Literature DB >> 21914202

Enhancing genome investigations in the mosquito Culex quinquefasciatus via BAC library construction and characterization.

Paul V Hickner1, Becky Debruyn, Diane D Lovin, Akio Mori, Christopher A Saski, David W Severson.   

Abstract

BACKGROUND: Culex quinquefasciatus (Say) is a major species in the Culex pipiens complex and an important vector for several human pathogens including West Nile virus and parasitic filarial nematodes causing lymphatic filariasis. It is common throughout tropical and subtropical regions and is among the most geographically widespread mosquito species. Although the complete genome sequence is now available, additional genomic tools are needed to improve the sequence assembly.
FINDINGS: We constructed a bacterial artificial chromosome (BAC) library using the pIndigoBAC536 vector and HindIII partially digested DNA isolated from Cx. quinquefasciatus pupae, Johannesburg strain (NDJ). Insert size was estimated by NotI digestion and pulsed-field gel electrophoresis of 82 randomly selected clones. To estimate genome coverage, each 384-well plate was pooled for screening with 29 simple sequence repeat (SSR) and five gene markers. The NDJ library consists of 55,296 clones arrayed in 144 384-well microplates. Fragment insert size ranged from 50 to 190 kb in length (mean = 106 kb). Based on a mean insert size of 106 kb and a genome size of 579 Mbp, the BAC library provides ~10.1-fold coverage of the Cx. quinquefasciatus genome. PCR screening of BAC DNA plate pools for SSR loci from the genetic linkage map and for four genes associated with reproductive diapause in Culex pipiens resulted in a mean of 9.0 positive plate pools per locus.
CONCLUSION: The NDJ library represents an excellent resource for genome assembly enhancement and characterization in Culex pipiens complex mosquitoes.

Entities:  

Year:  2011        PMID: 21914202      PMCID: PMC3180476          DOI: 10.1186/1756-0500-4-358

Source DB:  PubMed          Journal:  BMC Res Notes        ISSN: 1756-0500


Introduction

Culex quinquefasciatus (Say), the southern house mosquito, is a major vector for a number of important human pathogens including West Nile virus and Wuchereria bancrofti, the primary global etiologic agent for lymphatic filariasis (LF) [1-3]. It is estimated that more than 1.2 billion people are at risk for infection by parasites causing LF, with 120 million people presently infected [4]. Among these are over 40 million people who suffer from chronic morbidity associated with lymphadema and hydrocele [5]. Despite the availability of effective antihelminthics to treat and prevent infections, the damage to the lymphatic system caused by these parasites is largely irreversible. Although efforts to eradicate LF globally using mass drug administration to human populations in endemic areas were initiated in 2000, the success of these efforts will likely also rely on the implementation of effective mosquito vector control strategies [6]. However, vector control efforts can be hindered by the rapid selection for emergence of insecticide resistance [7]. Consequently, the identification of new targets for insecticides as well as the development of novel vector control strategies is expected to play a large role in the successful control and/or eradication of mosquito-borne diseases [8]. Cx. quinquefasciatus and Cx. pipiens (L.) are the two most common and geographically widespread species in the Cx. pipiens complex, a species complex with nearly worldwide distribution [9]. Cx. quinquefasciatus is common in tropical and subtropical regions while Cx. pipiens, the northern house mosquito, occupies more temperate regions. Both species are abundant in urban areas where they oviposit in stagnant, and often polluted water. They frequently enter homes and feed on humans during the night, hence the common name of house mosquito. The taxonomic status of this complex has been a subject of debate, and these taxa are sometimes placed within a single species, i.e., Cx. pipiens quinquefasciatus or Cx. pipiens pipiens [9]. Introgression between these species is common in the United States where hybrids can be found as far south as Louisiana and as far north as Illinois [10-12], yet in South Africa the populations remain largely distinct [13,14]. Females are morphologically indistinguishable, while differences in male genitalia have been used to identify species as well as interspecies hybrids [10-12,15]. Recently, however, PCR assays have been developed to aid in the differentiation of species in this complex [16-19]. Given their medical importance, Cx. pipiens complex mosquitoes have garnered considerable attention by the scientific community during the last 100 years [9]. Nevertheless, the current status of contemporary Cx. pipiens genetics remains considerably behind that of other important mosquito vectors such as Anopheles gambiae and Aedes aegypti [20]. The Cx. quinquefasciatus (Johannesburg strain) genome sequence was recently determined using the whole genome shotgun (wgs) approach, thus providing a valuable resource for advancing genome studies in this species complex [21]. However, the genome assembly remains highly fragmented and few (~40) of the 3171 supercontigs have been assigned to their respective chromosomes [21]. Bacterial artificial chromosome (BAC) genomic libraries are important resources for the assembly and characterization of complex genomes. They have been utilized for the assembly of numerous genomes including Drosophila melanogaster and An. gambiae [22,23]. BAC libraries have also been used for the development of genetic markers for non-model organisms [24,25]. Furthermore, BAC clones can be used for positional cloning to help identify and characterize genomic regions of interest [26,27], as well as for construction of BAC-based physical map assemblies [28-31]. These are useful for long-range contiguity and anchoring of wgs draft assemblies as well as targeted re-sequencing for high resolution using BAC pools [32]. The objective of this work was to construct a BAC library with comprehensive coverage of the Cx. quinquefasciatus genome, thereby providing a tool to aid in genome assembly, marker development, and gene discovery in Cx. pipiens complex mosquitoes.

Methods

BAC library construction

High molecular weight DNA was extracted from pupae from the Johannesburg (JHB) strain. This strain was established using individuals from Johannesburg South Africa, and was the strain used in the Cx. quinquefasciatus genome project [21]. Pupae were gently homogenized in 1X PBS buffer containing 50 mM EDTA pH 8.0 and 0.1% BME and filtered through one layer of miracloth into 50 mL Falcon tubes. Cells were pelleted by centrifugation in a swinging-bucket rotor (Beckman) at 3,200 rpm for 15 minutes at 4°C. Pellets were washed 2 additional times with PBS and gently resuspended in 1 mL of PBS. The nuclei solution was warmed to 45°C in a waterbath, mixed gently with an equal volume of 1.5% low-melt agarose (Seaplaque) and aliquoted into plug molds (BioRad) using large-bore tips. Protein digestion and plug washing was performed exactly as the methods of Luo and Wing (2003) [33]. HindIII partial restriction enzyme digestion of DNA, as well as the preparation of high molecular weight DNA fragments was conducted following the procedure of Luo and Wing (2003) [33]. Preparation of the HindIII cloning-ready single copy pIndigoBAC536 vector from the high copy pCUGIBAC1 plasmid was performed according to Luo et al. (2001) [34]. The size selected high molecular fragments were ligated to the vector and transformed into E. coli strain DH10B competent cells (Invitrogen, Carlsbad, CA). White recombinant colonies were selected on LB plates containing chloramphenicol, X-Gal and IPTG, and picked robotically using the Genetix Q-bot (Genetix, UK). Recombinant clones were transferred into individual wells of microtiter plates, grown and then stored at -80°C. The BAC library was also gridded onto 10, 11.25 × 22.25 cm filters in high density, double spots (18,432 clones represented per filter) and 4 × 4 patterns. To estimate the size of the BAC inserts, DNA from 82 randomly selected clones was prepared according to standard alkaline lysis protocol, digested with NotI, and separated by pulsed-field gel electrophoresis (PFGE) on a 1% agarose gel under the following conditions: 5-15 sec linear ramp time, 6 V/cm, 14°C in 0.5 × TBE buffer for 15 hours and stained with ethidium bromide. Insert sizes of the clones with endogenous NotI sites, evidenced by multiple restriction fragments, were estimated by summing the fragments. Southern blotting was used to confirm that all of the clones were truly Cx. quinquefasciatus and are not significantly contaminated by other types of DNA. One gel used for insert size determination was transferred to a positively charged nylon membrane Hybond N+ (GE Healthcare) following the methods of Chomczynski (1992) [35]. BAC vector (pIndigoBAC536) and total Culex DNA were used as probes and radiolabeled with the DECAprime™ II kit (Ambion, Inc). The probes were mixed and denatured, and hybridization was carried out overnight at 60°C. The membrane was washed with 1× SSC, 0.1% SDS at 60°C twice for one hour each. The membrane was exposed to a phosphor screen (GE Healthcare) overnight and the image recorded by a Typhoon 9400 imager (GE Healthcare).

BAC library screening

Screening of the BAC library was generally performed as described by Jiménez et al. (2004) [36]. Briefly, we first prepared pools of DNA representing all clones within each of the individual 144 384-well microplates. Plates were initially replicated on LB agar plates containing 12.5 μg/ml chloramphenicol and incubated overnight at 37°C. The plates were then flooded with LB broth containing 12.5 μg/ml chloramphenicol, agitated for 4 h at 37°C and the slurries used to prepare 9.5 ml overnight cultures. These individual plate pool cultures were used for large-scale alkaline lysis DNA extractions [37] and subsequent PCR screening with SSR oligonucleotide primer sets. A combination of PCR-based plate-pool DNA screening and radiolabeled oligonucleotide probe hybridization was used to screen the NDJ library. Initial PCR-based screening of BAC DNA representing individual plate pools was performed using 29 simple sequence repeats (SSRs) (Table 1) [38-40]. The Primer3 program [41] was used to design primers to amplify regions within a gene on supercontig 3.134 and four genes previously identified as having a role in reproductive diapause in Cx. pipiens s.s. (Table 2) [42,43]. PCR reactions were performed in a total volume of 25 μl containing 50 mM KCl, 10 mM Tris (pH 9.0), 0.1% Triton X, 1.5 mM MgCl2, 200 μM dNTPs, 5 pmol of each primer (F and R), 25 ng of plate pool DNA and 1 unit of Taq polymerase. PCR thermal cycling conditions were 5 min. at 94°C, followed by thirty cycles of 1 min. at 94°C, 1 min. at 60°C, 2 min. at 72°C, and then 10 min. at 72°C for a final extension. The SSR positive plate pools were identified by electrophoresis on 2% agarose gels using ethidium bromide and UV visualization.
Table 1

SSR primer sequences.

SSR locusGenBank accessionSSR Primer Sequence (F/R)Product size (bp)a# Positive plate pools
C127GAC1GF102017GCGTTTGGAGAGTGGAAAAG30710
TGAGTTTTCAGTGCCCTCCT
C32AC1BGF110611AAACGATCGCAATTCGAAAC2423
GTGGCGAACAACATTCACAG
C32TC1BGF110612TCATCGTTCATTCGTTCCAA1792
TGTCATTTTCTGCCTGCATC
C32TG1GF102044CGTGTTTTCCATTGTTGGTG40029
TTGGCTGTGTCAACTGCTTC
C68ACAT1GF102032GGCCTTGCTGAGAAAACTTG4251
CCCAAAATCCAAGCTTCAAA
C68CA1GF102033ATAAAGCGACCAAGGCTCAA2947
GCGAAACCATTCAAAAGCAT
C68GA1BGF110613CACCCCACAGTTAACCCAAC2458
CTCGAGAGATTTGGCCTTTG
C65AC1GF102022GGAGTTGTGCGGTTGAAAGT30519
GCACTGCCTAACGGATCATT
C65CGC1GF102023TCTGGGTACAACCCCGTAAC22120
AGAGAGTGCGCAAAAGCAAT
C65TG1GF102021ACTGCGAAACGCTTACTGCT3029
GTGTGTGGACTGTGGTGGAG
C474CT1BGF110614CCCAAACTTGCCACAAAAGT2902
CTCACTCTCCGTGAACGACA
C48ATC1GF102034CATTTTTCGGGTGGCTTCTA3377
CGAGATCGAAATGATGCTGA
C48CGA1BGF110615GCTTGGGAATCTGAATCTGC2514
ACCTTGCATTCAACGAGCTT
C48GTT1BGF110616GTGGCCACCTGGTTGTAGTT30923
ACCACCGGTAGAACATCTCG
C175AT1GF102036GGACCAAGGGTACGATTTGA18514
CAGACTGGTTAACGGCTTCC
C175TG1GF102045TCAGATCTCCGAGAGGAGGA2954
CTGTCAGGGCCAGATTTCAT
C134AC1GF102037GAAGGTCAGCCACTCAGGC1940
ACAGCTGACTCTCGTCGAC
C129GT1GF102038AAGGTGCAAAACCAAACTGG3771
TGGAGCACAGCCCTACTCTT
C66CA1GF102026CGACTACTGCCCCAATTTGT2132
CACCCTCCCCTACAGACGTA
C177CA1BGF110618AGGGCAATGTTTACGACGAC2932
CTTGCGCCTTAGTCATCCTC
C177TG1GF102028AGCACAAAAAGGCACGATTT1976
TAAACGCAAGTAGGCGGAGT
C99TGT1BGF110619GCAGTGGAGGATTCTGAGGA3585
CAGAACGTTTGGCGAATTTT
C205CA1GF102029CAATGCGCCTTCTGGATTAT2273
CTCGTGATGGCCATTTCTCT
C205TG1BGF110620ATTGCTCAAGTGCTGCCTTT2127
ATGACGACGAAAAACCGAAC
C139TG1BGF110621GGGATCGCTACGTGTTTTGT2656
TCTCGGAATGCCAGTCTTTT
C446AC2GF110622CATACGACGTGGAACAAACG16217
ACGAGGTTGAGGTTGGTGAC
C446TG1GF102043GGAAAGGGGCACTTGTGTAA39722
CGTTTGCTTCTCTTCGAACC
CxpGT4AY423738GTCGTCGCTAACCCTTGTT1462
CGCGATAGTCGGTAATCGT
CxqTri4AY958079CTAGCCCGGTATTTACAAGAAC12116
AACGCCAGTAGTCTCAGCAG

aPredicted amplicon size based on nucleotide sequence in VectorBase [50].

Table 2

Primer sequences for genes used in library screening.

GeneVectorBase gene IDGenBank accessionSSR Primer Sequence (F/R)Product size (bp)a# Positive plate pools
CHP*CPIJ007110GF110930CGAGCAGTTCAAACACCAGA20712
GCTTCTTCAGGTTGCTCCAC
FOXOCPIJ016794GF110931CTGAGCCCAATTCAGTCCAT1873
TCTGCTGTAAAGTCAGCTCGTC
ILP-1CPIJ018051GF110932AGTCCCTCGGAGGAGTTCAA1637
TCGGCACAGTACTGCTTGAG
ILP-2CPIJ018050GF110933TCCAGCAGATCTTCGATGC14010
TGTAGATCGGGGAACTCGTC
ILP-5CPIJ001698GF110934GGTTCCATCACGCAGGAGT8723
GTTGATCCGCTTGTTCGAC

aPredicted amplicon size based on nucleotide sequence in VectorBase [50]. *CHP: Conserved hypothetical protein.

SSR primer sequences. aPredicted amplicon size based on nucleotide sequence in VectorBase [50]. Primer sequences for genes used in library screening. aPredicted amplicon size based on nucleotide sequence in VectorBase [50]. *CHP: Conserved hypothetical protein. Well position of marker loci within select positive microplates was determined by DNA-DNA hybridization. Four individual clones were identified by probing with P32-labeled PCR amplicons (C127GAC1, C65AC1, C99TGT1, and FOXO) and thereafter sized with PFGE. Briefly, microplates representing positive pools were replicated to Colony/Plaque screen hybridization membranes (NEN™, Life Science Products) following Jiménez et al. [36]. Hybridizations and radiolabeling of the target clones were conducted following our standard probing procedures [44]. The presence of the marker locus in each of the four clones was confirmed by PCR and UV visualization on 2% agarose gels, as described for plate pool screening.

Results and Discussion

We have constructed a BAC library for Cx. quinquefasciatus, an important human disease vector and a major species in the Cx. pipiens complex, using high molecular weight DNA extracted from Johannesburg strain pupae and partially digested with HindIII. The Notre Dame Johannesburg (NDJ) library consists of 144 384-well microplates containing 55,296 clones. NotI digestion and pulsed-field gel electrophoresis of 82 randomly selected clones produced fragments ranging from 50 to 190 kb in length (mean = 106 kb) and no empty vectors (Figures 1 and 2). Southern blotting with BAC vector and Cx. quinquefasciatus gDNA indicated that the inserts are of Culex origin and all BACs appear to be fully digested (Figure 2B). Based on a mean insert size of 106 kb and a genome size of 579 Mbp, the BAC library provides ~10.1-fold coverage of the Cx. quinquefasciatus genome.
Figure 1

Insert size distribution of BAC clones in the NDJ library based on pulsed-field gel electrophoresis of 82 randomly selected clones.

Figure 2

. A. Pulsed-field gel electrophoresis of 38 randomly selected clones and 4 clones containing markers used in plate pool screening. B. Southern transfer of the BACs from panel A hybridized with a mixture of total Cx. quinquefasciatus gDNA and BAC vector.

Insert size distribution of BAC clones in the NDJ library based on pulsed-field gel electrophoresis of 82 randomly selected clones. . A. Pulsed-field gel electrophoresis of 38 randomly selected clones and 4 clones containing markers used in plate pool screening. B. Southern transfer of the BACs from panel A hybridized with a mixture of total Cx. quinquefasciatus gDNA and BAC vector. To further assess the quality of the library, we prepared and screened DNA extractions representing each of the 144 plate pools with 29 simple sequence repeat (SSR) markers representing all three linkage groups (Figure 3). The number of positive plate pools for each SSR ranged from 0 to 29, resulting in a mean of 8.7 positive plate pools per screen. Only one of the SSR markers (C134AC1) did not amplify in any of the plate pools. Nevertheless, a gene sequence (CPIJ007110) on the same supercontig (3.134), ~80 kb downstream, amplified in 12 plate pools. In addition to the SSRs, we screened the plate pools with primers designed to amplify sequences within exons of four genes previously determined to have a role in reproductive diapause in Cx. pipiens sensu stricto (s.s.) [42,43]. The number of positive plate pools for the gene sequences ranged from three to 23, resulting in a mean of 10.8 positive plate pools per gene (Table 2). The size distribution of the four individual clones selected by probing with radiolabeled markers is similar to the size distribution of the library (Figure 2A). The overall mean number of positive plate pools for the 29 SSRs and five genes used to screen the library was 9.0, indicating that the NDJ BAC library represents ~9 BAC clones per marker across the Cx. quinquefasciatus genome, assuming that only one BAC clone per 384-well plate pool contains the target sequence.
Figure 3

Chromosome locations of the 29 SSRs used to screen the NDJ BAC library. SSR markers indicated by brackets '{' were extracted and developed from genome assembly supercontig sequences anchored as indicated to loci from the existing linkage map [48,49]. Map distances are given in Kosambi centiMorgans.

Chromosome locations of the 29 SSRs used to screen the NDJ BAC library. SSR markers indicated by brackets '{' were extracted and developed from genome assembly supercontig sequences anchored as indicated to loci from the existing linkage map [48,49]. Map distances are given in Kosambi centiMorgans. Detailed genetic and genomic studies among the Cx. pipiens complex could provide valuable insights into the molecular genetic mechanisms influencing important traits such as vector competence, insecticide resistance, and reproductive diapause. Despite morphological similarities and their ability to form hybrid populations, species within the complex differ in several life history traits. For example, Cx. quinquefasciatus requires a blood meal prior to laying eggs (anautogenous) and is unable to enter diapause and overwinter in cold climates. Cx. pipiens and Cx. pipiens pallens also are anautogenous but adult females are able to enter reproductive diapause and survive winter in temperate climates, and Cx. pipiens molestus is able to lay eggs without taking a blood meal (autogenous) but does not enter diapause [45-47]. Presently, detailed molecular analyses of these traits are limited by the fragmented genome assembly. Fingerprinting, end-sequencing and physical assembly of the NDJ BAC library would likely facilitate the construction of a more complete genome sequence assembly by serving as a template for genome finishing, including gap-filling, as well as providing resources to enable the assignment of the individual superscaffolds to their respective chromosome position via in situ hybridization. In summary, the NDJ BAC library provides a valuable resource for marker development, positional cloning, and genome sequence assembly enhancement for Cx. quinquefasciatus thus helping to advance genome studies in Cx. pipiens complex mosquitoes.

Library availability

The NDJ BAC library is available to researchers through the Clemson University Genomics Institute (see Culex pipiens library CPQLBa at http://www.genome.clemson.edu/).

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

PVH drafted the manuscript and helped design probes for library screening. AM performed the initial genetic mapping and provided the pupae used in library construction. CAS constructed the library, estimated insert sizes and assisted in writing the manuscript. BD and DDL designed probes for library screening. BD performed plate pool screening. The project was conceived and supervised by DWS. All authors approved of the final version.
  42 in total

1.  Utilization of a zebra finch BAC library to determine the structure of an avian androgen receptor genomic region.

Authors:  Meizhong Luo; Yeisoo Yu; Hyeran Kim; Dave Kudrna; Yuichiro Itoh; Robert J Agate; Esther Melamed; José L Goicoechea; Jayson Talag; Christopher Mueller; Wenming Wang; Jennifer Currie; Nicholas B Sisneros; Rod A Wing; Arthur P Arnold
Journal:  Genomics       Date:  2006-01       Impact factor: 5.736

2.  Biometrical studies on intergradation in the genitalia of certain populations of Culex pipiens and Culex quinquefasciatus in the United States.

Authors:  S SUNDARARAMAN
Journal:  Am J Hyg       Date:  1949-11

3.  The effect of temperature and photoperiod on blood-feeding and ovarian development in mosquitoes of the Culex pipiens complex.

Authors:  B F Eldridge
Journal:  Am J Trop Med Hyg       Date:  1968-01       Impact factor: 2.345

4.  Computational and experimental analysis of microsatellites in rice (Oryza sativa L.): frequency, length variation, transposon associations, and genetic marker potential.

Authors:  S Temnykh; G DeClerck; A Lukashova; L Lipovich; S Cartinhour; S McCouch
Journal:  Genome Res       Date:  2001-08       Impact factor: 9.043

5.  Midgut barrier imparts selective resistance to filarial worm infection in Culex pipiens pipiens.

Authors:  Michelle L Michalski; Sara M Erickson; Lyric C Bartholomay; Bruce M Christensen
Journal:  PLoS Negl Trop Dis       Date:  2010-11-02

6.  A first generation BAC-based physical map of the Asian seabass (Lates calcarifer).

Authors:  Jun Hong Xia; Felicia Feng; Grace Lin; Chun Ming Wang; Gen Hua Yue
Journal:  PLoS One       Date:  2010-08-05       Impact factor: 3.240

7.  The genome sequence of the malaria mosquito Anopheles gambiae.

Authors:  Robert A Holt; G Mani Subramanian; Aaron Halpern; Granger G Sutton; Rosane Charlab; Deborah R Nusskern; Patrick Wincker; Andrew G Clark; José M C Ribeiro; Ron Wides; Steven L Salzberg; Brendan Loftus; Mark Yandell; William H Majoros; Douglas B Rusch; Zhongwu Lai; Cheryl L Kraft; Josep F Abril; Veronique Anthouard; Peter Arensburger; Peter W Atkinson; Holly Baden; Veronique de Berardinis; Danita Baldwin; Vladimir Benes; Jim Biedler; Claudia Blass; Randall Bolanos; Didier Boscus; Mary Barnstead; Shuang Cai; Angela Center; Kabir Chaturverdi; George K Christophides; Mathew A Chrystal; Michele Clamp; Anibal Cravchik; Val Curwen; Ali Dana; Art Delcher; Ian Dew; Cheryl A Evans; Michael Flanigan; Anne Grundschober-Freimoser; Lisa Friedli; Zhiping Gu; Ping Guan; Roderic Guigo; Maureen E Hillenmeyer; Susanne L Hladun; James R Hogan; Young S Hong; Jeffrey Hoover; Olivier Jaillon; Zhaoxi Ke; Chinnappa Kodira; Elena Kokoza; Anastasios Koutsos; Ivica Letunic; Alex Levitsky; Yong Liang; Jhy-Jhu Lin; Neil F Lobo; John R Lopez; Joel A Malek; Tina C McIntosh; Stephan Meister; Jason Miller; Clark Mobarry; Emmanuel Mongin; Sean D Murphy; David A O'Brochta; Cynthia Pfannkoch; Rong Qi; Megan A Regier; Karin Remington; Hongguang Shao; Maria V Sharakhova; Cynthia D Sitter; Jyoti Shetty; Thomas J Smith; Renee Strong; Jingtao Sun; Dana Thomasova; Lucas Q Ton; Pantelis Topalis; Zhijian Tu; Maria F Unger; Brian Walenz; Aihui Wang; Jian Wang; Mei Wang; Xuelan Wang; Kerry J Woodford; Jennifer R Wortman; Martin Wu; Alison Yao; Evgeny M Zdobnov; Hongyu Zhang; Qi Zhao; Shaying Zhao; Shiaoping C Zhu; Igor Zhimulev; Mario Coluzzi; Alessandra della Torre; Charles W Roth; Christos Louis; Francis Kalush; Richard J Mural; Eugene W Myers; Mark D Adams; Hamilton O Smith; Samuel Broder; Malcolm J Gardner; Claire M Fraser; Ewan Birney; Peer Bork; Paul T Brey; J Craig Venter; Jean Weissenbach; Fotis C Kafatos; Frank H Collins; Stephen L Hoffman
Journal:  Science       Date:  2002-10-04       Impact factor: 47.728

8.  Genetic basis for reproductive diapause is correlated with life history traits within the Culex pipiens complex.

Authors:  A Mori; J Romero-Severson; D W Severson
Journal:  Insect Mol Biol       Date:  2007-07-17       Impact factor: 3.585

9.  Sequencing of Culex quinquefasciatus establishes a platform for mosquito comparative genomics.

Authors:  Peter Arensburger; Karine Megy; Robert M Waterhouse; Jenica Abrudan; Paolo Amedeo; Beatriz Antelo; Lyric Bartholomay; Shelby Bidwell; Elisabet Caler; Francisco Camara; Corey L Campbell; Kathryn S Campbell; Claudio Casola; Marta T Castro; Ishwar Chandramouliswaran; Sinéad B Chapman; Scott Christley; Javier Costas; Eric Eisenstadt; Cedric Feschotte; Claire Fraser-Liggett; Roderic Guigo; Brian Haas; Martin Hammond; Bill S Hansson; Janet Hemingway; Sharon R Hill; Clint Howarth; Rickard Ignell; Ryan C Kennedy; Chinnappa D Kodira; Neil F Lobo; Chunhong Mao; George Mayhew; Kristin Michel; Akio Mori; Nannan Liu; Horacio Naveira; Vishvanath Nene; Nam Nguyen; Matthew D Pearson; Ellen J Pritham; Daniela Puiu; Yumin Qi; Hilary Ranson; Jose M C Ribeiro; Hugh M Roberston; David W Severson; Martin Shumway; Mario Stanke; Robert L Strausberg; Cheng Sun; Granger Sutton; Zhijian Jake Tu; Jose Manuel C Tubio; Maria F Unger; Dana L Vanlandingham; Albert J Vilella; Owen White; Jared R White; Charles S Wondji; Jennifer Wortman; Evgeny M Zdobnov; Bruce Birren; Bruce M Christensen; Frank H Collins; Anthony Cornel; George Dimopoulos; Linda I Hannick; Stephen Higgs; Gregory C Lanzaro; Daniel Lawson; Norman H Lee; Marc A T Muskavitch; Alexander S Raikhel; Peter W Atkinson
Journal:  Science       Date:  2010-10-01       Impact factor: 63.714

10.  VectorBase: a data resource for invertebrate vector genomics.

Authors:  Daniel Lawson; Peter Arensburger; Peter Atkinson; Nora J Besansky; Robert V Bruggner; Ryan Butler; Kathryn S Campbell; George K Christophides; Scott Christley; Emmanuel Dialynas; Martin Hammond; Catherine A Hill; Nathan Konopinski; Neil F Lobo; Robert M MacCallum; Greg Madey; Karine Megy; Jason Meyer; Seth Redmond; David W Severson; Eric O Stinson; Pantelis Topalis; Ewan Birney; William M Gelbart; Fotis C Kafatos; Christos Louis; Frank H Collins
Journal:  Nucleic Acids Res       Date:  2008-11-21       Impact factor: 16.971

View more
  6 in total

1.  Composite linkage map and enhanced genome map for Culex pipiens complex mosquitoes.

Authors:  Paul V Hickner; Akio Mori; Dave D Chadee; David W Severson
Journal:  J Hered       Date:  2013-07-11       Impact factor: 2.645

2.  Mitotic-chromosome-based physical mapping of the Culex quinquefasciatus genome.

Authors:  Anastasia N Naumenko; Vladimir A Timoshevskiy; Nicholas A Kinney; Alina A Kokhanenko; Becky S deBruyn; Diane D Lovin; Vladimir N Stegniy; David W Severson; Igor V Sharakhov; Maria V Sharakhova
Journal:  PLoS One       Date:  2015-03-13       Impact factor: 3.240

3.  De novo transcriptome sequencing and sequence analysis of the malaria vector Anopheles sinensis (Diptera: Culicidae).

Authors:  Bin Chen; Yu-Juan Zhang; Zhengbo He; Wanshun Li; Fengling Si; Yao Tang; Qiyi He; Liang Qiao; Zhentian Yan; Wenbo Fu; Yanfei Che
Journal:  Parasit Vectors       Date:  2014-07-07       Impact factor: 3.876

4.  Identification of protease m1 zinc metalloprotease conferring resistance to deltamethrin by characterization of an AFLP marker in Culex pipiens pallens.

Authors:  F F Zou; Q Guo; Y Sun; D Zhou; M X Hu; H X Hu; B Q Liu; M M Tian; X M Liu; X X Li; L Ma; B Shen; C L Zhu
Journal:  Parasit Vectors       Date:  2016-03-23       Impact factor: 3.876

5.  Association of a Chromosomal Rearrangement Event with Mouse Posterior Polymorphous Corneal Dystrophy and Alterations in Csrp2bp, Dzank1, and Ovol2 Gene Expression.

Authors:  Anna L Shen; Susan A Moran; Edward A Glover; Norman R Drinkwater; Rebecca E Swearingen; Leandro B Teixeira; Christopher A Bradfield
Journal:  PLoS One       Date:  2016-06-16       Impact factor: 3.240

6.  Detection and quantitation of copy number variation in the voltage-gated sodium channel gene of the mosquito Culex quinquefasciatus.

Authors:  Walter Fabricio Silva Martins; Krishanthi Subramaniam; Keith Steen; Henry Mawejje; Triantafillos Liloglou; Martin James Donnelly; Craig Stephen Wilding
Journal:  Sci Rep       Date:  2017-07-19       Impact factor: 4.379

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.