Literature DB >> 21999143

Bacterial and fungal microflora in surgically removed lung cancer samples.

Panagiotis Apostolou1, Aggeliki Tsantsaridou, Ioannis Papasotiriou, Maria Toloudi, Marina Chatziioannou, Gregory Giamouzis.   

Abstract

BACKGROUND: Clinical and experimental data suggest an association between the presence of bacterial and/or fungal infection and the development of different types of cancer, independently of chemotherapy-induced leukopenia. This has also been postulated for the development of lung cancer, however the prevalence and the exact species of the bacteria and fungi implicated, have not yet been described. AIM: To determine the presence of bacterial and fungal microflora in surgically extracted samples of patients with lung cancer.
MATERIALS AND METHODS: In this single-center prospective, observational study, tissue samples were surgically extracted from 32 consecutive patients with lung cancer, and reverse-transcription polymerase chain reaction (RT-PCR) was used to identify the presence of bacteria and fungi strains.
RESULTS: The analysis of the electrophoresis data pointed out diversity between the samples and the strains that were identified. Mycoplasma strains were identified in all samples. Strains that appeared more often were Staphylococcus epidermidis, Streptococcus mitis and Bacillus strains, followed in descending frequency by Chlamydia, Candida, Listeria, and Haemophilus influenza. In individual patients Legionella pneumophila and Candida tropicalis were detected.
CONCLUSIONS: A diversity of pathogens could be identified in surgically extracted tissue samples of patients with lung cancer, with mycoplasma strains being present in all samples. These results point to an etiologic role for chronic infection in lung carcinogenesis. Confirmation of these observations and additional studies are needed to further characterize the etiologic role of inflammation in lung carcinogenesis.

Entities:  

Mesh:

Year:  2011        PMID: 21999143      PMCID: PMC3212932          DOI: 10.1186/1749-8090-6-137

Source DB:  PubMed          Journal:  J Cardiothorac Surg        ISSN: 1749-8090            Impact factor:   1.637


Introduction

Lung cancer is the most common cancer worldwide, with 1.35 million incident cases annually, and consists one of the leading causes of mortality worldwide [1]. In addition to cigarette smoking, the major lung cancer risk factor [1], recent studies underscore an etiologic role for chronic pulmonary infection in lung carcinogenesis, acting either independently or as a cofactor to tobacco smoke in increasing lung cancer risk [2-5]. Experimental and clinical data correlate cancer development with the presence of certain pathogens, independently of chemotherapy-induced leucopenia [6-8]. Indeed, mycoplasma is one of the most often observed pathogen in lung carcinomas [9], and it has been postulated that mycoplasma-infected cells have a higher ability to metastasize in vivo than non-mycoplasma-infected cells [10]. Very similarly, the bacterium Chlamydia pneumoniae, a common cause of community-acquired pneumonia, has been implicated in lung carcinogenesis [11-16]. Staphylococcus strains likewise have been observed in many cases of patients with lung cancer [6,7,17-19]. Other studies have demonstrated the presence of colonies in respiratory tract in patients with cancer [19]; Haemophilus influenza [6,7,19-21] and Candida albicans [7,20-22] have been found in patients with lower respiratory tract malignancies. Legionella pneymophila has been diagnosed in patients with cancer [23], as well as strains of Bacillus [7], Listeria [24], and Streptococcus [6,7,17,19,25]. Importantly, previous retrospective and prospective studies have relied on serologic characterization of chronic bacterial and fungal infections [14]. To the best of our knowledge, the prevalence of bacterial and/or fungal infection in surgically extracted samples of patients with lung cancer has not been previously reported. The aim of the present study, therefore, was to determine the presence of bacterial and fungal microflora in surgically removed tissue samples of patients with lung cancer, by using PCR methods and special primers.

Materials and methods

In this single-center prospective, observational study, tissue samples were surgically removed from 32 consecutive patients with lung cancer. The samples were maintained in RPMI culture medium (Sigma, R0883, Germany). The tissue was dissociated and 2 ml Trypsin - 0,25% EDTA (Invitrogen, 25200-072, California) was added in order to detach the cells. The trypsin has been inactivated by using FBS (Invitrogen, 10106-169, California) and cells were centrifuged at 1,200 rpm for 10 min. Then cells were incubated in 25 cm2 flasks (Orange Scientific, 5520200, Belgium) at 37°C, in a 5% CO2 atmosphere, until well developed. RNA was extracted using TRIZOL (Invitrogen, 15596-026, California) and was used as a template to generate cDNA using the First strand cDNA synthesis kit (Fermentas, K1612, Canada). The First strand cDNA was used as a template for the Gradient-PCR reaction, which was performed using GoTaq Flexi polymerase (Promega, M8305, USA). Primers have been designed with Gene Expression 1.1 software. The PCR conditions were set as follows: initial denaturation at 95°C for 10 min to activate the polymerase, 35 cycles of denaturation at 94°C for 45 sec, followed by annealing at 52-58°C for 45 sec and an extension step at 72°C for 60 sec. A final extension step was performed at 72°C for 10 min. The PCR products were then separated on 1.5% agarose gel (Merck, 1012360500, USA) stained with GelGreen (Gentaur, 41005, Belgium), and finally observed under UV-light. A 100-bp ladder (Promega, G2101, USA) was used as marker. This study was in compliance with the Helsinki Declaration. All participants gave informed consent and the study was approved by the institutional board review.

Results

Table 1 shows the primer pairs that were used in PCR to identify the specific pathogen strains. Table 2 presents the frequency of different species and strains in the samples that were examined. The analysis of the electrophoresis data pointed out diversity between the samples and the strains that were identified in them. Mycoplasma strains were identified in all samples (Figure 1 demonstrates electrophoresis results for Mycoplasma strains). Strains that appeared more often were Staphylococcus epidermidis, Streptococcus mitis and Bacillus strains, followed in descending frequency by Chlamydia, Candida, Listeria, and Haemophilus influenza. In individual patients Legionella pneumophila and Candida tropicalis were detected.
Table 1

Primer pairs that have been used in PCR

OrganismSpeciesForward Primer (5'-3')Reverse Primer (5'-3')PCR Product (bp)
TreponemapallidumAATGCGGTGGCGTAGCGATACTTTTGCGGTTTGCTCCACTTC275

denticolaAGGGATATGGCAGCGTAGCAATACGTCCTCCCTTACGGGTTAGACT453

vincentiiGCGGTATGTAAGCCTGGTGTGAATTTGCTTTGGCACTGAAGCTCTT277

NeisseriameningitidisAAGTCGGACGGCAGCACAGATCAGCCGCTGATATTAGCAACAG421

LegionellapneumophilaAAGATTAGCCTGCGTCCGATTAGAACCCTCCTCCCCACTGAAAGT232

BorreliaburgdorferiCATGCAAGTCAAACGGGATGTAGACCTTCTTCATTCACGCAGTG361
americana
valaisiana
garinii
recurrentis
hispanica
duttonii
lusitaniae
spielmanii

ListeriagrayiTCTTGACATCCTTTGACCACTCTGTGCACCGGCAGTCACTTTAGAG157
innocua
monocytogenes
welshimeri

HelicobacterpyloriGATTGGCTCCACTTCGCAGTAGGCGACCTGCTGGAACATT560
pullorum
equorum
canadensis

StaphylococcusaureusAGGCGACTTTCTGGTCTGTAACTGCCGAAGGGGAAGGCTCTATCT307

HaemophilusparasuisCCTTGGGAAAATACTGACGCTCATTCCCGAAGGCACACTCTCAT297

ChlamydiamuridarumTGTTTAGTGGCGGAAGGGTTAGCCGTCCATTGCGAAAGATTC304
trachomatis

BacilluspumilusTGCAAGTCGAGCGGACAGATCCCAGTCTTACAGGCAGGTTAC91
aerophilus
licheniformis
amyloliquefaciens
subtilis

Bacillus IIanthracisCGGCTTCGGCTGTCACTTATGTCAGCACTAAAGGGCGGAAAC655
cereus
thuringiensis

MycoplasmapneumoniaeGAGGCGAACGGGTGAGTAACACGCGACTGCTGGCACATAGT441
pirum
gallicepticum
genitalium
amphoriforme

LeptospiraborgpeterseniiGGATAGCCCCGAGAGGTCATACCATCATCACATCGCTGCTTAT299

LeptospirameyeriCGAATGTGACGGTTCCTGGTAGTTCGCCCATTGAGCAAGATT210
biflexa
StaphylococcusepidermidisGTGAAAGACGGTTTTGCTGTCACCGGATAACGCTTGCCACCTAC359

StreptococcusmitisGGAGCTTGCTCTTCTGGATGAGGAGCCGTTACCCCACCAACT197

LeptospirainterrogansCAGCCTGCACTTGAAACTATGTGATAGTCCCCAGGCGGTCTACT266

BrachyspirahyodysenteriaeTGCCGTAGAGTGGGGGATAACCGCAGGCTCATCGTAAAG109
aalborgi
intemedia
alvinipulli
innocens
suanatina

HaemophilusinfluenzaeCTTGCTTTCTTGCTGACGAGTGTCTCAGTCCCGCACTTTCATC129

Candida IalbicansCCAGCCGAGCCTTTCCTTCTTACCCCCGACCGTCCCTATT187
parapsilosis
dubliensis

CandidatropicalisCGGTCGGGGGTATCAGTATTCATACTCGCTGGCTCCGTCAGT622
Table 2

Prevalence by different species and strains

PathogenStrainPrevalence (%)
Legionellapneumophila3.125
Listeriagrayi9.375
innocua
monocytogenes
welshimeri
Chlamydiamuridarum12.5
trachomatis
Bacilluspumilus28.125
aerophilus
licheniformis
amyloliquefaciens
subtilis
Staphylococcusepidermidis25
Streptococcusmitis21.875
Haemophilusinfluenzae6.25
Mycoplasmapneumonia100
pirum
gallicepticum
genitalium
amphoriforme
Candidaalbicans12.5
parapsilosis
dubliensis
Candidatropicalis3.125
Figure 1

Electrophoresis results for Mycoplasma strains.

Primer pairs that have been used in PCR Prevalence by different species and strains Electrophoresis results for Mycoplasma strains.

Discussion

Lung cancer is the most common cancer worldwide and is a leading causes of mortality worldwide [1]. Many recent studies have underscored the etiologic role of chronic pulmonary infection in lung carcinogenesis, concluding that inflammation increases the risk for incident lung cancer [2-5]. Numerous studies on lung cancer have pointed out the appearance of Mycoplasma strains in patients and suggest association of infection with tumorigenesis; it has been postulated that mycoplasma-infected cells have a higher ability to metastasize in vivo than non-mycoplasma-infected cells [10]. Candida species have been isolated from patients with lower respiratory tract infection [7,20-22]. Haemophilus influenza [6,7,19-21], Staphylococcus epidermidis [6,7,17-19], Streptococcus species [6,7,17,19,25], Legionella pneymophila [23], as well as strains of Bacillus [7], Listeria [24] and Streptococcus [6,7,17,19,25] have been also identified in patients with different pulmonary diseases. Very similarly, the bacterium Chlamydia pneumoniae, a common cause of community-acquired pneumonia, has been implicated in lung carcinogenesis [11-16]. A recent meta-analysis by Zhan et al. [16] of 12 studies involving 2595 lung cancer cases and 2585 controls from four prospective studies and eight retrospective studies, was conducted to analyze the association between C. pneumoniae infection and risk of lung cancer. Overall, people exposed to C. pneumoniae infection had an odds ratio (OR) of 1.48 (95% confidence interval (CI), 1.32-1.67) for lung cancer risk, relative to those not exposed. Of interest, a higher titre was an even better risk prognosticator (OR for IgA ≥64 cutoff group, 2.35; 95% CI, 1.88-2.93; OR for IgA ≥16 cutoff group, 1.22; 95% CI, 1.06-1.41). These data strongly support the idea that lung cancer is a biofilm associated chronic infection. Biofilms are microorganism populations organized in a form of colonies using self-produced extracellular matrix that works as infrastructure material. The vast majority of the micro-"colonists" establish biofilms on any inert or diseased biological surface. They adhere to each other, divide, cooperate, and, progressively, their bio-mass grows, matures and finally disperses. It resembles malignant behavior (tumors composed by cancer cells and by stroma cells-monocytes, lymphocytes, microvessels, can metastasize). Therefore, many researchers imply that lung malignancies are communities of diverse pathogens resistant to antibiotics. One of the major limitations in most of the previous studies was the use of serologic characterization to identify chronic bacterial or fungal infections [14]. This has resulted in conflicting results and great variability in relative risk estimations among seropositive individuals [14,15,26-29]. This wide variability could also reflect the retrospective nature of most of the studies, the small sample sizes, or inadequate adjustment for confounding factors [14]. New techniques, such as PCR-RFLPs, Matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) and microcolony methods allow examination and analysis of microbial communities [30,31]. Analyzing the constituents of microbial biofilms responsible for lung disease may help us discover novel strategies to control malignancies. To the best of our knowledge, the prevalence of bacterial and/or fungal infection in surgically extracted samples of patients with lung cancer has not been previously reported. Therefore, the main purpose of the present study was to determine the presence of bacterial and fungal microflora in surgically removed tissue samples of patients with lung cancer, by using PCR methods and special primers. In this study, specific primers were designed in order to amplify as many different strains of microorganisms. Pairs of primers that were designed were capable of amplifying Treponema, Neisseria, Legionella, Borrelia, Listeria, Helicobacter, Staphylococcys, Haemophilus, Bacillus, Leptospira, Streptococcus, Mycoplasma, Candida and Brachyspira species. It is worth noting that Mycoplasma species were observed in all samples. Staphylococcus epidermidis and Streptococcus mitis were almost seen in one quarter of patients. Neither Treponema strains nor Leptospira, Helicobacter, and Staphylococcus aureus strains were observed in this study.

Conclusion

A diversity of pathogens could be identified in surgically extracted tissue samples of patients with lung cancer, with mycoplasma strains being present in all samples. These results point to an etiologic role for chronic infection in lung carcinogenesis. Confirmation of these observations and additional studies are needed to further characterize the etiologic role of inflammation in lung carcinogenesis, thus making it possible to apply new therapeutic modalities.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

PA carried out the molecular studies and drafted the manuscript. AT participated in the design of the study and collected all tissue samples. IP participated in the design of the study and coordination. MT carried out the molecular studies and drafted the manuscript. MC carried out the molecular studies and drafted the manuscript. GG performed the statistical analysis and drafted the manuscript. All authors read and approved the final manuscript.
  31 in total

1.  Lung cancer in never smokers: a new hot area of research.

Authors:  Ramaswamy Govindan
Journal:  Lancet Oncol       Date:  2010-03-19       Impact factor: 41.316

Review 2.  Chlamydia pneumoniae infection and lung cancer risk: a meta-analysis.

Authors:  Ping Zhan; Li-jun Suo; Qian Qian; Xiao-kun Shen; Li-Xin Qiu; Li-ke Yu; Yong Song
Journal:  Eur J Cancer       Date:  2010-12-29       Impact factor: 9.162

3.  Chlamydia pneumoniae infection and risk for lung cancer.

Authors:  Anil K Chaturvedi; Charlotte A Gaydos; Patricia Agreda; Jeffrey P Holden; Nilanjan Chatterjee; James J Goedert; Neil E Caporaso; Eric A Engels
Journal:  Cancer Epidemiol Biomarkers Prev       Date:  2010-05-25       Impact factor: 4.254

4.  Lack of association between serum antibodies of Chlamydia pneumoniae infection and the risk of lung cancer.

Authors:  Jennifer S Smith; Urban Kumlin; Fredrik Nyberg; Cristina Fortes; David Zaridze; Wolfgang Ahrens; Irene Bruske-Hohlfeld; Vali Constantinescu; Jie Ting; Simone Benhamou; Lorenzo Simonato; Jens Boman; Valerie Gaborieau; Paolo Boffetta
Journal:  Int J Cancer       Date:  2008-11-15       Impact factor: 7.396

5.  [Incidence and characteristics of bronchial colonisation in patient with lung cancer: a retrospective study of 388 cases].

Authors:  S Laroumagne; A Salinas-Pineda; C Hermant; M Murris; P-A Gourraud; C Do; C Segonds; A Didier; J Mazières
Journal:  Rev Mal Respir       Date:  2011-02-03       Impact factor: 0.622

6.  Single DNA sequence common to all chlamydial species employed for PCR detection of these organisms.

Authors:  A A Girjes; F N Carrick; M F Lavin
Journal:  Res Microbiol       Date:  1999-09       Impact factor: 3.992

7.  [Infective complications in patients with lung cancer].

Authors:  Milan Rancić; Lidija Ristić; Ivana Stanković
Journal:  Med Pregl       Date:  2010 Sep-Oct

8.  [Microbial spectrum of respiratory tract in patients with different pulmonary diseases].

Authors:  G S Balasaniants; E A Torkatiuk
Journal:  Zh Mikrobiol Epidemiol Immunobiol       Date:  2010 Nov-Dec

9.  [Bronchial bacterial colonization in patients with lung cancer].

Authors:  Maciej Dancewicz; Maria Szymankiewicz; Mariusz Bella; Joanna Swiniarska; Janusz Kowalewski
Journal:  Pneumonol Alergol Pol       Date:  2009

10.  Characterization of Candida species isolated from cases of lower respiratory tract infection.

Authors:  B J Jha; S Dey; M D Tamang; M E Joshy; P G Shivananda; K N Brahmadatan
Journal:  Kathmandu Univ Med J (KUMJ)       Date:  2006 Jul-Sep
View more
  16 in total

1.  Mycoplasma hyorhinis reduces sensitivity of human lung carcinoma cells to Nutlin-3 and promotes their malignant phenotype.

Authors:  Uljana A Boyarskikh; Alexandra S Shadrina; Mariya A Smetanina; Yakov A Tsepilov; Igor P Oscorbin; Vadim V Kozlov; Alexander E Kel; Maxim L Filipenko
Journal:  J Cancer Res Clin Oncol       Date:  2018-05-08       Impact factor: 4.553

Review 2.  Microbiota in cancer development and treatment.

Authors:  Muhammad Hassan Raza; Kamni Gul; Abida Arshad; Naveeda Riaz; Usman Waheed; Abdul Rauf; Fahad Aldakheel; Shatha Alduraywish; Maqbool Ur Rehman; Muhammad Abdullah; Muhammad Arshad
Journal:  J Cancer Res Clin Oncol       Date:  2018-12-12       Impact factor: 4.553

3.  Nucleic acid aptamer controls mycoplasma infection for inhibiting the malignancy of esophageal squamous cell carcinoma.

Authors:  Yibin Zhang; Hui Zhang; Xing Sun; Tianhuan Peng; Tiantian Xie; Yijun Yuan; Junxiao Guo; Yinglei Chen; Lingli Zhou; Neng Ling; Hui Li; Ling Li; Lin Zhang; Xiaodong Li; Long Liang; Jing Liu; Mao Ye; Weihong Tan
Journal:  Mol Ther       Date:  2022-02-18       Impact factor: 12.910

4.  The human tumor microbiome is composed of tumor type-specific intracellular bacteria.

Authors:  Deborah Nejman; Ilana Livyatan; Garold Fuks; Noam Shental; Ravid Straussman; Nancy Gavert; Yaara Zwang; Leore T Geller; Aviva Rotter-Maskowitz; Roi Weiser; Giuseppe Mallel; Elinor Gigi; Arnon Meltser; Gavin M Douglas; Iris Kamer; Vancheswaran Gopalakrishnan; Tali Dadosh; Smadar Levin-Zaidman; Sofia Avnet; Tehila Atlan; Zachary A Cooper; Reetakshi Arora; Alexandria P Cogdill; Md Abdul Wadud Khan; Gabriel Ologun; Yuval Bussi; Adina Weinberger; Maya Lotan-Pompan; Ofra Golani; Gili Perry; Merav Rokah; Keren Bahar-Shany; Elisa A Rozeman; Christian U Blank; Anat Ronai; Ron Shaoul; Amnon Amit; Tatiana Dorfman; Ran Kremer; Zvi R Cohen; Sagi Harnof; Tali Siegal; Einav Yehuda-Shnaidman; Einav Nili Gal-Yam; Hagit Shapira; Nicola Baldini; Morgan G I Langille; Alon Ben-Nun; Bella Kaufman; Aviram Nissan; Talia Golan; Maya Dadiani; Keren Levanon; Jair Bar; Shlomit Yust-Katz; Iris Barshack; Daniel S Peeper; Dan J Raz; Eran Segal; Jennifer A Wargo; Judith Sandbank
Journal:  Science       Date:  2020-05-29       Impact factor: 47.728

5.  Association or Causation? Exploring the Oral Microbiome and Cancer Links.

Authors:  F R F Teles; F Alawi; R M Castilho; Y Wang
Journal:  J Dent Res       Date:  2020-08-18       Impact factor: 6.116

6.  Nucleoside-catabolizing enzymes in mycoplasma-infected tumor cell cultures compromise the cytostatic activity of the anticancer drug gemcitabine.

Authors:  Johan Vande Voorde; Suna Sabuncuoğlu; Sam Noppen; Anders Hofer; Farahnaz Ranjbarian; Steffen Fieuws; Jan Balzarini; Sandra Liekens
Journal:  J Biol Chem       Date:  2014-03-25       Impact factor: 5.157

7.  Lung microbiome alterations in NSCLC patients.

Authors:  Leliang Zheng; Ruizheng Sun; Yinghong Zhu; Zheng Li; Xiaoling She; Xingxing Jian; Fenglei Yu; Xueyu Deng; Buqing Sai; Lujuan Wang; Wen Zhou; Minghua Wu; Guiyuan Li; Jingqun Tang; Wei Jia; Juanjuan Xiang
Journal:  Sci Rep       Date:  2021-06-03       Impact factor: 4.379

8.  Bacteria and tumours: causative agents or opportunistic inhabitants?

Authors:  Joanne Cummins; Mark Tangney
Journal:  Infect Agent Cancer       Date:  2013-03-28       Impact factor: 2.965

9.  Mycoplasma hyorhinis-encoded cytidine deaminase efficiently inactivates cytosine-based anticancer drugs.

Authors:  Johan Vande Voorde; Peter Vervaeke; Sandra Liekens; Jan Balzarini
Journal:  FEBS Open Bio       Date:  2015-08-03       Impact factor: 2.693

Review 10.  Mycoplasmas and cancer: focus on nucleoside metabolism.

Authors:  Johan Vande Voorde; Jan Balzarini; Sandra Liekens
Journal:  EXCLI J       Date:  2014-03-27       Impact factor: 4.068

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.