| Literature DB >> 22140385 |
Jian-Hua Chen1, Yong-Sheng Yu, Hong-Hong Liu, Xiao-Hua Chen, Min Xi, Guo-Qing Zang, Zheng-Hao Tang.
Abstract
BACKGROUND: Nearly 350 million persons worldwide are chronically infected with hepatitis B virus (HBV). Ubiquitin (Ub) is a highly conserved small regulatory protein, ubiquitous in eukaryotes, that usually serves as a signal for the target protein that is recognised and degraded in proteasomes . The Ub-mediated processing of antigens is rapid and efficient and stimulates cell-mediated immune responses. Accordingly, Ub-mediated processing of antigens has been widely used in chronic-infection and cancer studies to improve immune response.Entities:
Keywords: DNA vaccine; Hepatitis B core antigen; Ubiquitin
Year: 2011 PMID: 22140385 PMCID: PMC3227483 DOI: 10.5812/kowsar.1735143x.689
Source DB: PubMed Journal: Hepat Mon ISSN: 1735-143X Impact factor: 0.660
Primers of Ubiquitin and HBcAg
| Ub | A: CGCA | EcoR I |
| B: ATTCTTTATACGGGTCAATGT | ||
| HBcAg | C: CCTGGTCCTTCGCCTGAGAGGT | Hind III |
| D: GCG | ||
| HBcAg | E: GATA | BamH I |
| F: GCG | Hind II |
a Restriction enzyme site
b The Ub C-terminal glycine had been replaced with alanine
c HBcAg with a modified N-terminal methionine residue was replaced by arginine
d For the construction of pHBcAg plasmid, the HBcAg gene was PCR-amplified with primers
Figure 1Electrophoresis of pUb-HBcAg Digested by EcoR I and Hind III. Lane 1: pUb-HBcAg Digested by EcoR I and Hind III; Lane M1: DNA Marker 2000; Lane M2: DNA Marker 15000.
Figure 2Expression of the Plasmids. (A) Gene expression of HBcAg and Ub-HBcAg, Lane M: DNA marker 2000; Lane 1: blank plasmid pcDNA3.1 (-) transfecting COS-7 cells; Lane 2,3,5: β-actin;Lane 4: plasmid pHBcAg transfecting COS-7 cells; Lane 6: plasmid pUb-HBcAg transfecting COS-7 cells. (B) Protein expression of HBcAg (about 21 kDa), Lane 1: COS-7 cells transfected with pcDNA3.1 (-); Lane 2 and Lane 3 are the same sample: COS-7 cells transfected with pUb-HbcAg; Lane 4: COS-7 cells transfected with pHBcAg
Figure 3HBcAg-Specific IgG Titer in the Sera of Mice Immunized with Various Formulations. The initial dilution of each serum from immunized mouse was 1:100 and followed with serial of three-fold dilution for anti-HBc IgG detection. Data is from one representative experiment of three performed and is presented as the geometric mean titer ± SD (n = 8). **P < 0.01 pUb-HBcAg 100μg group.
Figure 4Detection of T Lymphocyte Proliferation Response. Data shown represent the mean and SD. **P < 0.05, *P <0.01.
Figure 5Cytokines Production in the Supernatant of Splenocytes Harvested from Immunized Mice after in Vitro Re-stimulation. Data Represent the Means ± SD (n = 8).
Figure 6Intracellular Cytokine Expression in Spleen Cells. The whole cell population was doubly stained with fluorescent material labeled using FITC-CD8α and PE-IFN-γ antibodies. The doubly stained cells were counted and analyzed by flow cytometry. The data are the mean ± SD from eight mice per group.