Literature DB >> 22073120

In vivo systematic analysis of Candida albicans Zn2-Cys6 transcription factors mutants for mice organ colonization.

Patrick Vandeputte1, Françoise Ischer, Dominique Sanglard, Alix T Coste.   

Abstract

The incidence of fungal infections in immuno-compromised patients increased considerably over the last 30 years. New treatments are therefore needed against pathogenic fungi. With Candida albicans as a model, study of host-fungal pathogen interactions might reveal new sources of therapies. Transcription factors (TF) are of interest since they integrate signals from the host environment and participate in an adapted microbial response. TFs of the Zn2-Cys6 class are specific to fungi and are important regulators of fungal metabolism. This work analyzed the importance of the C. albicans Zn2-Cys6 TF for mice kidney colonization. For this purpose, 77 Zn2-Cys6 TF mutants were screened in a systemic mice model of infection by pools of 10 mutants. We developed a simple barcoding strategy to specifically detect each mutant DNA from mice kidney by quantitative PCR. Among the 77 TF mutant strains tested, eight showed a decreased colonization including mutants for orf19.3405, orf19.255, orf19.5133, RGT1, UGA3, orf19.6182, SEF1 and orf19.2646, and four an increased colonization including mutants for orf19.4166, ZFU2, orf19.1685 and UPC2 as compared to the isogenic wild type strain. Our approach was validated by comparable results obtained with the same animal model using a single mutant and the revertant for an ORF (orf19.2646) with still unknown functions. In an attempt to identify putative involvement of such TFs in already known C. albicans virulence mechanisms, we determined their in vitro susceptibility to pH, heat and oxidative stresses, as well as ability to produce hyphae and invade agar. A poor correlation was found between in vitro and in vivo assays, thus suggesting that TFs needed for mice kidney colonization may involve still unknown mechanisms. This large-scale analysis of mice organ colonization by C. albicans can now be extended to other mutant libraries since our in vivo screening strategy can be adapted to any preexisting mutants.

Entities:  

Mesh:

Substances:

Year:  2011        PMID: 22073120      PMCID: PMC3205040          DOI: 10.1371/journal.pone.0026962

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Candida albicans is an ubiquitous dimorphic organism colonizing skin and mucosa of immuno-competent people without causing any pathologies. In contrast, it is the cause of a wide spectrum of diseases in immuno-compromized patients, ranging from benign mucosal infections such as oral thrush to disseminated candidiasis, which can be fatal. Oral and vaginal infections with C. albicans are extremely common even in weakly immuno-compromized individuals. In severe cases of immunodeficiency, C. albicans penetrates into deeper tissues and may enter the bloodstream. From the bloodstream, the fungus has the potential to invade almost all body sites and organs. Therefore, C. albicans is able to survive in radically different environments with dramatic changes in physico-chemical conditions such as oxygen and carbon dioxide tension, pH and temperature. In addition, it has to escape host immune defenses, even if they are weakened in immuno-compromized patients [1], [2]. The therapy of C. albicans infections necessitates the use of antifungal agents acting essentially against ergosterol, DNA and cell wall biosynthesis as described in details in several reviews [3], [4], [5], [6]. The exposure of fungal pathogens to antifungal agents can engage mechanisms enabling their adaptation and finally resulting in drug resistance that is associated with treatment failure. C. albicans resistance to antifungal agents is often the result of genetic alterations such as gain-of-function mutations or chromosomal rearrangements (for review see [7]), or of the formation of multicellular associations known as biofilms [8], [9]. In the case of C. albicans systemic infections, treatment failures are relatively frequent even in absence of in vitro measurable antifungal resistance in specific fungal strains, leading to a mortality rate of up to 30%. Therefore, it seems unlikely that existing antifungal agents will have an impact on the mortality rate of systemic fungal infections. A better understanding of host-pathogen interactions is necessary to develop either new drugs and/or new clinical approaches. These new therapeutic approaches may be combined with existing antifungal chemotherapies and immunotherapies [10]. Several studies have addressed this question in the past but focusing only on the host immune response involving chemokines, cytokines and effector cells [11], [12], [13], [14]. These studies often included analyses on a restricted number of genes or explored transcriptome analysis essentially by ex vivo experiments [15], [16], [17], [18], [19], [20] and one by in vivo analysis [21]. All these analyses yielded a limited perspective on the interactions between C. albicans and its host during the infectious process. Large scale reverse genetic analyses of C. albicans genes involved in environmental adaptation have been performed in vitro [22], and thus are not appropriate for the study on host-pathogen interactions. Very recently two studies performed in vivo large scale analyses of C. albicans genes involved in the infectious process [23], [24]. Nevertheless these analyses did not focus on a specific class of genes and were not exhaustive [23] or investigated heterozygous mutants of essential genes but in which the effect of the deletion of only one gene copy could not be visible [22]. Their implementation was time- and cost-consuming and could not be adapted to a pre-existing C. albicans mutant library. In this study we propose a simple way to screen directly for host colonization a collection of C. albicans Zn2-Cys6 transcription factor (TF) mutants in a murine disseminated infection model. TFs integrate several signals originating from the environment and mediate adapted responses by modulating gene transcription. Blocking a TF involved in the response to a specific host condition may disarm the adapted fungus response that otherwise allows its survival. Previous contributions confirm this hypothesis and demonstrate that in C. albicans, deletion of genes encoding for TFs result in significant decrease of virulence. These TFs are involved in (i) adaptation to oxidative stress (CAP1 and RIM101) [25], [26], [27], [28], (ii) nitrogen regulation (GAT1), and (iii) yeast to hyphae transition (CPH1, EFG1, TUP1, and CaNDT80) [10], [29], [30], [31], [32], [33]. Thus, TFs represent interesting candidates to study virulence in order to design new antifungal strategies. Among existing C. albicans TFs, the Zn2-Cys6 “zinc cluster” subclass is of particular interest since it is fungal-specific. In order to address the involvement of TF of this family in host colonization, we developed a system in which C. albicans TF mutants are analysed in pools of 10 tagged strains. After C. albicans DNA extraction from mice organs, quantitative PCR (qPCR) is performed on specific tags and thus allows the relative quantification of individual mutant in the population in infected tissues. We tested 77 mutants of specific Zn2-Cys6 TF for their potential in colonizing mice kidneys in a mouse model of systemic infection. We were able to distinguish 8 and 4 mutants with reduced and increased colonization, respectively, as compared to an isogenic wild type strain. In an attempt to identify the putative function of these TFs and to better elucidate their involvement in virulence and/or colonization, we determined in vitro susceptibilities to heat, pH and oxidative stresses as well as hyphae formation and agar invasion of these 77 strains. These phenotypic tests revealed an overall poor correlation with in vivo results, suggesting that most of these TFs may regulate the expression of yet unidentified virulence factors.

Materials and Methods

Strains and media

The C. albicans strains used in this study are listed in Supplementary File S1. These mutants are part of a larger collection of transcription factor mutants available at the Fungal Genetic Stock Center (http://www.fgsc.net/). They were selected for the presence of a fungal Zn2-Cys6 binuclear cluster DNA-binding domain (Pfam accession number PF00172, http://pfam.sanger.ac.uk/family/PF00172). The mutants were constructed by four different gene inactivation strategies (see Supplementary File S1), using two different parent strains, CAF4-2 [34] and BWP17 [35], which were both used as control strains throughout this study. Each TF mutant was transformed with a plasmid containing a barcode and was then renamed BCYi for “BarCoded Yeast” number i (see Table 1 and Supplementary File S1). Isolates were grown in complete medium YEPD (1% Bacto peptone, Difco Laboratories, Basel, Switzerland), 0.5% Yeast extract (Difco) and 2% glucose (Fluka, Buchs, Switzerland) or in minimal medium YNB (Yeast Nitrogen Base) (Difco) and 2% glucose (Fluka). When grown on solid media, 2% agar (Difco) was added. Escherichia coli DH5α was used as a host for plasmid constructions and propagation. DH5α was grown in LB (Luria-Bertani broth) or LB plates, supplemented with ampicillin (0.1 mg/ml) when required.
Table 1

Composition of the strain pools used for mice infection in this study.

barcodePool 1  =  CAF4-2 backgroundPools 2 to 5  =  BWP17 background
Pool1Pool2Pool3Pool4Pool5
Parental strainBCY number* Orf mutatedParental strainBCY number* Orf mutatedParental strainBCY number* Orf mutatedParental strainBCY number* Orf mutatedParental strainBCY number* Orf mutated
STM11DSY16911orf19.7374---DSY336517orf19.7319DSY3418-148orf19.4288HZY2966orf19.3012
STM20DSY17623orf19.166DSY3429-134orf19.1035DSY3411-219orf19.2423DSY3419-150orf19.4450HZY4468orf19.6203
STM43DSY289275orf19.2647DSY3436-536orf19.3405DSY3412-221orf19.255DSY3420-152orf19.5924HZY5970orf19.6038
STM209ACY17615orf19.3188DSY3437-538orf19.7372HZY34164orf19.5133DSY3421-154orf19.5940HZY6072orf19.5849
STM219DSY32977orf19.1499DSY3447-1140orf19.1718DSY3414-123orf19.3252DSY3424-656orf19.2808HZY6174orf19.4649
STM224DSY32989orf19.6817HZY2342orf19.6985DSY3415-125orf19.4145DSY3425-958orf19.4524HZY6376orf19.2623
STM227PVY140166orf19.1168HZY2444orf19.7371DSY3416-127orf19.4166DSY3426-260orf19.2748HZY6778orf19.3190
STM232---HZY2846orf19.4766DSY3417-129orf19.4225DSY3427-362orf19.3876DSY416080orf19.7381
STM6CAF4-211WTBWP1731WTBWP1731WTBWP1731WTBWP1731WT
STM240DSY210113 CMP1 DSY434382 CMP1 DSY434382 CMP1 DSY434382 CMP1 DSY434382 CMP1

Highlighted in grey are ORF mutated in two separated strains.

*Barcoded yeast number.

Highlighted in grey are ORF mutated in two separated strains. *Barcoded yeast number.

Yeast transformation

Yeast transformation was performed as described previously [36].

Phenotypic tests

Eight different in vitro phenotypes, putatively relevant for virulence and/or colonization in the host, were assessed for each of our mutants by comparison with their wild type parental strains. These phenotypic tests were performed by serial dilutions of fungal cultures onto solid agar YEPD-based plates. Yeast cultures were grown overnight in liquid YEPD and diluted to a density of 1.5×105 cells/ml. Two serial 10-fold dilutions were performed to a final dilution containing 1.5×103 cells/ml. Four microliters of each dilution were spotted onto YEPD-based plates and incubated for 24 to 72 h depending on the condition tested. Following this large scale screening, a refined screen was performed for mutants with a phenotype differing from the wild type. For that purpose, the same conditions were used except that six serially 5-fold dilutions were spotted on agar plates. First, heat susceptibility was tested by incubation at 42°C as compared to 35°C which corresponds to the reference condition. We also determined the susceptibility of our mutants to alkaline pH (pH 8.3 was achieved by adding 50 mM of HEPES pH 8.5 and 25 mM NaOH) or acidic pH (pH 3.35 was achieved by adding 50 mM of HEPES pH 1.9). Third, we assessed the susceptibility to 1 mM and 5 mM H2O2. Lastly, filamentation phenotype was determined by, either plating each mutant onto YEPD agar plates supplemented with 10% of fetal calf serum (FCS), growing cells in 10% FCS liquid YEPD medium for 4 h, and determining agar invasion capacity after 48 h of growth in YEPD agar plates. All plates were recorded for phenotypes after 24 and 48 h of incubation except for FCS-supplemented plates, which were analyzed after 72 h of incubation. For cells grown in liquid medium, pictures were taken using an Axiovert200 Zeiss inverted microscope with a 200× magnification. This screening was repeated twice from independent overnight cultures to assess the reproducibility of the results.

Construction of plasmids

Tagged-plasmids were constructed from CIp30 [37] and were carrying STM tags consisting in random 40-nucleotides sequences used in C. neoformans [38], [39]. We chose 10 distinct STM tags with numbers 6, 11, 20, 43, 209, 219, 224, 227, 232 and 240 (see Table 2 for nucleotide sequences). First, complementary oligomers (Table 2) containing the 40-mer sequence of the STM tag flanked by the cohesive ends with NotI and DraIII restriction sites were hybridized and digested by DraIII and NotI. Then, the double-stranded oligomers were cloned into pKS(+) (Stratagene) at DraIII and NotI sites and re-cloned into CIp30 at ScaI and NotI sites. This cloning step was necessary since we discovered after sequence analysis of CIp30 near the NotI site that the published CIp30 map was not designed from a pKS(+) backbone but from a pKS(−) backbone. Therefore we had to subclone the double-stranded oligomers in a pKS(+) backbone to avoid the problem of the non-palindromic DraIII site. Finally 10 plasmids were generated from the CIp30 backbone containing each a specific tag and were called CIp30-STM6, −11, −20, −43, −209, −219, −224, −227, −232 and −240.
Table 2

Sequences of oligonucleotides used in this study.

Primer nameSequence
Primers for STM tag
STM6-Fgtgccatagctaccacacgatagctccccctagccccctacacgc
STM6-Rggccgcgtgtagggggctagggggagctatcgtgtggtagctatggcacgta
STM11-Fgtgcacacgaaataaacctctaaacctcccccacaccaccccggc
STM11-Rggccgccggggtggtgtgggggaggtttagaggtttatttcgtgtgcacgta
STM20-Fgtgatcaacaactaccgaccacgatcgacatccaacgccccatgc
STM20-Rggccgcatggggcgttggatgtcgatcgtggtcggtagttgttgatcacgta
STM43-Fgtgccataaaaaaactagacccagctaccaatcacgctaccatgc
STM43-Rggccgcatggtagcgtgattggtagctgggtctagtttttttatggcacgta
STM209-Fgtgctatcactctagcaatagcacaatctcgctctacccataagc
STM209-Rggccgcttatgggtagagcgagattgtgctattgctagagtgatagcacgta
STM219-Fgtgccctaaaaccctacagcaatcacgatataccgctcccgacgc
STM219-Rggccgcgtcgggagcggtatatcgtgattgctgtagggttttagggcacgta
STM224-Fgtgggtggtttgtgtgggtagagcgggggattgggggttaggggc
STM224-Rggccgcccctaacccccaatcccccgctctacccacacaaaccacccacgta
STM227-Fgtgtggtcgcgggagatcgtggtttagagggagcgcggtctatgc
STM227-Rggccgcatagaccgcgctccctctaaaccacgatctcccgcgaccacacgta
STM232-Fgtgatggcgttgtcgatatggttaggtagcgaggtcggttgcggc
STM232-Rggccgccgcaaccgacctcgctacctaaccatatcgacaacgccatcacgta
STM240-Fgtgggcgctcgatcgcgggtgggtgttggatcggggtggatgggc
STM240-Rggccgcccatccaccccgatccaacacccacccgcgatcgagcgcccacgta
Primers for qPCR detection
Forward-primerccgtctatcagggcgatg
Primer-STM6-revcgcgtgtagggggcta
Primer-STM11-revcgccggggtggtgt
Primer-STM20-revcatggggcgttggatg
Primer-STM43-revgccgcggccgcatggtagcg
Primer-STM209-revcggccgcttatgggta
Primer-STM219-revcggccgcgtcgggagcggta
Primer-STM224-revgcccctaacccccaatc
Primer-STM227-revcgcggccgcatagac
Primer-STM232-revgccgcaaccgacctc
Primer-STM240-revtcgggatctaggcttgg
Primer-STM240-fortacgtgggcgctcgat
Probes for qPCR detection
probeLNA-STM6* [6FAM]tac+Cac+Acg+Ata+Gctcc[TAM]
probeDNA-STM11[6FAM]CACACGAAATAAACCTCTAAACCTCCC[TAM]
probeLNA-STM20* [6FAM]caa+Caa+Cta+Ccg+Accacga[TAM]
probeLNA-STM43* [6FAM]aa+Cta+Gac+Cca+Gctacc[TAM]
probeDNA-STM209[6FAM]ATCACTCTAGCAATAGCACAATCTCGC[TAM]
probeLNA-STM219* [6FAM]ccc+Tac+Agc+Aat+Cacga[TAM]
probeDNA-STM224[6FAM]GGTGGTTTGTGTGGGTAGAGCGGG[TAM]
probeDNA-STM227[6FAM]TCGCGGGAGATCGTGGTTTAGAGG[TAM]
probeDNA-STM232[6FAM]ATGGCGTTGTCGATATGGTTAGGTA[TAM]
probeLNA-STM240* [6FAM]catccaccc+Cgatccaac[TAM]

*: For STM6, STM20, STM43, STM219 and STM240, Locked Nucleic Acid (LNA) were used as indicated (+) in the oligonucleotide sequence in order to reach a Tm suitable for qPCR reactions.

*: For STM6, STM20, STM43, STM219 and STM240, Locked Nucleic Acid (LNA) were used as indicated (+) in the oligonucleotide sequence in order to reach a Tm suitable for qPCR reactions. For the construction of the orf19.2646 revertant strains, pAC249 was designed to re-introduce a wild-type orf19.2646 allele at its genomic locus. For this purpose, the SAT1 gene was amplified from pSFS2 using the primers Sat1-Not (5′-ATAAGAATGCGGCCGCGTCAAAACTAGAGAATAATAAAG-3′) and Sat1-BamHI (5′-GCAAAGGATCCCACCACCTTTGATTGTAAAT-3′). This fragment was introduced into pBluescript KS+ by BamHI and NotI to yield pDS1551. Next, orf19.2646 was amplified using the primers orf19.2646-5-for (5′-CGCGAGGTACCTCAATCAAGCCTCCTGTACC-3′) and orf19.2646-Rxho (5′-CGCGACTCGAGTGTACACAAAACTTAGAACC-3′). The resulting PCR fragment was cloned into pDS1551 by KpnI and XhoI to yield pAC249.

Construction of orf19.2646 revertant and control strains

The plasmid pAC249 was introduced into the STM-tagged orf19.2646 mutant strain (BCY152) by SpeI digestion allowing integration at the orf19.2646 genomic locus. In parallel, the parental plasmid pDS1551 was introduced into BCY152 and into the tagged-BWP17 (BCY31) strains at the ACT1 locus by MunI digestion.

Animal experiments and Ethics Statement

All animal experiment were performed at the University of Lausanne and at the University hospital center under the surveillance and with the approval of the institutional Animal Use Committee: Affaires Vétérinaires du Canton de Vaud, Switzerland; with the authorization n° 1734.2 and 1734.3, according to the decree 18 of the federal law on animal protection. Strains were grown in individual tubes for 16 hours under agitation at 30°C in YNB. Each strain was then diluted 100-fold times in YEPD and grown overnight under agitation at 30°C. Overnight cultures were washed twice in PBS and resuspended in 5 ml PBS. Concentration of each culture was measured and each strain was diluted in PBS at a concentration of 2×106 cells/ml. For injection of the 10 strains pools, one ml of each diluted strain was mixed. Aliquots of each single culture and of the mix were plated onto YEDP in order to count colony-forming units (CFU). Female BALB/c mice (20 to 25 g; Charles River France) were housed in ventilated cages with free access to food and water. To establish C. albicans infection, mice were injected into their lateral tail vein with 250 µl of saline suspensions containing 5×105 CFU of C. albicans mixed strains. Groups of three mice were established for each pool or single strain infection. Group of four to five mice were used for orf19.2646 revertant experiments. Mice were monitored daily and were sacrificed three days after infection by CO2 inhalation. Kidneys were excised aseptically and weighted. The two kidneys were homogenized together in 5 ml sterile water and 100 µl of organ homogenates were used to count CFUs. The remaining homogenates were centrifuged and pellets were frozen overnight for further analyses. To analyse the CFU results, 10-fold dilutions of kidney extracts were plated onto YEPD supplemented with 50 µg/ml of chloramphenicol. Statistical significance of single infections was determined with the Kruskal-Wallis test.

Preparation of C. albicans DNA from mice kidneys

Frozen pellets of kidneys homogenates were thawed slowly at room temperature, resuspended in 2 ml of water and then dispatched equally in 2 ml screw caps tubes. Tubes were centrifuged for 1 min at maximum speed. One pellet was kept for further analyses. The other pellets were washed three times in lysis buffer (2% Triton X-100, 1% SDS, 100 mM NaCl, 10 mM Tris HCl pH 8, 1 mM EDTA) in order to eliminate mice tissue debris. Yeast cells were resuspended in 200 µl of lysis buffer supplemented with one volume of phenol-chloroform. Cells were next disrupted by adding one volume of glass beads and by agitating the solution for 15 seconds at a power of 5 in a Fastprep 24 instrument (MP Biomedical, France). Suspensions were then centrifuged for 10 min at maximum speed. The aqueous phase was recovered and DNA was precipitated with 2 volumes of absolute ethanol. Pellet was resuspended in 50 µl of TE (10 mM Tris HCl pH 7.5, 1 mM EDTA) in which 10 µl of RNase A (Roche) (10 mg/ml) was added. Solution was incubated for 30 min at 37°C. Ten µl of proteinase K (Sigma) (10 mg/ml) were added and solution was incubated for 30 min at 65°C. DNA was then precipitated and resuspended in TE. After overnight incubation at 4°C, the concentration of DNA was measured using a Nanodrop ND1000 equipment (ThermoScientific, DE, USA).

Quantitative real-time PCR (qPCR) and normalization

qPCR reactions were performed with 0.2 µM of each primer, 0.1 µM of probe and iTaq supermix with ROX (BioRad, Reinach, Switzerland) according to the manufacturer's instructions. Cycling conditions were as following: 2 min at 50°C, 3 min at 95°C followed by 40 cycles of 15 s at 95°C and 1 min at 60°C. Amplification and detection of PCR products were performed with a Step One Plus™ (Applied Biosystems, CA, USA). Reactions were performed in a total volume of 25 µl. Data were analysed using the Step One software V2.1 (Applied Biosystems, CA, USA). In each run, a PCR control was performed with yeast DNA extract from kidneys of non-infected mice. The signals obtained gave the noise level of the qPCR. Each sample showing a CT for STM6 (wild type strain) higher than that of the non-infected mice reaction was rejected since C. albicans DNA extraction from kidneys probably failed. Such samples were eliminated for further analysis. Standard curves were created with 10-fold serial dilutions (105 to 101 copies) of the ten CIp30-STM plasmids. These ten standard curves (one for each barcode) were used to determine the copy number (Qx) of the different barcodes carried by strains of each pool from infected mice kidney (QxINVIVO) or from 24h YEPD cultures (QxINVITRO). To determine an increase or decrease of growth of strains in vivo as compared to in vitro conditions, the “in vivo/in vitro” ratio (dQx =  QxINVIVO/QxINVITRO) was calculated for each STM barcoded strain. This dQx ratio calculation allows the normalization of the in vivo data to the in vitro growth of each mutant strain. Finally, to obtain the colonization score of each strain (S  =  log2 (dQx/dQSTM6)), each dQx ratio was normalized to the dQSTM6 of its pool in order to normalize the results of all pools. The STM6 barcode was contained in isogenic wild type strains present in all the pools as positive control.

Results

In order to discover new C. albicans virulence factors and to help elucidating novel elements in host-pathogen interactions, we propose here to screen a collection of C. albicans transcription factor mutants in a murine disseminated infection model. The murine disseminated infection model is a conventional experimental model to study C. albicans pathogenicity. In this model, several organs such as brain, spleen, lungs, liver and kidneys are infected by C. albicans. We planned to use this model of infection to evaluate organ colonization by Zn2-Cys6 TF mutant strains. For this purpose, we used mutants from an already existing collection containing 239 mutants corresponding to almost all the mutants of non-essential TF genes of C. albicans [40], [41], [42]. To reduce the number of animals used in this study, the 77 Zn2-Cys6 TF mutant strains were tested by pools as described in Figure 1 and Table 1. We developed a strategy to tag strains of a pool with 40-mers barcodes enabling their specific and individual detection (see Material and Methods and Figure 2). This original strategy of screening limits the number of tags, primers and probes to detect each strain in a pool and thus reduces considerably the costs of screening.
Figure 1

Flow chart describing the principal steps (A to E) of in vivo screening of the TF mutant collection.

A: To enable the simultaneous testing of several mutants in animals, strains are tagged with 40 nucleotides barcodes. B: Mice are infected with pools of 10 barcoded strains. C: In parallel, pools are grown 24-hours in vitro. D: C. albicans DNA are extracted from mice kidneys and in vitro co-culture. E: Each barcoded mutant of the pool is relatively quantified by real-time qPCR in DNA extracted from mice organs and in vitro co-cultures.

Figure 2

CIp30-STM6 detection.

Details of the CIp30 plasmid sequence, in which the barcode (here STM6) was cloned between DraIII and NotI restriction sites. The localization of the STM6 barcode (purple), the position where the Taqman probe specific for STM6 is hybridizing (red) and the positions of forward (dark green) and reverse primers (light green) are indicated. Note that the reverse primer hybridizes at the 3′-extremity of the barcode and thus enhances the specificity of detection.

Flow chart describing the principal steps (A to E) of in vivo screening of the TF mutant collection.

A: To enable the simultaneous testing of several mutants in animals, strains are tagged with 40 nucleotides barcodes. B: Mice are infected with pools of 10 barcoded strains. C: In parallel, pools are grown 24-hours in vitro. D: C. albicans DNA are extracted from mice kidneys and in vitro co-culture. E: Each barcoded mutant of the pool is relatively quantified by real-time qPCR in DNA extracted from mice organs and in vitro co-cultures.

CIp30-STM6 detection.

Details of the CIp30 plasmid sequence, in which the barcode (here STM6) was cloned between DraIII and NotI restriction sites. The localization of the STM6 barcode (purple), the position where the Taqman probe specific for STM6 is hybridizing (red) and the positions of forward (dark green) and reverse primers (light green) are indicated. Note that the reverse primer hybridizes at the 3′-extremity of the barcode and thus enhances the specificity of detection.

In vitro detection of barcoded C. albicans strains

A pool of infection contained ten strains: eight strains of the TF mutant collection, a wild type strain as a positive control and an avirulent strain (a cmp1Δ mutant) as a negative control. Each strain of the pool was tagged with a barcode consisting of a unique 40 oligonucleotides sequence (Table 2) selected among STM (Sequence Tag Mutagenesis) tags previously used in C. neoformans [38], [39]. Each barcode was cloned in a C. albicans optimized plasmid (CIp30) [37] and transformed in TF mutant strains as indicated in Table 1. Ten sets of Taqman probes and primers were designed as presented in Figure 2 for STM6 in order to specifically detect each barcode. Our first attempt was to specifically detect each barcode in vitro. For this purpose, the ten STM-CIp30 plasmids were introduced into the wild type strain BWP17. We thus obtained ten strains differing only by their barcodes. Using DNA from in vitro culture of each strain and from co-culture of all strains, we were able to detect each strain specifically (data not shown). Our second attempt was to determine the limit of detection of a strain within a pool. The DNAs of the ten BWP17-tagged strains, except the one carrying the STM11-tag, were mixed in an equal amount. The DNA of the STM11-tagged strain was diluted to a concentration of 10 ng/µl and 10-fold serially diluted to reach a concentration of 0.01 ng/µl. Each dilution was mixed with 10 ng of pool DNA. STM11 was detected specifically in the different samples (Figure 3). BWP17-STM11 DNA can be detected even if 500-fold diluted in the pool as compared to other DNAs (Figure 3).
Figure 3

Limit of detection of a given barcoded strain in a pool.

Signal curves of qPCR over cycle numbers: samples contain 10 ng of the DNA of nine barcoded strains equally mixed and 10-fold serial dilutions of the DNA (from 200 to 0.02 ng) of the strain with the barcode STM11 (Orange). Samples contain only 10-fold serial dilution of the DNA (from 200 to 0.02 ng) of the strain with the barcode STM11 (Blue). No template control corresponds to the limit of DNA detection of the assay (Black).

Limit of detection of a given barcoded strain in a pool.

Signal curves of qPCR over cycle numbers: samples contain 10 ng of the DNA of nine barcoded strains equally mixed and 10-fold serial dilutions of the DNA (from 200 to 0.02 ng) of the strain with the barcode STM11 (Orange). Samples contain only 10-fold serial dilution of the DNA (from 200 to 0.02 ng) of the strain with the barcode STM11 (Blue). No template control corresponds to the limit of DNA detection of the assay (Black). The set of ten barcoded plasmids, primers and probes designed for their detection represents therefore a powerful tool optimized for the in vitro qPCR detection of a given C. albicans tagged strain within a mixed population.

Detection of C. albicans barcoded strains in vivo

The subsequent test was to assess the detection of each barcode in vivo. We first determined the threshold above or under which a strain may be considered as colonizing mice organs differently than the wild type. For this purpose a “BWP17 in vivo pilot assay” was performed with a pool containing ten BWP17-tagged strains as described above. This in vivo pilot assay was performed three times with groups of three mice. At day three post-infection, which is the minimal time for C. albicans required to complete a systemic infection [43], mice kidneys were recovered. C. albicans DNA extraction from mice kidneys was optimized [44] to reduce contamination by mammalian DNA. In parallel, C. albicans DNA was also extracted from a 24 h in vitro co-culture in 50 ml YEPD of the same inoculum (250 µl). The relative abundances of each DNA were quantified by qPCR. The detection of each barcode from mice kidneys was successful. The score of infection of each BWP17-tagged strain was calculated relative to that of the BWP17-STM6 strain as described in Material and Methods. When the results of the three independent experiments were pooled, the medium score has a value of −0.05 (± 0.72) (Supplementary File S1). This value, to which ± two standard deviations were added (1.39 to −1.49), corresponds to the threshold above or under which a strain has a different colonization potential as compared to the wild type. Each pool contains a cmp1Δ strain as a negative control of infection. CMP1 encodes for the catalytic subunit of calcineurin. Previous studies extensively described that strains lacking a functional calcineurin are avirulent and unable to colonize mice organs in the model of disseminated infection [45], [46], [47]. To validate our screening system, we verified whether or not such a strain could be detected from infected mice tissues. For this purpose, we performed a so called “CMP1“ pilot experiment, in which a pool containing a BWP17-STM6 tagged strain and nine cmp1Δ strains carrying the other barcodes was injected in groups of three mice. The cmp1Δ mutants (all tags combined) showed a score of −4.02 (± 2.12) (data not shown), thus confirming that the system was able to detect a strain with a colonization score lower than the wild type. These in vivo pilot assays demonstrated that our strategy of screening was functional in vivo and also defined the limits of detection and interpretation of the results.

Analysis of ten pools of Zn2-Cys6 TF mutant strains

The screening of the 77 C. albicans Zn2-Cys6 mutant strains in a mouse model of systemic infection was performed by designing ten pools of infection as detailed in Table 1. These 77 mutants correspond to only 74 mutated genes since three genes were mutated twice independently (i.e. orf19.5133, orf19.3012 and orf19. 3876) (Supplementary File S1). All mutant strains were transformed with plasmids derived from STMx-CIp30. These plasmids carrying the STM-tags allow also to re-introduce URA3, HIS1 or ARG4 markers in a neutral locus for virulence [37]. Pool 1 was containing nine strains with a CAF4-2 background (Table 1 and Supplementary File S1). The seven Zn2-Cys6 TFs and the cmp1Δ mutants of the pool were constructed using URA blaster cassettes in the CAF4-2 background [48], [49], [50]. Therefore, CAF4-2 containing STM6-CIp30 was the positive control. The negative control was DSY2101 (cmp1Δ) containing STM240-CIp30 (Table 1). The nine other pools contained isolates with a BWP17 background. Each pool except pools 2 and 6 contained eight Zn2-Cys6 TF mutants (only seven for pools 2 and 6), BWP17 tagged with STM6 and DSY4343 (cmp1Δ) tagged with STM240. Mutants of these pools were obtained using different strategies as detailed in Supplementary File S1. Our first analysis was performed on cmp1Δ strains. When merging the scores of BCY82 (cmp1Δ in the BWP17 background) from pools 2 to 10 and from the “CMP1 pool” as detailed above, we obtained an average score of −3.83 (± 2.42). It is important to note that in some experiments, no qPCR signals could be obtained for BCY82, probably because the DNA of this strain was under the limit of detection. This means that the DNA of this strain was at least 500-fold more diluted as compared to other DNAs of the pool that included mice DNA from kidneys. BCY13 (cmp1Δ mutant in a CAF4-2 background) showed a score of -4.15 (± 2.44) (Figure 4 and Supplementary File S1). Both scores obtained for the cmp1Δ strains (BCY82 and BCY13) were under the threshold value of −1.49 as mentioned above, thus confirming that these strains are less colonizing mice tissues than the wild type independently of the genetic background. After setting the detection limits of our in vivo screening system, we determined the colonization scores of all strains of the Zn2-Cys6 TF mutant collection in comparison to their isogenic wild type strains. The scores of all strains are presented in Figure 4 and detailed in Supplementary File S1. The majority of the strains have a score within the interval delimited by the “BWP17 pool” assay, indicating that their colonization scores were not significantly different from the wild type strains. In contrast, four strains (as referred to hyper-colonizers), i.e. BCY27, BCY150, BCY160 and BCY162 showed scores of 2.36, 3.23, 2.42 and 3.18, respectively, and were above the “BWP17 pool” limit. This suggests a higher colonization capacity than the wild type. Next, eight strains (as referred to hypo-colonizers), i.e. BCY36, BCY21, BCY164, BCY88, BCY112, BCY122, BCY148 and BCY152 showed scores below the “BWP17 pool” limit (−3.2, −2.57, −2.34, −1.65, −3.49, −2.08, −2.11, and −2.08, respectively). These data suggest that these strains are poor colonizers as compared to the wild type.
Figure 4

Strain scores of mice kidney colonization.

S scores are plotted for each tested mutant. The scores were defined as the values obtained by the equation: S score  =  log2(dQx/dQSTM6), where Qx is the relative quantification of the different C. albicans DNA as compared to a standard curve included in each qPCR reaction for a given barcode. A first normalization was performed to limit the “pool effect” on the strain growth and the PCRs efficacy effect by the equation dQx =  QxINVIVO/QxINVITRO with X corresponding to a given barcode. A second normalization was performed based on the wild type strain in order to compare each pool with each other. Since the barcode STM6 was carried by the wild type strain in each pool as positive control, the following equation was applied: dQx/ΔQSTM6. The cmp1Δ strains carried always the barcode STM240. Orf19.5133 was mutated in two independent strains. Strain BCY158 yielded no result since qPCR signals were under the detection threshold.

Strain scores of mice kidney colonization.

S scores are plotted for each tested mutant. The scores were defined as the values obtained by the equation: S score  =  log2(dQx/dQSTM6), where Qx is the relative quantification of the different C. albicans DNA as compared to a standard curve included in each qPCR reaction for a given barcode. A first normalization was performed to limit the “pool effect” on the strain growth and the PCRs efficacy effect by the equation dQx =  QxINVIVO/QxINVITRO with X corresponding to a given barcode. A second normalization was performed based on the wild type strain in order to compare each pool with each other. Since the barcode STM6 was carried by the wild type strain in each pool as positive control, the following equation was applied: dQx/ΔQSTM6. The cmp1Δ strains carried always the barcode STM240. Orf19.5133 was mutated in two independent strains. Strain BCY158 yielded no result since qPCR signals were under the detection threshold. The four hyper-colonizers strains correspond to mutations of orf19.4166, orf19.6781, orf19.1685 and orf19.391. The orf19.4166 (ZCF21), orf19.6781 (ZFU2) and orf19.1685 (ZCF7) encode TFs with yet unknown functions. Interestingly, orf19.391 (also called UPC2) encodes a TF regulating genes of the ERG family involved in sterol biosynthesis and therefore plasma membrane integrity. Upc2 was also reported to be involved in antifungal resistance due to acquisition of gain-of-function mutations [51], [52], [53], [54]. The eight hypo-colonizer strains correspond to mutations of orf19.3405 (ZCF18), orf19.255 (ZCF1), orf19.5133 (ZCF29), orf19.2747 (RGT1), orf19.7570 (UGA3), orf19.6182 (ZCF34), orf19.3753 (SEF1) and orf19.2646 (ZCF13). Interestingly, orf19.5133 encodes a TF with yet unknown function and is deleted and interrupted in strains BCY164 (pool 3) and BCY158 (pool 10), respectively. BCY164 (orf19.5133) contained the tag STM209 and showed a score of −2.34 (± 1.13). BCY158, tagged with STM224, did not appear as hypo-colonizer since no signal above the background was obtained by qPCR for this strain. Five other genes including orf19.3405, orf19.255, orf19.6182, UGA3 and orf19.2646 encode Zn2-Cys6 TF with yet unknown function. These TFs have been analysed in large scale screening of mutants or found as target genes in transcriptional microarray analyses [22], [24], [42], [55]. RGT1 encodes a transcriptional repressor involved in the regulation of glucose transporter genes [56]. SEF1 encodes a TF involved in iron assimilation and survival in stationary phase at 30°C [57], [58].

Single strain infections

In order to validate our previous results and in order to eliminate false positives due to pool effect in the infections, we performed single strain infection with seven hypo-colonizers and BCY31 (BWP17 tagged with STM6). As in the case of pools experiments, groups of 3 mice were infected intravenously with 5×105 cells of C. albicans mutant strains. Kidney colonization was next analysed by counting C. albicans CFUs in kidneys at three days post-infection as performed in the pool experiments. Results are presented in Figure 5. We observed that fungal burdens of all mutant strains were lower than the wild type. Nevertheless, only mutants for orf19.3405 and orf19.2646 showed a significant statistical difference in tissue colonization as compared to BCY31 (8.11×103 and 1.09×104 CFU/g kidney for mutants and 1.24×107 for BCY31). Therefore, these two mutants constitute interesting candidates for further analyses.
Figure 5

Single strain infections.

Seven strains with the lowest scores of colonization in the pool experiments were tested for kidney colonization by single strain mice infection. Groups of three mice were infected with a unique strain. Three days after infection, kidneys were harvested and CFU were measured. Symbol (*) indicates a p-value ≤ 0.05 by the Kruskal-Wallis test.

Single strain infections.

Seven strains with the lowest scores of colonization in the pool experiments were tested for kidney colonization by single strain mice infection. Groups of three mice were infected with a unique strain. Three days after infection, kidneys were harvested and CFU were measured. Symbol (*) indicates a p-value ≤ 0.05 by the Kruskal-Wallis test.

In vitro phenotypes of Zn2-Cys6 TF mutants

In an attempt to correlate in vivo results with putative functions of identified TFs, the whole collection was screened for six phenotypes potentially relevant for in vivo growth by comparing each mutant with its parent wild type strain. First, we determined resistance to heat and oxidative stress by incubation at 42°C and in H2O2-supplemented medium, respectively, and growth capacities at alkaline or acidic pH of each mutant on rich media. Considering the environmental conditions that C. albicans faces within the host, an enhanced or reduced resistance to heat-, oxidative- or pH-stresses may give indications regarding the involvement of a given Zn2-Cys6 TF in virulence and/or colonization abilities. Since switching from the yeast to hyphal form is known to be a determinant of virulence [59], the ability of each mutant to produce true hyphae and/or pseudohyphae was also assessed. For that purpose, colony wrinkling was visually inspected after 72 h of incubation on rich media supplemented with 10% serum, which is known to induce filamentation in C. albicans [59]. Moreover, agar invasion was quantified by washing YEPD agar plates after 48 h of incubation at 35°C and by visually evaluating a decrease or an increase of invasive growth as compared to the wild type strain. Raw pictures of this screening are provided as supplementary data (see Supplementary File S2, S3, S4, S5, S6, S7). Lastly, pictures of cells grown for 4 h in YEPD liquid media supplemented with 10% FCS were analyzed for the presence of true hyphae. Overall, 39 out of 74 mutants displayed an altered phenotype regarding the six criteria tested here (Tables 3, Figure 6 and Supplementary File S1, sheet “phenotype”). Only a few mutants displayed altered susceptibilities to heat, pH and H2O2. Indeed, none of the mutants showed impaired growth at acidic pH and only one of them, SEF1, exhibited decreased growth at alkaline pH. Likewise, only one mutant, orf19.3188 (TAC1) was hypersusceptible to H2O2. Two mutants had a decreased growth capacity at 42°C, namely orf19.5849 (CWT1), and orf19.2646 (ZCF13). The largest phenotypic alterations were observed in morphology-discriminative conditions since among the 39 mutants displaying a phenotype in our screen, 28 were selected for their abnormal morphology on solid YEPD 10% FCS media and/or their altered ability to invade agar (Figure 6 and Supplementary file S1, sheet “phenotype”). Out of 22 mutants with abnormal morphology, 13 produced less wrinkled colonies as compared to their respective wild-type parents and 9 an increased colony wrinkling. Regarding agar invasion ability, 6 and 5 mutants showed increased and decreased invasion in the solid substrate, respectively, as compared to the wild-type (Figure 6 and Table 3).
Table 3

ORFs deleted in the Zn2Cys6 TF mutants with altered phenotypes on solid media as compared to wild type strain.

Altered phenotype
Increased susceptibility toAgar invasionColony wrinklingHyphae formation
HeatOxidative stressAlkaline pHIncreasedDecreasedIncreasedDecreasedIncreasedDecreased
orf19.2646orf19.3188orf19.3753orf19.2623orf19.2447orf19.431orf19.1255orf19.1168orf19.166
orf19.5849orf19.2646orf19.4649orf19.1497orf19.1685orf19.3305orf19.1685
orf19.3190orf19.5251orf19.1718orf19.2280orf19.3405orf19.2647
orf19.5097orf19.6985orf19.2646orf19.3190orf19.4649orf19.2747
orf19.5729orf19.7374orf19.2808orf19.4998orf19.4766orf19.3188
orf19.5992orf19.3127orf19.5133orf19.5097orf19.3753
orf19.3308orf19.5251orf19.5729orf19.3986
orf19.5097orf19.5548orf19.6038orf19.4998
orf19.6781orf19.6985orf19.6985orf19.5133
orf19.6888orf19.7374orf19.7381orf19.5849
orf19.7381orf19.7374
orf19.7583
Figure 6

Filamentation, invasive growth and susceptibility to heat, oxidative and pH stresses of the Zn2-Cys6 TF mutants.

Pictures of serial dilutions assay plates for the Zn2-Cys6 TF mutants displaying an in vitro phenotype (see Supplementary File S1 for phenotype details) were taken after 24, 48 or 72 h of incubation. Mutants are referenced on the left side of each panel according to the disrupted ORF number (see Supplementary File S1). Conditions of incubation are indicated on the top of the figure. (A) Reference panel attributing a score relative to wild type phenotype (score 0), is given for better visualization of differences between BWP17-based mutants and wild type regarding (B) invasion and (C) filamentation phenotypes. Since only one filamentation and one invasion altered phenotypes were observed for CAF4-2-based mutants (i.e mutant for orf19.7374), such a reference panel was not included. (D) Growth of orf19.3188 (TAC1) mutant on H2O2-containing medium. (E) Mutants with reduced growth at 42°C or (F) alkaline pH. The phenotypes of each mutant were compared with its respective parental strain, which was spotted on each plate for reference.

Filamentation, invasive growth and susceptibility to heat, oxidative and pH stresses of the Zn2-Cys6 TF mutants.

Pictures of serial dilutions assay plates for the Zn2-Cys6 TF mutants displaying an in vitro phenotype (see Supplementary File S1 for phenotype details) were taken after 24, 48 or 72 h of incubation. Mutants are referenced on the left side of each panel according to the disrupted ORF number (see Supplementary File S1). Conditions of incubation are indicated on the top of the figure. (A) Reference panel attributing a score relative to wild type phenotype (score 0), is given for better visualization of differences between BWP17-based mutants and wild type regarding (B) invasion and (C) filamentation phenotypes. Since only one filamentation and one invasion altered phenotypes were observed for CAF4-2-based mutants (i.e mutant for orf19.7374), such a reference panel was not included. (D) Growth of orf19.3188 (TAC1) mutant on H2O2-containing medium. (E) Mutants with reduced growth at 42°C or (F) alkaline pH. The phenotypes of each mutant were compared with its respective parental strain, which was spotted on each plate for reference. Liquid YEPD 10% FCS media cultures allowed the selection of 21 mutants with a modified cell morphology as compared to their parental wild type strains. Mutants with more than 80% of cells forming hyphae were scored as positive. In contrast, mutants showing less than 10% of hyphae were scored as negative (see Table 3 and Supplementary file S1, sheet “Phenotype”). Following these criteria, 11 mutants displayed almost no hyphae formation. In contrast, 10 displayed an increase in true hyphae formation. In vivo single infection experiments allowed the selection of two interesting TF (orf19.2646 and orf19.3405) mutant strains for their hypo-colonizer phenotype in kidneys. Mutant for orf19.2646 produced highly wrinkled colonies on YEPD agar medium supplemented with 10% FCS and also better invaded the agar as compared to the wild-type. Mutant for orf19.3405 showed a growth deficiency in all conditions tested (Figure 6) but displayed an increased production of true hyphae in liquid YEPD supplemented with 10% FCS (Table 3 and Supplementary file S1).

Reversion of the orf19.2646 deletion phenotypes

We further investigated orf19.2646 since it appeared as a promising candidate to discover yet unknown virulence factors. To confirm that both in vitro and in vivo phenotypes observed were effectively due to the interruption of orf19.2646, we constructed a revertant strain by re-introduction of a wild-type gene at the genomic locus in the BCY152 background (see Material and Methods). As shown in Figure 7A, the revertant strain exhibited as the parent wild-type no growth deficiency at 42°C and no longer displayed a wrinkled colony morphology in contrast to the mutant strain. Likewise, animal experiments confirmed that the re-introduction of orf19.2646 restored a colonization capacity comparable to the wild-type strain which was also statistically different from the mutant (Figure 7B).
Figure 7:

Phenotypes of orf19.2646 mutant and revertant strains.

(A) In vitro growth in YEPD agar medium at either 35 or 42°C for 24 h. Enhanced resolution picture was taken after 48 h of incubation at 35°C to better visualize the wrinkled colony phenotype. (B) In vivo colonization assay. Groups of four to five mice were infected with either wild-type, orf19.2646 mutant or revertant strains. Three days after infection, kidneys were harvested and CFU were measured. Symbol (*) and (**) indicate a p-value ≤ 0.05 and 0.01, respectively, as determined by the Kruskal-Wallis test.

Phenotypes of orf19.2646 mutant and revertant strains.

(A) In vitro growth in YEPD agar medium at either 35 or 42°C for 24 h. Enhanced resolution picture was taken after 48 h of incubation at 35°C to better visualize the wrinkled colony phenotype. (B) In vivo colonization assay. Groups of four to five mice were infected with either wild-type, orf19.2646 mutant or revertant strains. Three days after infection, kidneys were harvested and CFU were measured. Symbol (*) and (**) indicate a p-value ≤ 0.05 and 0.01, respectively, as determined by the Kruskal-Wallis test.

Discussion

In this work, we screened at large scale the role of C. albicans Zn2-Cys6 TFs in organs colonization using a mouse model of systemic infection. For this purpose, we developed a screening strategy infecting mice with pools of ten strains tagged with a set of ten barcodes consisting of 40-nucleotides sequences. Among the 77 Zn2-Cys6 TF mutants tested corresponding to 74 mutated ORF, four resulted in a hyper-colonizer phenotype while eight showed hypo-colonizer phenotype (see Supplementary file S1). Recently, similar large-scale in vivo mutant screening were performed by Noble et al. [24] and Chamilos et al. [55]. This last work was performed in the Toll mutant fly model, and focused on 33 TF mutants with no restriction on the TF class [55]. The mutants used came from the same TF mutant collection as used here. Twelve mutants were common between this study and ours (see Supplementary file S1, “all-scores” sheet). Among these twelve mutants, none were found hypo-colonizer in the fly model and only one (UGA3) was found hypo-colonizer in our pool experiment. The use of two distinct infection models might explain the discrepancies between both studies. The work of Noble et al. [24] was more similar to our analysis since mutant strains of this study were barcoded and were infecting mice as pools. Nevertheless, our analyses were different since Noble et al. [24] did not target a specific class of genes and developed their own strategy of screening associated to their particular mutant collection [24]. Consequently, out of the 77 Zn2-Cys6 TF mutants tested here, only 26 were common with the study of Noble et al. [24] (see Supplementary file S1, “all-scores” sheet). Three of the eight hypo-colonizers mutants, namely mutants for orf19.255 (ZCF1), orf19.6182 (ZCF34) and SEF1, were also tested in their study. Only the mutant for SEF1 showed a hypo-colonizer phenotype in both studies (Table 4). Transcriptional analyses on iron metabolism in C. albicans showed that SEF1 might be involved in iron uptake regulation [58]. Interestingly, Chen et al. [60] demonstrated recently that SEF1, as observed here (Table 4), is critical for in vivo colonization. The SEF1 deletion was accompanied by a decreased virulence in the mice bloodstream infection model [60]. Fortunately, none of the mutants found as hypo-colonizers by Noble et al. [24] were missed using our strategy. Besides, none of the four mutants that were found hyper-colonizers were identified by Noble et al. [24]. To our knowledge, the remaining four mutants found here as hypo-colonizer including mutants for orf19.5133 (ZCF29), orf19.3405 (ZCF18), orf19.2646 (ZCF13) and RGT1 have not yet been identified in studies addressing virulence or organ colonization in animal studies.
Table 4

In vitro phenotypes of C. albicans Zn2-Cys6 TF mutants with hypo- or hyper-colonization phenotype in a mice model of disseminated candidiasis.

ORF numberGene namePhenotype in our studyOther phenotypes
Hyper- colonizers
19.6781 ZFU2 increased colony wrinkling on serumdecreased invasive growth [69]
weak enhancement of invasion of YEPD medium [22]
19.1685 ZCF7 decreased colony wrinkling on serumimpaired growth on Lee's medium [22]
no hyphae formation in liquid YEPD serumreduced colony wrinkling on Spider medium [22]
19.391 UPC2 no phenotypeaccumulation of abnormal sterol intermediates [53]
hypersusceptible to azole antifungals [53]
decreased anaerobic growth rate [70]
haploinsufficiency on SLAD medium [69]
19.4166 ZCF21 no phenotypeweak resistance to Caffeine [22]
weak resistance to Copper at 37°C [22]
marginal sensitivity to Calcofluor White [22]
Hypo- colonizers
19.3405 ZCF18 growth-deficient on YEPD mediahypersusceptible to virgineone [71]
increased hyphae formation in liquid YEPD serum
19.255 ZCF1 no phenotypeno phenotype
19.5133 ZCF29 decreased colony wrinkling on YEPDA serumstrong sensitivity to Caffeine and Menadione [22]
no hyphae formation in liquid YEPD serumstrong resistance to Fenpropimorph [22]
19.2747 RGT1 decreased invasive growthdecreased resistance to 2-deoxy-D-glucose [67]
no hyphae formation in liquid YEPD serumincreased filamentous growth [56], [67]
strong reduction of colony wrinkling at 37°C and 42°C [22]
19.7570 UGA3 no phenotypeno phenotype
19.6182 ZCF34 no phenotypeincreased susceptibility to clotrimazole [69]
increased mortality rate in stationary growth phase [57]
abnormal morphology on solid Spider medium [24]
19.3753 SEF1 hypersusceptibility to alkaline pHincreased mortality rate in stationary growth phase [57]
no hyphae formation in liquid YEPD serumstrong sensitivity to elevated pH, weak sensitivity to SDS [22]
haploinsufficiency on SLAD medium [69]
decreased colonization [24], [60]
19.2646 ZCF13 increased colony wrinkling and invasionno phenotype
hypersusceptibility to heat
To further characterize the putative function of the Zn2-Cys6 TFs deleted in our study, we screened the whole collection for altered hyphae formation and colony morphology on serum, invasive growth and susceptibility to pH, heat and oxidative stresses. These six phenotypic criteria are known to play a major role in C. albicans pathogenesis (for review see [59]). SEF1 mutant had an impaired growth at alkaline pH, which has already been described by Lan et al. [58]. Only one mutant displayed altered susceptibility to H2O2. Interestingly, this mutant was TAC1 (orf19.3188), the main regulator of the expression of genes encoding transporters belonging to the ATP-binding cassette family, which are known to mediate azole resistance [48]. Liu et al. found that TAC1 is regulating some genes involved in oxidative stress response such as GPX1 and SOD5 [61]. Moreover several studies suggested that azole drugs are able to generate an oxidative stress through mitochondrion metabolism disturbance [62], [63], [64]. Our observation further reinforces this hypothesis. Lastly, only two mutants were hypersusceptible to heat stress, namely mutants for orf19.5849 (CWT1) and orf19.2646 (ZCF13). To our knowledge, and without any further investigations, no obvious correlation between impaired growth at 42°C and the putative functions of these TFs could be observed. Contrary to pH, oxidative and heat stresses, most of the phenotypes altered in our TF mutants were hyphae production in liquid medium supplemented with serum, morphological aspect of colonies, and invasive growth (Table 3, Figure 6 and Supplementary file S1). In C. albicans, several parameters are known to induce hyphal formation (serum and temperature as example) however the mechanisms by which this yeast can sense contact with a surface and can promote invasion of soft substrates like agar medium or host tissue are still not fully understood [65]. However, invasive growth and colony wrinkling are two partially independent mechanisms (or at least mechanisms mediated by different effectors) helping C. albicans to cope with the requirements of its environment. Our results further demonstrate that agar invasion, colony wrinkling, and hyphae formation could not be correlated since a high discrepancy was observed while performing in vitro phenotypic screening of our TF mutants collection. More than the hyphal form itself, the ability of C. albicans to switch from yeast to hyphae or pseudohyphae is of crucial importance for its virulence [66]. Accordingly, no correlation between colony wrinkling and/or hyphae formation in liquid medium and reduced organs colonization could be made from our results (Figure 8). Indeed, only four of our hypo-colonizer mutants (orf19.5133, orf19.2747, orf19.3753, and orf19.1685) have a reduced hyphae production. Likewise, only one hypo-colonizer mutant lost its capacity to invade agar (orf19.2747), and only two (orf19.5133 and orf19.1685) displayed smooth colonies. Even mutant for orf19.2646 and orf19.3405, although compromized in organ colonization, produced highly wrinkled colonies on serum-supplemented media and a larger amount of hyphae in the presence of serum, respectively, as compared to the wild type (Table 3). Likewise, no correlation between increased filamentation on serum and colonization ability could be evidenced since all but one (orf19.6781) of the hyper-colonizer mutants produce highly wrinkled colonies on serum-supplemented media (Figure 6 and Table 3). This enhanced ability to produce hyphae may explain partially its higher ability to colonize mice tissues.
Figure 8:

Venn diagram of C. albicans Zn2-Cys6 TF mutants with an in vitro and/or an in vivo phenotype.

The 49 mutants (grey circle) with altered morphology and/or invasive growth, or altered susceptibility to pH, oxidative and/or heat stresses as determined by in vitro serial dilutions assay and liquid culture were compared to the 12 mutants with increased or decreased mice kidney colonization capacity (black circle). The remaining 22 mutants (white rectangle) did not have either in vivo or in vitro phenotypes.

Venn diagram of C. albicans Zn2-Cys6 TF mutants with an in vitro and/or an in vivo phenotype.

The 49 mutants (grey circle) with altered morphology and/or invasive growth, or altered susceptibility to pH, oxidative and/or heat stresses as determined by in vitro serial dilutions assay and liquid culture were compared to the 12 mutants with increased or decreased mice kidney colonization capacity (black circle). The remaining 22 mutants (white rectangle) did not have either in vivo or in vitro phenotypes. One unexpected observation was the poor correlation between decreased invasive growth and hypo-colonizer phenotypes as only two hypo-colonizer TF mutants (for RGT1 and CTA4) displayed a decreased agar invasion (Figure 6 and Table 4). This result may appear surprising since it is well established that invasion ability is a crucial determinant for the capacity of C. albicans to colonize host tissues [66]. RGT1 was previously extensively analysed in vitro for its role in sugar transport and metabolism [56], [67], thus the decreased colonization ability of RGT1 mutant might not be only linked to its decreased invasion capacity but probably to a combination with sugar metabolism. The CTA4 mutant, which also produced smooth colonies on serum-supplemented media and no hyphae in liquid media, has been described with a decreased virulence by Chiranand et al. [68]. Even if virulence and colonization are two distinct mechanisms of pathogenesis, it would be interesting to address whether this mutant also exhibits decreased virulence in the mice model of disseminated infection. In conclusion, the reduced or enhanced ability of most of the identified mutants to colonize mice kidneys could be at least partially explained by their in vitro phenotype (Table 4). However, a systematic relationship between criteria investigated here and colonization ability could be ruled out from our results. Indeed, among the 39 TF mutants positively selected from our in vitro test, only 7 had a modified colonization capacity in mice as compared to their wild type strains (Figure 8). Moreover, five of these twelve TF mutants did not have any in vitro phenotype, suggesting that their increased or decreased colonization ability could be attributed to alternative virulence traits. Finally, to validate results obtained with hypo-colonizer mutants, single strain infections were performed with the seven hypo-colonizer mutants and the wild type strain. Even if all mutants showed decreased colonization as compared to wild type, only two mutants for orf19.2646 (ZCF13) and orf19.3405 (ZCF18) showed significant reduction of colonization by CFU counting in kidneys as compared to the wild type. Surprisingly, these two strains did not show the lowest colonization scores in pool experiments. This result can be explained by a “pool effect”, which might influence the colonization of each strain of the pool. Competition between strains can modify the behavior of a strain in mice organs as compared to single strain infection. Our in vitro analysis showed that the mutant for orf19.3405 (ZCF18) is slightly growth-deficient, and thus might contribute to its hypo-colonizer phenotype. Regarding mutant for orf19.2646, we observed an increased ability to filament and to invade the agar and a growth deficiency at 42°C. The phenotypes observed in vitro and in vivo were reverted by the re-introduction of a wild-type allele in the mutant strain confirming that phenotypes observed were effectively due to the orf19.2646 (ZCF13) mutation. Orf19.2646 (ZCF13) therefore represents a very interesting candidate for further analyses. The further characterization of the function of this TF in virulence and identification of its target genes may constitute promising basis for the better understanding of host-Candida interactions. In addition, analysis of the remaining mutants of our collection may reveal other interesting candidates for involvement in colonization and virulence. Overall, our study demonstrates that our original strategy is a powerful tool to detect both in vivo and in vitro competitive fitness. This last in vitro approach is currently used in our laboratory. Moreover, this detection system is easy to implement, could be adapted to any pre-existing mutants and its efficacy could be enhanced by the use of additional STM tags. This file contains five sheets. The “Zn2Cys6 TF” sheet describes the mutant collection and provides for each mutant ORF number, gene name (when available) and description according to the Candida Genome Database assembly #21. It also provides information for inactivation strategy and numbering of barcoded strains (BCY). The “Phenotype” sheet describes the phenotype that was observed in vitro and a summary of the already described phenotypes for each mutant. The “All scores” sheet gives scores obtained for each replicate of in vivo experiments as well as the mean score for each mutant (see also Figure 4). It also gives information regarding previous large scale in vivo studies. The “BWP17 pilot assay” gives scores obtained for each replicate of the first in vivo pilot assay performed with the 10 BWP17 barcoded strains. Results are presented by STM. The “Supplementary references” sheet lists the references used in the “Phenotype” sheet. (XLSX) Click here for additional data file. Raw pictures of first in vitro phenotypic screen plates after 24 h of incubation. Each TF mutant is referenced according to its barcoded strain number (see Supplementary_S1.xlsx), and has to be compared with its respective parental strain (barcoded strain number 11 for CAF4-2 based TF mutants and barcoded strain number 31 for BWP17 based TF mutants) which was spotted on each plate for reference. Note that susceptibility to H2O2 was only determined at 5 mM. (EPS) Click here for additional data file. Raw pictures of first in vitro phenotypic screen plates after 48 h of incubation. Each TF mutant is referenced according to its barcoded strain number (see Supplementary_S1.xlsx), and has to be compared with its respective parental strain (barcoded strain number 11 for CAF4-2 based TF mutants and barcoded strain number 31 for BWP17 based TF mutants) which was spotted on each plate for reference. (EPS) Click here for additional data file. Raw pictures of second in vitro phenotypic screen plates after 24 h of incubation. Each TF mutant is referenced according to its barcoded strain number (see Supplementary_S1.xlsx), and has to be compared with its respective parental strain (barcoded strain number 11 for CAF4-2 based TF mutants and barcoded strain number 31 for BWP17 based TF mutants) which was spotted on each plate for reference. H2O2 concentration was adjusted and susceptibility of TF mutants was determined at 1 and 5 mM. (EPS) Click here for additional data file. Raw pictures of second in vitro phenotypic screen plates after 48 h of incubation. Each TF mutant is referenced according to its barcoded strain number (see Supplementary_S1.xlsx), and has to be compared with its respective parental strain (barcoded strain number 11 for CAF4-2 based TF mutants and barcoded strain number 31 for BWP17 based TF mutants) which was spotted on each plate for reference. (EPS) Click here for additional data file. Raw pictures of additional in vitro phenotypic screen performed for morphology determination. Each TF mutant is referenced according to its barcoded strain number (see Supplementary_S1.xlsx), and has to be compared with its respective parental strain (barcoded strain number 11 for CAF4-2 based TF mutants and barcoded strain number 31 for BWP17 based TF mutants) which was spotted on each plate for reference. This was performed on YEPD agar plates supplemented with 10% of serum after 24 and 72 h of incubation at 35°C. (EPS) Click here for additional data file. Raw pictures of in vitro phenotypic screen for TF mutants carrying the barcoded strain numbers BCY48, BCY122, BCY124, BCY126, BCY166 and BCY164. These strains were obtained in a second time during the course of this study and therefore assayed independently from the main screen. Each TF mutant is referenced according to its barcoded strain number (see Supplementary_S1.xlsx), and has to be compared with the parental strain (barcoded strain number 31) which was spotted on each plate for reference. (EPS) Click here for additional data file.
  71 in total

Review 1.  How human pathogenic fungi sense and adapt to pH: the link to virulence.

Authors:  Dana A Davis
Journal:  Curr Opin Microbiol       Date:  2009-07-23       Impact factor: 7.934

Review 2.  Antifungal drug resistance mechanisms in fungal pathogens from the perspective of transcriptional gene regulation.

Authors:  Dominique Sanglard; Alix Coste; Sélène Ferrari
Journal:  FEMS Yeast Res       Date:  2009-09-07       Impact factor: 2.796

3.  Candida albicans RIM101 pH response pathway is required for host-pathogen interactions.

Authors:  D Davis; J E Edwards; A P Mitchell; A S Ibrahim
Journal:  Infect Immun       Date:  2000-10       Impact factor: 3.441

4.  Efficacy of FK463, a new lipopeptide antifungal agent, in mouse models of disseminated candidiasis and aspergillosis.

Authors:  F Ikeda; Y Wakai; S Matsumoto; K Maki; E Watabe; S Tawara; T Goto; Y Watanabe; F Matsumoto; S Kuwahara
Journal:  Antimicrob Agents Chemother       Date:  2000-03       Impact factor: 5.191

5.  Biofilm formation by the fungal pathogen Candida albicans: development, architecture, and drug resistance.

Authors:  J Chandra; D M Kuhn; P K Mukherjee; L L Hoyer; T McCormick; M A Ghannoum
Journal:  J Bacteriol       Date:  2001-09       Impact factor: 3.490

6.  An A643T mutation in the transcription factor Upc2p causes constitutive ERG11 upregulation and increased fluconazole resistance in Candida albicans.

Authors:  Clemens J Heilmann; Sabrina Schneider; Katherine S Barker; P David Rogers; Joachim Morschhäuser
Journal:  Antimicrob Agents Chemother       Date:  2009-11-02       Impact factor: 5.191

Review 7.  Covalently linked cell wall proteins of Candida albicans and their role in fitness and virulence.

Authors:  Frans M Klis; Grazyna J Sosinska; Piet W J de Groot; Stanley Brul
Journal:  FEMS Yeast Res       Date:  2009-06-22       Impact factor: 2.796

Review 8.  Candida albicans iron acquisition within the host.

Authors:  Ricardo S Almeida; Duncan Wilson; Bernhard Hube
Journal:  FEMS Yeast Res       Date:  2009-08-21       Impact factor: 2.796

9.  Role of Ndt80p in sterol metabolism regulation and azole resistance in Candida albicans.

Authors:  Adnane Sellam; Faïza Tebbji; André Nantel
Journal:  Eukaryot Cell       Date:  2009-06-19

10.  A phenotypic profile of the Candida albicans regulatory network.

Authors:  Oliver R Homann; Jeanselle Dea; Suzanne M Noble; Alexander D Johnson
Journal:  PLoS Genet       Date:  2009-12-24       Impact factor: 5.917

View more
  30 in total

1.  The Role of UPC2 Gene in Azole-Resistant Candida tropicalis.

Authors:  Cen Jiang; Qi Ni; Danfeng Dong; Lihua Zhang; Zhen Li; Yuan Tian; Yibing Peng
Journal:  Mycopathologia       Date:  2016-08-18       Impact factor: 2.574

2.  Zinc Cluster Transcription Factors Alter Virulence in Candida albicans.

Authors:  Luca Issi; Rhys A Farrer; Kelly Pastor; Benjamin Landry; Toni Delorey; George W Bell; Dawn A Thompson; Christina A Cuomo; Reeta P Rao
Journal:  Genetics       Date:  2016-12-07       Impact factor: 4.562

3.  The Role of Glycoside Hydrolases in S. gordonii and C. albicans Interactions.

Authors:  Zhiyan Zhou; Biao Ren; Jiyao Li; Xuedong Zhou; Xin Xu; Yuan Zhou
Journal:  Appl Environ Microbiol       Date:  2022-05-04       Impact factor: 5.005

4.  Nonidentical function of Upc2A binding sites in the Candida glabrata CDR1 promoter.

Authors:  Bao Gia Vu; William Scott Moye-Rowley
Journal:  Genetics       Date:  2022-09-30       Impact factor: 4.402

5.  The zinc cluster transcription factor Rha1 is a positive filamentation regulator in Candida albicans.

Authors:  Raha Parvizi Omran; Bernardo Ramírez-Zavala; Walters Aji Tebung; Shuangyan Yao; Jinrong Feng; Chris Law; Vanessa Dumeaux; Joachim Morschhäuser; Malcolm Whiteway
Journal:  Genetics       Date:  2022-01-04       Impact factor: 4.402

6.  Rapid Phenotypic and Genotypic Diversification After Exposure to the Oral Host Niche in Candida albicans.

Authors:  Anja Forche; Gareth Cromie; Aleeza C Gerstein; Norma V Solis; Tippapha Pisithkul; Waracharee Srifa; Eric Jeffery; Darren Abbey; Scott G Filler; Aimée M Dudley; Judith Berman
Journal:  Genetics       Date:  2018-05-03       Impact factor: 4.562

7.  Adaptation of a Gaussia princeps Luciferase reporter system in Candida albicans for in vivo detection in the Galleria mellonella infection model.

Authors:  Eric Delarze; Françoise Ischer; Dominique Sanglard; Alix T Coste
Journal:  Virulence       Date:  2015       Impact factor: 5.882

8.  Azole resistance in a Candida albicans mutant lacking the ABC transporter CDR6/ROA1 depends on TOR signaling.

Authors:  Nitesh Kumar Khandelwal; Neeraj Chauhan; Parijat Sarkar; Brooke D Esquivel; Paola Coccetti; Ashutosh Singh; Alix T Coste; Meghna Gupta; Dominique Sanglard; Theodore C White; Murielle Chauvel; Christophe d'Enfert; Amitabha Chattopadhyay; Naseem A Gaur; Alok Kumar Mondal; Rajendra Prasad
Journal:  J Biol Chem       Date:  2017-11-20       Impact factor: 5.157

9.  Identification and functional characterization of Rca1, a transcription factor involved in both antifungal susceptibility and host response in Candida albicans.

Authors:  Patrick Vandeputte; Sylvain Pradervand; Françoise Ischer; Alix T Coste; Sélène Ferrari; Keith Harshman; Dominique Sanglard
Journal:  Eukaryot Cell       Date:  2012-05-11

10.  Antifungal resistance and new strategies to control fungal infections.

Authors:  Patrick Vandeputte; Selene Ferrari; Alix T Coste
Journal:  Int J Microbiol       Date:  2011-12-01
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.