Phasevarion mediated epigenetic gene regulation in Helicobacter pylori.

Many host-adapted bacterial pathogens contain DNA methyltransferases (mod genes) that are subject to phase-variable expression (high-frequency reversible ON/OFF switching of gene expression). In Haemophilus influenzae and pathogenic Neisseria, the random switching of the modA gene, associated with a phase-variable type III restriction modification (R-M) system, controls expression of a phase-variable regulon of genes (a "phasevarion"), via differential methylation of the genome in the modA ON and OFF states. Phase-variable type III R-M systems are also found in Helicobacter pylori, suggesting that phasevarions may also exist in this key human pathogen. Phylogenetic studies on the phase-variable type III modH gene revealed that there are 17 distinct alleles in H. pylori, which differ only in their DNA recognition domain. One of the most commonly found alleles was modH5 (16% of isolates). Microarray analysis comparing the wild-type P12modH5 ON strain to a P12ΔmodH5 mutant revealed that six genes were either up- or down-regulated, and some were virulence-associated. These included flaA, which encodes a flagella protein important in motility and hopG, an outer membrane protein essential for colonization and associated with gastric cancer. This study provides the first evidence of this epigenetic mechanism of gene expression in H. pylori. Characterisation of H. pylori modH phasevarions to define stable immunological targets will be essential for vaccine development and may also contribute to understanding H. pylori pathogenesis.

Introduction

The host-adapted pathogen Helicobacter pylori is the most common cause of bacterial infection worldwide [1], [2] and is an important etiologic agent of gastritis, peptic ulcers, and gastric cancer [3], [4]. Unless treated, colonization usually persists for life, indicating that H. pylori is well adapted to the gastric environment.

In order to adapt its physiology to its environment and ensure survival, H. pylori has evolved molecular mechanisms for generating genetic variation [5]. One mechanism is phase-variation, which is the high frequency reversible on/off switching of gene expression. Phase-variation is commonly mediated by mutations in simple tandem DNA repeats in the open reading frame or promoter region of genes encoding surface expressed virulence determinants [6]. The independent, random switching of these genes results in phenotypically diverse populations that can rapidly adapt to host environments and evasion of immune responses [7]. While phase-variation is typically associated with genes encoding surface structures, several host-adapted bacterial pathogens, including H. pylori, have DNA methyltransferases (mod genes) associated with type III restriction modification (R-M) systems that contain simple tandem DNA repeats which have been proven to phase vary [5], [8], [9].

R-M systems are ubiquitous in bacteria and confer protection to the bacterial host against invasion by foreign DNA [10]. R-M systems are classified into three groups: Types I, II or III on the basis of their subunit composition, DNA cleavage position, sequence-specificity and co-factor requirements [11]. Type III systems are composed of a methyltransferase (modification, mod) gene and an endonuclease (restriction, res) gene, whose products form a two-subunit enzyme – Mod and Res [12]. In Type III systems Res must form a complex with Mod to be functional [13], although, Mod can function independently of Res [14]. The Mod subunit contains several conserved motifs in the N- and C-terminal regions and the central region contains the DNA-recognition domain that dictates sequence specificity [15].

We have recently shown that in three human pathogens (Haemophilus influenzae [16], Neisseria gonorrhoeae and Neisseria meningitidis [17]) the random switching of the modA gene controls expression of a phase-variable regulon of genes (a “phasevarion”), via differential methylation of the genome in the modA ON and OFF states. In this study we investigated the modH gene, a phase-variable DNA methytransferase of H. pylori, to determine if it plays a role in gene regulation.

Results

Seventeen modH alleles present in H. pylori

To investigate if the modH gene associated with a type III R-M system of H. pylori behaves as a phasevarion [16], [17], we first carried out phylogenetic analysis of modH. We have previously reported that Helicobacter strains, like the pathogenic Neisseria, contain multiple phase-variable type III R-M systems [9]. We defined one of these phase-variable type III R-M systems as modH. As with H. influenzae and the pathogenic Neisseria [16], [17], for each mod gene of H. pylori there are distinct alleles that differ only in their DNA recognition domain ([15]; see Figure 1A). Comparison of the fully sequenced and annotated H. pylori genomes available at the time revealed that there were four distinct alleles of modH based on differences in their DNA recognition domain [9]. The modH gene contains tracts of simple tandem guanosine repeats that mediate phase-variation of mod gene expression.

Figure 1

Sequence analysis of the 17 H. pylori modH alleles.

(A) Diagrammatic representation of the mod and res genes of H. pylori. The methyltransferase gene (mod) and restriction endonuclease (res) genes and the repeat region that mediates phase-variation are indicated. Type III R-M system conserved motifs are also shown: in mod, the catalytic region (DPPY), the AdoMet binding pocket (FxGxG), and the DNA recognition domain (DRD); in res, the ATP binding motif (TGxGKT), and ATP hydrolysis motif (DEPH) and the endonuclease domain. A black circle indicates the position of a nonsense mutation or frame-shift mutation in res. (B) The variable regions for each of the 17 modH alleles in the multiple sequence alignment were aligned in ClustalW and visualised with JalView using the overlay feature. The nucleotides are represented as vertical bars colored according to consensus identity (dark blue >90% identity; light blue >50% identity; white <50% identity or gap). The modH alleles were from the following H. pylori strains (listed in Table 1); modH1 BH13, modH2 1061, modH3 11637, modH4 1134, modH5 2A, modH6 3A, modH7 CHP7, modH8 CHP2, modH9 CHP4, modH10 219, modH11 GN760, modH12 L252, modH13 L264, modH14 SouthAfrica7, modH15 Gambia 94/24, modH16 Cuz20 and modH17 908. To generate the amino acid sequences of the DRD region for this comparison the modH genes were translated, starting and ending with the residues corresponding to amino acid residues 214 and 449, respectively, with reference to the sequence of the H. pylori P12 type III methyltransferase (gb ACJ08645.1). (C) The 17 modH alleles are shown as coloured lines. BLASTn matches longer than 20 nucleotides and >90% identity between the 17 modH alleles were mapped as a box onto the corresponding allele in the appropriate colour. Detailed information on each individual coloured box is provided in Figure S1 and Table S1. (D) Diagrammatic representation of the tBLASTn match between modH3 and modH10. The nucleotides are represented as vertical bars (dark blue >90% identity; light blue >50% identity; white <50% identity or gap). The numbers below the figure indicate the percent identity as defined by BLASTn for the area between the double-headed arrows.

Table 1

ModH allele and repeat numbers for H. pylori clinical isolates and genome sequence strains.

Strain	modH allele b	G tract repeat numbera	Origin	Sequence source(Accession number)
L203	modH1	13 (ON)	The Netherlands	This study (HQ734252)
BH13	modH1	12 (OFF)	Brazil	This study (HQ734242)
35A	modH1	8(OFF)	Norway	CP002096.1 (HMPREF4655_20115)
PeCan4	modH1	9 (OFF)	Cancer Patient	CP002074.1 (HPPC_07455)
J99	modH1	11 (OFF)	USA	NC_000921.1 (jhp1411)
2047d	modH2	12 (OFF)	The Netherlands	This study (HQ734240)
1061	modH2	12 (OFF)	Canada	This study (HQ734238)
163(A)	modH2	11 (OFF)	Brazil	This study (HQ734234)
CHP1	modH2	13 (ON)	Australia	This study (HQ734243)
26695	modH2	12 (OFF)	UK	NC_000915.1 (HP1522)
2022	modH3	15 (OFF)	The Netherlands	This study (HQ734239)
L101d	modH3	9 (OFF)	The Netherlands	This study (HQ830157)
11637	modH3	11 (OFF)	Australia	This study (HQ734241)
L71	modH3	10 (ON)	The Netherlands	This study (HQ734251)
SS1	modH3	12 (OFF)	Mouse-adapted strain	This study (HQ830158)
F30	modH3	14 (OFF)	East Asia	BAJ57491.1 (HPF30_1394)
51c	modH3	14 (OFF)	Korea	CP000012.1 (KHP_1374)
83	modH3	12 (OFF)	USA	CP002605.1 (HMPREF0462_1519)
HPAG_1	modH3	13 (ON)	Sweden	CP000241.1 (HPAG1_1393)
1134	modH4	14 (OFF)	Canada	This study (HQ734257)
Sat464	modH4	10 (ON)	Peru	CP00207.1 (HPSAT_07320)
98-10	modH4	11 (OFF)	Japan	ABSX01000015.1 (HP9810_885g17)
HPG27	modH4	11 (OFF)	Italy	CP001173.1 (HPG27_1444)
2025	modH5	15 (OFF)	The Netherlands	This study (JN974761)
CHP5	modH5	12 (OFF)	Australia	This study (HQ734246)
KC7617	modH5	11 (OFF)	Canada	This study (HQ734250)
5A	modH5	10 (ON)	The Netherlands	This study (HQ734233)
P12	modH5	10 (ON)	Germany	CP001217.1 (HPP12_1497)
2A	modH5	9 (OFF)	The Netherlands	This study (HQ734231)
HPB8	modH5	13 (ON)	Gerbil-adapted strain	NC_014257 (HPB8_7)
India7	modH5	14 (OFF)	India	CP002331.1 (HPIN_07505)
L251	modH5	9 (OFF)	The Netherlands	This study (HQ734253)
3A	modH6	12 (OFF)	The Netherlands	This study (HQ734232)
L2624	modH6	12 (OFF)	The Netherlands	This study (HQ734256)
Shi470	modH6	10 (ON)	Asia/South America	CP001072.2 (HPSH_07815)
F32c	modH6	12 (OFF)	East Asia	BAJ58990.1 (HPF32_1408)
F57	modH6	11 (OFF)	East Asia	BAJ60509.1 (HPF57_1435)
Lithuania75	modH6	12 (OFF)	Lithuania	CP002334.1 (HPLT_07575)
758TM	modH6	9 (OFF)	Canada	This study (HQ734236)
CHP7	modH7	15 (OFF)	Australia	This study (HQ734248)
AS620	modH7	10 (ON)	Canada	This study (JN974762)
CHP2	modH8	11 (OFF)	Australia	This study (HQ734244)
CHP4	modH9	13 (ON)	Australia	This study (HQ734245)
L80	modH10	11 (OFF)	The Netherlands	This study (JN974763)
219	modH10	9 (OFF)	Brazil	This study (HQ734235)
SJM180	modH10	9 (OFF)	Peru	NC_014560.1 (HPSJM_07770)
CHP6	modH10	10 (ON)	Australia	This study (HQ734247)
GN760d	modH11	11 (OFF)	Canada	This study (HQ734237)
F16	modH11	12 (OFF)	East Asia	AP011940.1 (HPF16_1417)
52c	modH11	11 (OFF)	Korea	CP001680.1 (HPKB_1423)
CHP8	modH11	10 (ON)	Australia	This study (HQ734249)
L252	modH12	10 (ON)	The Netherlands	This study (HQ734254)
L264	modH13	13 (OFF)	The Netherlands	This study (HQ734255)
SouthAfrica7	modH14	9 (OFF)	South Africa	CP002336.1 (HPSA_07265)
Gambia94/24	modH15	9 (OFF)	Gambia	CP002332.1 (HPGAM_08025)
Cuz20	modH16	11 (OFF)	Peru	CP002076.1 (HPCU_07650)
908	modH17	12 (OFF)	Africa	CP002184.1 (hp908_1508)

Number and expression state of poly-guanosine repeats within the mod gene; in-frame (ON) or out-of-frame (OFF).

A strain was defined as having the modH allele if the DNA recognition region was ≥90% identical at the nucleotide level to the modH gene of H. pylori. A strain was defined as having a particular modH allele if the DNA recognition region was ≥90% identical at the amino acid and nucleotide level to the modH allele. Refer to Figure 1.

res gene contains a nonsense mutation (strain F32, nucleotide 1587 and strain 52, nucleotide 537 change from G to T) or missing base pair resulting in a frame-shift mutation (strain 51, nucleotide 2054).

res gene not detected.

To investigate whether additional alleles of modH are present in H. pylori, and to examine the distribution of modH alleles and their repeat sequence type and number, sequence analysis of a genetically diverse set of H. pylori clinical isolates was performed. This analysis revealed that all strains examined contained the modH gene, with thirteen additional modH alleles observed, bringing to seventeen the total number of modH alleles observed (Table 1, Figure 1B). Here we define modH alleles of the same group as sharing more than 90% amino acid identity with other group members in a global pairwise alignment. In previous studies of mod genes inter-allelic diversity in the DNA recognition domain is very high with less than 30% amino acid identity shared by DNA recognition domain regions of different groups [16], [17]. In contrast in comparison of the modH alleles, there are two groups of alleles (modH5/modH11/modH12 and modH3/modH10) that share large regions of high identity, separated by regions with little or no identity, a pattern suggestive of recombination. The most frequently occurring modH alleles observed in the strain survey are modH3 (16% of isolates tested) and modH5 (16% of isolates tested). Sequencing of the repeat region of the modH alleles revealed that the repeat numbers vary in length between 9 and 15 bp in different strains, resulting in the mod genes being in-frame (ON) or out-of-frame (OFF) for expression; consistent with phase-variation of the modH gene in this collection of strains (Table 1). Sequence analysis of the corresponding res genes in the strain collection revealed that strains F32 (modH2), and 52 (modH11) have nonsense mutations resulting in truncation of the res gene, while strain 51 (modH3) has a base pair missing resulting in a frame-shift mutation (Figure 1A, Table 1). Furthermore, for strains 2047 (modH2), L101 (modH3) and GN760 (modH11) a full-length res gene could not be amplified (Table 1).

Representatives of all 17 modH alleles were compared by multiple sequence alignment. Figure 1B illustrates the diversity seen throughout the DNA recognition domain of the modH alleles at the nucleotide level. There are several short regions of high similarity within the DNA recognition domain. The mosaic pattern observed in the alignment schematic (Figure 1B) suggests that large segments have been deleted or replaced via genetic recombination. To examine recombination within the DNA recognition domains in more detail and to determine its contribution to modH allele diversity, we undertook all versus all BLASTn searches using the 13 representative modH sequences (Figure 1C). The number of reciprocal exchanges identified gave a clear indication that the modH alleles have recombined in the past. By using this approach we identified new relationships between the modH alleles. Some alleles were found to have undergone recombination more readily than others to generate new alleles. For example, modH5, modH11 and modH12 share near identical 5′ and 3′ regions, but each has a different central fragment suggesting recent origin from an ancestral allele (Figure 1C). Closer examination of these regions reveals that the 5′ end of each allele (modH5, modH11 and modH12) matches the first 200 nucleotides of the other two alleles. For example, modH5 has matches to nucleotides 1–177 of modH11 and nucleotides 1–186 of modH12, modH11 has matches to modH5 (1–186) and modH12 (1–172) and modH12 has matches to modH5 (1–177) and modH11 (1–172) (Figure S1, Table S1). Similarly the 3′ end of modH5 has matches to regions related to modH11 (nucleotides 517–711) and modH12 (nucleotides 517–711) as well as modH4 (nucleotides 641–711), modH6 (nucleotides 647–711), modH8 (nucleotides 688–711) and modH16 (nucleotides 641–711) (Figure S1, Table S1). These regions of similarity are also observed in the 3′ ends of modH11 and modH12 (Figure S1, Table S1). Likewise, modH3 and modH10 also appear to have originated from a single allele that has undergone at least two recombination events to generate the diversity that now distinguishes them from one another (Figure 1D).

Analysis of differentially expressed genes in the H. pylori modH5 phasevarion

To determine whether phase-variation of the modH allele in H. pylori resulted in changes in global gene expression, we conducted a study using H. pylori strain P12, which expresses the most common modH5 allele. The modH5 gene was inactivated by insertion of a cat cassette to make the mutant strain P12ΔmodH5. Wild-type P12modH5 ON and P12ΔmodH5 were compared by microarray analysis using H. pylori P12 genome arrays (Methods). Six genes were found to be differentially expressed by a ratio of 1.6-fold or more, with 2 genes up-regulated in P12ΔmodH5 relative to wild-type and 4 genes down-regulated. These data confirmed that modH5 phase-variation has an influence on gene expression (Table 2). One gene with an increased expression of 2.4 fold in the modH mutant encodes the surface exposed protein, HopG (also known as HopY), a potential vaccine candidate [18]. HopG is required for colonization [19] and may be associated with gastric cancer [20]. Two genes associated with flagella showed increased expression in the modH ON strain. FlaA is the major component of the flagellar filament [21], [22] and is required for normal motility, which is essential for colonization [23] and the establishment of persistent infection [24]. HPP12_904 is homologous to the flagellar hook-length control protein FliK that is also essential for motility [25].

Table 2

Differentially expressed genes in H. pylori wild-type P12 modH5 ON versus the mutant strain P12ΔmodH5.

Gene IDa	Gene Name	Ratiob	B-Statc	QRT-PCRd
Reduced expression in the H. pylori strain P12 modH5 mutant
HPP12_1497	type III R-M system methyltransferase	−5.94	6.350
HPP12_0609	flagellin A	−1.97	3.583	−2.00 ± 0.609
HPP12_0904	hypothetical protein	−1.79	0.831	−1.92 ± 0.615
HPP12_0870	flagellar hook protein Flg	−1.57	0.118
Increased expression in H. pylori strain P12 modH5 mutant
HPP12_0255	hypothetical protein	1.80	0.667	4.72 ± 0.686
HPP12_0253	outer membrane protein HopG	2.38	1.631	3.12 ± 0.427

The genes listed are either down- or up- regulated in the H. pylori P12ΔmodH5 mutant strain. The identity of the gene is indicated with the gene ID in the annotation of the H. pylori P12 genome [42].

The ratio presented is the mean of H. pylori P12ΔmodH5 mutant:wild-type P12modH5 ON from multiple replicate spots on three independent microarrays. Only those genes with an expression ratio ≥1.5-fold were included in this study.

Determined using LIMMA [41].

Gene expression confirmed by quantitative RT-PCR (QRT-PCR) in the wild-type H. pylori P12modH5 ON strain and the H. pylori P12modH5 OFF strain. Results for each gene were as follows: HPP12_253 (5.10± 0.375), HPP12_255 (3.50± 0.346), HPP12_609 (−3.81 ± 0.184), HPP12_904 (−3.52± 0.290).

Quantitative real time PCR (QRT-PCR) confirmed that flaA and HPP12_904 were expressed at a higher level in the wild-type P12modH5 ON parent strain compared to P12ΔmodH5, while hopG and HPP12_0255 were expressed at a higher level in the P12ΔmodH5 mutant compared to P12modH5 ON (Table 2). QRT-PCR that compared the wild-type P12modH5 ON (G10) strain to a P12modH5 OFF strain (G6TG4), also confirmed the microarray results (Table 2).

Discussion

We recently confirmed gene regulation as a function of phase-variable type III R-M systems in the human pathogens H. influenzae [16] and pathogenic Neisseria [17], thus defining a new paradigm in bacterial gene regulation “the phase-variable regulon; “phasevarion” [9]. In this study we investigated whether the phase-variable type III R-M systems described in H. pylori serve a similar regulatory function.

H. pylori contain a number of phase-variable type II and type III R-M systems [9], [26], [27], as well as several active orphan type methyltransferases [28], [29], [30], suggesting that these methyltransferases may have functions other than restriction, such as gene regulation [31]. Additionally, H. pylori strains have been found to have inactive type III and II res genes, indicating that DNA restriction may not be the function of phase-variable R-M systems [8], [31]. Recently, methylation by a putative phase-variable mod gene associated with a type II R-M system in H. pylori (M.HpyAIV) was shown to influence gene expression of katA [31]. The M.HpyAIV gene has also been associated with the induction of a more robust host response in mice, suggesting an involvement in gene regulation [32].

In type III R-M systems DNA sequence specificity is conferred by the Mod subunit [15]. Differences in the modA DNA recognition domain have previously been observed in H. influenzae with 17 distinct modA alleles defined in this organism [33], [34]. In pathogenic Neisseria, we identified three distinct modA alleles and two distinct modB alleles [17]. Our phylogenetic studies on the modH gene of a collection of H. pylori clinical isolates revealed that there are 17 distinct modH alleles based on differences in their DNA recognition domain. In pathogenic Neisseria, strains with the same DNA recognition domain regulated the same set of genes, while those with different mod alleles regulate the expression of different sets of genes [17]. Seventeen distinct modH alleles in H. pylori suggest that 17 distinct phasevarions exist. ModH3 and modH5 were the most frequent alleles observed in clinical isolates.

Further studies on the modH5 phasevarion were conducted using microarray to compare H. pylori strain P12, which expresses the modH5 allele, to a mutant strain. Of the genes regulated by the modH5 phasevarion, two encode proteins that have important roles in motility, FlaA and FliK. Motility is an essential factor for the colonization and persistence of H. pylori in the human stomach [24] and therefore flagella have an important role in virulence. In addition, H. pylori FlaA has low intrinsic capacity to activate innate immunity via the Toll-like receptor 5 [35], [36], [37]. Therefore, altered expression of flagella may be advantageous for the adaptation of H. pylori to alternate host environments and in evading the host immune response. The gene encoding the essential outer membrane protein for colonization, HopG [19] was also found to be regulated by the modH5 phasevarion. Bacterial adherence mediated by HopG and outer membrane proteins is thought to play an important role in the colonization of the gastric epithelium by H. pylori [38], making HopG an attractive vaccine target [18]. Hence phasevarion mediated phase-variation of hopG has the potential to mediate escape from the host immune response.

Only a relatively small number of genes were found to be under the control of the modH5 phasevarion. This may be the full extent of the regulon, or only be a sub-set of the regulon due to the analysis being done under standard in vitro culture conditions. Differences in gene expression can only be detected if the genes in question are being expressed. Using different physiologically relevant conditions, such as specific pH conditions that reflect the gastric environment, may result in more genes being found to be under the influence of the modH5 phasevarion.

Here we provide evidence for a role for phase-variable mod genes associated with type III R-M systems in gene regulation in H. pylori. Although we cannot exclude another as yet undescribed role for these modH phase variation in H. pylori biology, we have confirmed phasevarion mediated epigenetic mechanism of gene expression does operate in H. pylori. Further characterisation of this phasevarion will contribute to an improved understanding of H. pylori pathogenesis and may guide vaccine development for this important human pathogen by defining stably expressed immunological targets in modH5 strains. Based on our previous studies [9] it is likely that other H. pylori modH alleles also function as phasevarions and regulate gene expression. Future studies in H. pylori involving gene regulation, host/pathogen interactions or vaccine development need to control for the potential for modH phase variation to alter global gene expression.

Materials and Methods

Bacterial strains and growth conditions

H. pylori strains were routinely grown from glycerol stocks for 2 days on GC agar (Oxoid, Basingstoke, UK) plates supplemented with 10% (v/v) horse serum (Invitrogen Corp, Carlsbad, CA), vitamin mix and antibiotics (nystatin, 20 mg/ml; trimethoprim, 2.5 mg/ml; vancomycin, 10 mg/ml) in a microaerobic atmosphere as described previously [39]. Plates for cultivation of mutant strains were further supplemented with chloramphenicol (4 mg/ml for routine culture, 10 mg/ml for selection of transformants).

DNA manipulation and analysis

All enzymes were sourced from New England Biolabs. Sequencing was performed on PCR products using QiaQuick PCR purification kit (Qiagen) and Big-Dye (Perkin Elmer) sequencing kits. Data were analysed using MacVector v11.0 (Accelrys).

ModH alleles (formerly called ModC [9]) were classified as ModH1-13 according to all-versus-all global pairwise amino acid alignments of the ModH DRD region and a within-group minimum identity cut-off of 90%. Global pairwise alignments were calculated with a dynamic programming technique as implemented in Jalview (http://www.jalview.org/) (alignment parameters: BLOSUM62 substitution matrix, gap-open penalty of 12, gap-extend penalty of 2). Inter-allele comparisons were carried out using all versus all BLASTn and BLASTp comparisons of representative ModH DRD alleles using stand-alone NCBI BLAST without filters (version 2.2.18). Amino acid and nucleotide sequences were aligned using ClustalX (version 2.0.11). Multiple alignments were viewed and edited in Jalview (42). The GenBank accession numbers are HQ734231–HQ734257, HQ830157–HQ830158 and JN974761–JN974763.

mod and res specific PCR

The modH gene and resH gene were amplified and sequenced using the primers listed in Table 3. H. pylori clinical isolates were used as templates (Table 1). The reaction was performed in 50 µl using KOD (Novagen) reagents, and 1 unit of KOD DNA polymerase with the following cycling conditions for the modH gene: 30 cycles of 94°C for 30 sec, 50°C for 30 sec, 70°C for 1 min and 1 cycle of 72°C for 5 min with 5 µM of the primer pair HP_MODHF1 and HP_MODHR5. A 693 bp region containing the DNA recognition domain (603 bp downstream of HP_MODHF1 and 640 bp upstream from HP_MODHR5) was compared to the H. pylori genome strains to determine the modH allele (Table 1). The primers HP_MODHREPEATF and HP_MODHR4 were used to sequence the repeat region. The resH gene was amplified using the primer pair HP_RESHF1 and HP_RESHR1 with the following cycling conditions: 30 cycles of 94°C for 30 sec, 50°C for 30 sec, 72°C for 2 min and 1 cycle of 72°C for 5 min. Only the regions containing the conserved motifs and nonsense mutations were sequenced using the primers HP_RESHF1, HP_RESHR1 and HP_RESHR7. PCR products were cleaned using the QIAquick PCR Purification Kit (Qiagen).

Table 3

Primers used for modH allele study.

Primer	Nucleotide Sequence 5′-3′
HP_MODHF1	GGATAGAGATGCAAAATAAAGAAATTG
HP_ MODHF2	CTCATCAAGGGCGATAATTTAGACG
HP_ MODHF3	CCAATGAAGAGGTTTTAAAAAC
HP_MODHF4	ACTCAAACTTTTATGCGATG
HP_MODHF5	GAGAGTAATAAGAGCGATTATC
HP_MODHF6	GGCGCTTCATTCTCGTCCAG
HP_MODHREPEATF	GCCGGGAGCGGGACAACCGCGCAT
HP_MODHR1	GTTTTTAAAACCTCTTCATTGG
HP_MODHR2	CCGTCTTGTTTGAGCAAATCTTTAG
HP_MODHR3	GATAATCGCTCTTATTACTCTC
HP_ MODHR4	CTGGACGAGAATGAAGCGCC
HP_MODHR5	CTACCCCCTAATCTTTAAATCGCC
HP_RESHF1	GGCGATTTAAAGATTAGGGGGTAG
HP_RESHR1	GTTCCATGTGAAACATTAGAG
HP_RESHR7	CTTTTTTATGCGTCGTAACCGAAAC
HP_0253F	CTGGCACGGACTTTTTATG
HP_0253R	CCCAAGTGTTACCCGCTAT
HP12_0255F	GCGCTCTAAGAATGGAGATAGAATATTAC
HP12_0255R	GCTAGAATATAATCTTTTTCTAAAACTTTTAAATCC
HP12_0609F	TAGTTCAGCAGGCACAGGGATTGG
HP12_0609R	TGGTGATAACGCTCGCATAAGC
HP12_0904F	AACGCTAAAGAGCCAAAAACCC
HP12_0904R	GAGTTGTGGTCGCTTGAATGTTG
16SF	ACGGAGGGTGCGAGCGTTAATC
16SR	TCGCCTTCGCAATGAGTATTCCT
RGRM4F	ATGCAAAATAAAGAAATTGGTG
RGRM4R	CTACCCCCTAATCTTTAAATCGCC
RGRM4Fmut	CGGATCCGTGGGGGATATAGAAATGAG
RGRM4Fmut1	CGGATCCTAAATTATCGCCCTTGATGAG
RGRM4Fmut2	CCGGATCCGGTGAAGCCCATCAAAAGGATTTG
RGRM4Rmut3	CCGGATCCTTAAATAACCCCTCCCCCCTC

Underlined sequences represent introduced BamHI restriction sites.

Construction of knockout mutant and OFF mutant of the modH5 gene of H. pylori strain P12

Two mutants of modH were made using strain H. pylori P12. In strain P12 the modH5 gene contains a G10 tract in the coding sequence of the gene and is in-frame for expression of a full-length modH gene; hence it is defined as “ON”. The complete ORF of P12modH5 was amplified using Vent DNA polymerase and primer pair RGRM4F/RGRMR4 and A-tailed before cloning into pGEM-T easy (Promega). The first mutant, P12ΔmodH5, was produced by allelic exchange of a 1480 bp region of modH containing the DNA binding region and poly-G tract, with a choloramphenicol resistance cassette (cat) lacking a transcriptional terminator [39]. The cloned ORF was inversely amplified using primer pair RGRM4Fmut/RGRM4Rmut1 to excise the 1480 bp region and introduce BamHI sites, which were used to ligate BamHI-cut cat. The second mutant, P12modH5 OFF, carried an insertion in the polyG tract to alter it to N11, resulting in a frame-shift mutation to an “OFF” phase. The cloned ORF was inversely amplified using primer pair RGRMFmut2/RGRM4Rmut3 to insert a silent thymidine residue into the poly-G tract, changing G10, to 5′-GGGGGGTGGGG-3′, excising a 270 bp region, and introducing BamHI sites for ligation with BamHI-cut cat. Both mutagenesis constructs carried the cat cassette in the same orientation as modH. For transformation of H. pylori P12, the linear mutagenesis cassettes were amplified using primer pair RGRM4F/RGRM4R. Naturally competent P12 was transformed using the purified PCR product as described previously [39] and transformants were screened by sequence analysis.

RNA extraction

Triplicate cultures of H. pylori strain wild-type P12modH5 ON, P12modH5 OFF and the P12ΔmodH5 mutant, were grown to exponential phase (optical density at 550 nm  =  0.9) in BHI broth (Oxoid) supplemented with 10% (v/v) fetal bovine serum (Invitrogen), vitamin mix and vancomycin. Bacterial cells were stabilized using RNAprotect Bacteria Reagent (Qiagen) prior to RNA extraction and approximately 50 µg of total RNA was prepared from each sample using the RNeasy Maxi Kit according to the manufacturer's instructions (Qiagen). The integrity and concentration of RNA were determined via micro-fluidic analysis on a bio-analyser (Agilent Technologies).

Microarray analysis

Custom Agilent 8×15 k oligonucleotide microarrays (Agilent, CA, USA) were designed based on the publically available sequence of H. pylori P12 (NC_011498) using E-array (Agilent, CA, USA). Reverse transcription reactions were performed in 40 µl volumes, containing 10 µg total RNA, 300 ng random hexamers, 0.5 mM dNTPs and 300 U SuperScript III Reverse Transcriptase (Invitrogen) at 42°C for 2.5 h. RNA contamination was removed from the cDNA by the addition of NaOH followed by column purification (Qiagen minElute, Qiagen). A total of 1 µg of purified cDNA was labeled using KREAtech Cy3-ULS (KREAtech, The Netherlands), and 625 ng was used to hybridize Agilent 8×15 k microarrays as per the manufacturer's instructions.

Hybridized arrays were scanned on an Agilent Genepix G2565BA scanner, and features were extracted using Feature Extraction V9.5 (Agilent, CA, USA). Analysis was performed using LIMMA [40] as follows. Background correction was applied, spots from duplicate probes were averaged and log transformed. Between-array quantile normalization was then applied to the log transformed spot intensities. A moderated t-test on the normalized log intensities was performed to identify differentially expressed genes and the False Discovery Rate (FDR) used to control for multiple testing. Genes were ranked using the B-statistic (B-stat) method where both fold change and variance of signals in replicates are used to determine the likelihood that genes are truly differentially expressed. A threshold in the B- stat of 0.0 was adopted as genes with a B score >0 have a >50% probability of being truly differentially expressed [41]. All experimental data are available online at the NCBI Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo/) submission number GSE26759. All data is MIAME compliant.

Quantitative Real-Time PCR

Oligonucleotides (Table 3) were designed using Primer Express 1.0 software (ABI Prism; PE Biosystems) and are named according to the open reading frame (ORF) being amplified. All real-time PCR reactions were performed in a 25 µl mixture containing 1 in 5 dilution of cDNA preparation (5 µl), 10× SYBR Green buffer (PE Applied Biosystems) and 5 µM of each primer. We used 16S RNA as the control in each quantitative PCR. Amplification and detection of specific products were performed with the ABI Prism 7700 sequence-detection system (PE Applied Biosystems) with the following cycle profile: 95°C for 10 min, followed by 45 cycles of 95°C for 15 sec and 60°C for 1 min. Data were analyzed with ABI prism 7700 (version 1.7) analysis software. Relative gene expression between the P12ΔmodH5 mutant and wild-type P12modH5 ON and P12modH5 OFF and wild-type P12modH5 ON was determined using the 2ΔΔCT relative quantification method.

Diagrammatical representation of the 17 alleles of . BLASTn was used to identify reciprocal exchanges between the modH DNA recognition domains of the following H. pylori strains (listed in Table 1); modH1 BH13, modH2 1061, modH3 11637, modH4 1134, modH5 2A, modH6 3A, modH7 CHP7, modH8 CHP2, modH9 CHP4, modH10 219, modH11 GN760, modH12 L252, modH13 L264, modH14 SouthAfrica7, modH15 Gambia 94/24, modH16 Cuz20 and modH17 908. Each unique modH DNA recognition domain is represented as a coloured box. BLASTn matches longer than 20 nt and >90% identity were mapped on to the corresponding allele in the appropriate colour. The number above the coloured boxes corresponds to Table S1 that contains details of the start and stop positions of each exchange. The nucleotide positions correspond to the DNA recognition domain only.

(DOCX)

Click here for additional data file.

Details of matches shown diagrammatically in

(DOCX)

Click here for additional data file.