Rubiaceae (tribe Cinchoneae). Luculia yunnanensis is an endangered ornamental shrub endemic to southwest China. Only two natural populations of L. yunnanensis exist in the wild according to our field investigation. It can be inferred that L. yunnanensis is facing a very high risk of extinction in the wild and an urgent conservation strategy is required. By using a modified biotin-sterptavidin capture method, 24 primer sets were identified in two wild populations. Of these primers, 11 displayed polymorphisms and 13 were monomorphic. The number of alleles per locus ranged from two to four, values for observed and expected heterozygosities ranged from 0.000 to 0.833 and from 0.431 to 0.771, with averages of 0.389 and 0.614, respectively. These markers will be useful for further investigation of conservation of resources, selecting parental types in cross-breeding, evolution of this species at the molecular level and related research in Luculia species.Entities:
Keywords: Luculia yunnanensis; Rubiaceae; genetic diversity; microsatellite marker; polymorphism; population structure
Mesh:
Substances:
Year: 2012 PMID: 22312269 PMCID: PMC3269703 DOI: 10.3390/ijms13010534
Source DB: PubMed Journal: Int J Mol Sci ISSN: 1422-0067 Impact factor: 6.208
Characteristics of 24 microsatellite loci successfully amplified in Luculia yunnanensis.
| Locus | Primer sequence (5′-3′) | Repeat motif | Size (bp) | Ta (°C) | GenBank Accession No. |
|---|---|---|---|---|---|
| MH 01 | F: GCACTGGCTTAGTTCTTT | (CT)12(CCCT)3(CT)4 | 213 | 60 | JN871296 |
| MH 02 | F: AAACGAGCAGAAACTGGA | (TG)11(AG)9 | 153 | 60 | JN871297 |
| MH 03 | F: CAACTTCCCAAATTCTGC | (CT)16 | 322 | 61 | JN871298 |
| MH 04 | F: TTTCATTCCGTAACCTT | (CT)33 | 198 | 57 | JN871299 |
| MH 05 | F: TCGTACAATTTTGTTGCTCT | (TG)12 | 130 | 61 | JN871300 |
| MH 06 | F: CTCTATCTGTCGCATTCTTC | (TC)19 | 201 | 61 | JN871301 |
| MH 07 | F: ACCTCGGATAGAAAACAGC | (GA)4(CA)6(GA)14 | 284 | 57 | JN871302 |
| MH 08 | F: TGAACTCCCCAGTCCCCACT | (AG)22 | 187 | 62 | JN871303 |
| MH 09 | F: TGGTCATCAACTATTTTCCCTC | (TC)14 | 153 | 57 | JN871304 |
| MH 10 | F: GTCCTCCATAGCCACAAA | (GAA)13 | 130 | 59 | JN871305 |
| MH 11 | F: GTCCTAGTGTACTTACCCATCA | (CA)14 | 192 | 61 | JN871306 |
| MH 12 | F: CAATTCTTGAGCCACTTT | (GA)13 | 208 | 56 | JN871307 |
| MH 13 | F: AAGAAGGTGAAGGAGGCT | (TC)12(GT)7(CT)4 | 262 | 49 | JN871308 |
| MH 14 | F: GGGTTCAAGGCTCAGGAC | (GA)15 | 221 | 49 | JN871309 |
| MH 15 | F: TATGCTTGGGCAGGAATG | (GA)21 | 201 | 54 | JN871310 |
| MH 16 | F: TTTTAGTAGGGTTCACCG | (CT)32 | 192 | 54 | JN871311 |
| MH 17 | F: ATTCTGTATCTGGCTCAC | (CT)14(CA)11 | 279 | 55 | JN871312 |
| MH 18 | F: ACGAGCAGAAACTGGAAA | (GT)11(GA)9 | 153 | 58 | JN871313 |
| MH 19 | F: TCTACTTCGGTTCAGGGTT | (TC)25(AC)5 | 283 | 61 | JN871314 |
| MH 20 | F: ATGACTCCACATAGCAAACA | (AG)20 | 233 | 63 | JN871315 |
| MH 21 | F: GGGAAATGGTTCTTTATGGT | (CT)21 | 142 | 59 | JN871316 |
| MH 22 | F: CATCAACTCACGATTGCA | (TA)6(GA)16 | 236 | 55 | JN871317 |
| MH 23 | F: GCAGGTGAGAATGCAAAT | (AG)27(TG)4 | 157 | 59 | JN871318 |
| MH 24 | F: GCTTGTTTTGATGGTTGT | (CA)13(GA)25 | 424 | 55 | JN871319 |
Displayed polymorphisms in Luculia yunnanensis; Ta, PCR annealing temperature.
Results of 11 polymorphic microsatellite loci screening in two populations of Luculia yunnanensis.
| Population 1 ( | Population 2 ( | |||||
|---|---|---|---|---|---|---|
| Locus | ||||||
| MH 01 | 4 | 0.833 | 0.684 | 3 | 0.666 | 0.489 |
| MH 02 | 2 | 0.333 | 0.463 | 3 | 0.250 | 0.539 |
| MH 03 | 3 | 0.000 | 0.652 | 4 | 0.000 | 0.681 |
| MH 04 | 3 | 0.250 | 0.561 | 3 | 0.250 | 0.684 |
| MH 05 | 4 | 0.416 | 0.655 | 4 | 0.583 | 0.771 |
| MH 06 | 3 | 0.166 | 0.681 | 4 | 0.500 | 0.753 |
| MH 07 | 2 | 0.333 | 0.463 | 5 | 0.583 | 0.768 |
| MH 08 | 3 | 0.166 | 0.594 | 4 | 0.500 | 0.699 |
| MH 09 | 4 | 0.250 | 0.587 | 4 | 0.583 | 0.655 |
| MH 10 | 2 | 0.250 | 0.431 | 2 | 0.666 | 0.463 |
| MH 11 | 3 | 0.666 | 0.648 | 3 | 0.333 | 0.594 |
N, population sample size; NA, number of alleles revealed; HO, observed heterozygosity; HE, expected heterozygosity.