| Literature DB >> 21994537 |
Glenys R Chidlow1,2, Gerry B Harnett1, Geoffrey R Shellam2, David W Smith1,2.
Abstract
This study used real-time PCR assays to screen small sample volumes for a comprehensive range of 35 respiratory pathogens. Initial thermocycling was limited to 20 cycles to avoid competition for reagents, followed by a secondary real-time multiplex PCR. Supplementary semi-nested human metapneumovirus and picornavirus PCR assays were required to complete the acute respiratory pathogen profile. Potential pathogens were detected in 85 (70%) of pernasal aspirates collected from 121 children with acute respiratory symptoms. Multiple pathogens were detected in 29 (24%) of those samples. The tandem multiplex real-time PCR was an efficient method for the rapid detection of multiple pathogens.Entities:
Keywords: mixed infections; respiratory pathogens; tandem multiplex real-time PCR
Year: 2009 PMID: 21994537 PMCID: PMC3185464 DOI: 10.3390/v1010042
Source DB: PubMed Journal: Viruses ISSN: 1999-4915 Impact factor: 5.818
Relative sensitivity of the multiplex tandem real-time PCR compared to single real-time and nested PCR in-house assays.
| Adenovirus (Group B) | 10−4 | 10−4 | 10−6 |
| Bocavirus | 10−7 | 10−7 | NA |
| 10−5 | 10−5 | 10−5 | |
| 10−8 | 10−8 | 10−8 | |
| 10−8 | 10−7 | NA | |
| 10−8 | 10−8 | NA | |
| 10−4 | 10−5 | 10−4 | |
| 10−6 | 10−6 | 10−5 | |
| Coronavirus 229E | 10−8 | 10−7 | 10−7 |
| Coronavirus HKU1 | 10−2 | 10−2 | NA |
| Coronavirus NL63 | 10−2 | 10−3 | NA |
| Coronavirus OC43 | 10−8 | 10−9 | 10−8 |
| 10−5 | 10−5 | NA | |
| Influenza virus A H1 | 10−6 (Matrix 10−6) | 10−6 (Matrix 10−6) | 10−6 |
| Influenza virus A H3 | 10−8 (Matrix 10−6) | 10−7 (Matrix 10−6) | 10−6 |
| Influenza virus B | 10−6 | 10−7 | 10−6 |
| Influenza virus C | 10−4 | 10−5 | 10−5 |
| 10−4 | 10−4 | 10−3 | |
| 10−5 | 10−4 | 10−3 | |
| 10−5 | 10−5 | NA | |
| 10−5 | 10−5 | 10−5 | |
| Parainfluenzavirus 1 | 10−8 | 10−7 | 10−8 |
| Parainfluenzavirus 2 | 10−6 | 10−6 | 10−6 |
| Parainfluenzavirus 3 | 10−6 | 10−5 | 10−5 |
| Parainfluenzavirus 4A | 10−6 | 10−6 | NA |
| Parainfluenzavirus 4B | 10−3 | 10−3 | NA |
| 10−3 | 10−2 | 10−2 | |
| Polyomavirus KI | 10−1 | 10−1 | NA |
| Polyomavirus WU | 10−5 | 10−3 | NA |
| RSV A | 10−7 | 10−7 | 10−7 |
| RSV B | 10−4 | 10−4 | 10−4 |
| 10−6 | 10−6 | NA | |
| 10−3 | 10−3 | NA | |
| Equine herpesvirus 4 | 10−5 | 10−5 | NA |
| MS-2 RNA coliphage | 10−8 | 10−7 | NA |
Separate assays for the HA and matrix gene sequences. Matrix assay results in brackets;
NA = Test not available in this laboratory;
Viruses added to samples to monitor successful nucleic acid extraction, cDNA production and PCR inhibitor removal.
Agents detected in PNA samples from 121 hospitalized children.
| 12 | RSV | RSV A (4), RSV B (8) |
| 1 | RSV, PIV-1 | RSV B, PIV-1 |
| 12 | Human rhinovirus (HRV) | HRV |
| 1 | HRV, PIV-1 | HRV, PIV-1 |
| 4 | Influenza virus B | Influenza virus B |
| 1 | PIV-1 | PIV-1 |
| 2 | PIV-3 | PIV-3 |
| 1 | Human metapneumovirus | Human metapneumovirus (hMPV) |
| 31 | Neg | Neg |
| 4 | Neg | RSV A (2), RSV B (2) |
| 7 | Neg | HRV |
| 3 | Neg | HBoV |
| 1 | Neg | HRV, KI polyomavirus |
| 1 | Neg | HCoVHKU1 |
| 1 | Neg | HCoVNL63, |
| 1 | Neg | HCoVNL63 |
| 1 | Neg | PIV-3 |
| 4 | RSV | RSV A, HRV |
| 1 | RSV | RSV B, HRV |
| 2 | RSV | RSV A, HBoV, GAS |
| 1 | RSV | RSV A, HBoV |
| 1 | RSV | RSV B, HBoV |
| 2 | RSV | RSV A, HRV, KI polyomavirus |
| 2 | RSV | RSV B, HCoVHKU1 |
| 1 | HRV | HRV, HCoVNL63 |
| 1 | HRV | HRV, HBoV |
| 1 | AdV | HRV, AdV |
| 1 | Influenza virus B | Influenza virus B, HCoVHKU1 |
| 1 | RSV, AdV | RSV A, HRV, HBoV, GAS |
| 1 | RSV, AdV | RSV B, HRV, HBoV, GAS |
| 1 | RSV, AdV | RSV B, HRV, HBoV, HCoVNL63 |
| 1 | RSV, AdV | RSV A, GAS |
| 2 | RSV, AdV | RSV B |
| 1 | RSV, AdV | RSV A, HRV, KI polyomavirus |
| 1 | RSV, AdV | RSV B, HBoV |
| 1 | RSV, | RSV A |
| 1 | AdV | WU polyomavirus |
| 1 | CMV | HRV, WU polyomavirus |
| 1 | CMV | HRV |
| 1 | CMV | hMPV |
| 1 | Neg | |
| 1 | RSV, PIV-2 | RSV B |
| 1 | RSV, PIV-3 | RSV A, HBoV, HCoVHKU1,WU polyomavirus |
| 1 | Influenza virus B | Neg |
| 2 | HRV | Neg |
| 1 | hMPV | Neg |
Original reported result for tests requested by clinician, performed as nested PCR assays except CMV (real-time PCR) and Haemophilus influenzae (bacterial culture).
Primers and probes included in the multiplex tandem real time PCR assay.
| Target (Abbreviation) | Primer or Probe name | Sequence 5′-3′ | Size (bp) | PCR mix |
|---|---|---|---|---|
| Adenovirus (AdV) | ADB-F | GACAGGATGCTTCGGAGTACCT | 91 | A-2 |
| Bocavirus (HBoV) | BOCA-F | TGGGCCATTTAATCCACTTGA | 63 | A-2 |
| Bordetella species | IS481-F | CGGATGAACACCCATAAGCA | 81 | A-5 |
| BPA-F | ATCCCGCTACTGTAATCCAA | 64 | A-5 | |
| CPD-F | GAAGGGTTCCATGCAGTTAAGTTT | 75 | A-3 | |
| CPSITT-F | CTCCTTACAAGCCTTGCCTGTAG | 68 | A-2 | |
| Coronavirus 229E | 229E-F | CTGCCAAGAGTCTTGCTCGTT | 80 | A-6 |
| Coronavirus HKU1 | HKCOR-F | CCCGCAAACATGAATTTTGTT | 61 | A-7 |
| Coronavirus NL63 | NL63-F | AACCTCGTTGGAAGCGTGTT | 61 | A-7 |
| Coronavirus OC43 | OC43-F | GACATGGCTGATCAAATTGCTAGT | 67 | A-6 |
| Equine herpesvirus 4 | EHV-F | GATGACACTAGCGACTTCGA | 81 | B-17 |
| HINF-F | AGAAGTTTTACTGATGATATGGGTACATCT | 79 | B-14 | |
| Influenza virus A | FA-MATF | CTTCTAACCGAGGTCGAAACGTA | 155 | A-4 |
| Influenza virus A H3 | H3N2-F | ACGAAGTGGGAAAAGCTCAATAAT | 72 | A-11 |
| Influenza virus A H1 | H1N1-F | AAGCTCATGGCCCAACCA | 57 | A-12 |
| Influenza virus B | FBMAT-F | TGCCTACCTGCTTTMMYTRACA | 75 | A-4 |
| Influenza virus C | FLUC-F | CCTAGAACITGGGAAGAKGCR | 61 | A-4 |
| LLong-F | TGGTCACTGCGGCCATTA | 58 | A-3 | |
| LPN-F | CAATGGCTAAAGGCATGCAA | 61 | A-3 | |
| MOR-F | TCGCCAAGGTGCRAAAATTAA | 63 | B-14 | |
| MS-2 RNA | MS2-F | GTCGACAATGGCGGAACTG | 66/74 | A-1 |
| MPN-F | AAGTACCACCACGACGCTCAA | 54 | A-10 | |
| Parainfluenzavirus (PIV) | PF1-F | GCAAAGAGARAATGCRGATCTAG | 67 | A-8 |
| 65 | A-8 | |||
| 59 | A-8 | |||
| 65 | A-9 | |||
| 60 | A-9 | |||
| PN-F | CCATACCTCAGAGAATATACCGTATCC | 69 | A-10 | |
| Polyomavirus | KI-F | GGTTCTGGAGCTGCCATAGC | 77 | B-16 |
| 63 | B-16 | |||
| Respiratory syncytial virus A (RSV A) | RSVA-F | CAACTTCTGTCATCCAGCAAA | 77 | A-9 |
| 74 | A-5 | |||
| Group A | STAspeB-F | CTAAACCCTTCAGCTCTTGGTACTG | 77 | B-11 |
| Pneum-F | CCACTCTTCTTGCGGTTGATC | 61 | B-14 | |
The letter indicates in which of the two enrichment PCR assays the primers are included, and the number indicates in which of 16 real time PCR mixes the primers and corresponding probes may be found.