Literature DB >> 21867516

Improved specificity for detection of Mycobacterium bovis in fresh tissues using IS6110 real-time PCR.

Tyler C Thacker1, Beth Harris, Mitchell V Palmer, Wade R Waters.   

Abstract

BACKGROUND: Culture of M. bovis from diagnostic specimens is the gold standard for bovine tuberculosis diagnostics in the USA. Detection of M. bovis by PCR in tissue homogenates may provide a simple rapid method to complement bacterial culture. A significant impediment to PCR based assays on tissue homogenates is specificity since mycobacteria other than M. bovis may be associated with the tissues.
RESULTS: Previously published IS6110 based PCR diagnostic assays, along with one developed in house, were tested against environmental mycobacteria commonly isolated from diagnostic tissues submitted to the National Veterinary Services Laboratory. A real-time PCR assay was developed (IS6110_T) that had increased specificity over other IS6110 based assays. Of the 13 non-tuberculous mycobacteria tested with IS6110_T only M. wolinskyi was positive. Thirty M. bovis infected tissue homogenates and 18 control tissues were used to evaluate the potential for the assay as a diagnostic test. In this small sample, IS6110_T detected 20/30 samples from M. bovis infected animals and 0/18 control tissues.
CONCLUSIONS: The IS6110_T assay provides a PCR based assay system that is compatible with current diagnostic protocols for the detection of M. bovis in the USA and compliments current testing strategies.

Entities:  

Mesh:

Substances:

Year:  2011        PMID: 21867516      PMCID: PMC3170578          DOI: 10.1186/1746-6148-7-50

Source DB:  PubMed          Journal:  BMC Vet Res        ISSN: 1746-6148            Impact factor:   2.741


Background

Mycobacterium bovis is the causative agent of bovine tuberculosis. Isolation of M. bovis from tissues harvested from suspect animals remains the gold standard for diagnosis. Although bacteriological culture is a reliable, definitive method for detection of M. bovis it takes a significant amount of time. Detecting the presence of M. bovis DNA in tissues prepared for culture may provide a simple, rapid diagnostic method. Mycobacteria other than M. bovis are routinely isolated from tissues submitted for diagnostic culture. These non-M. bovis mycobacteria may interfere with PCR diagnostic tests performed on these tissues if the test does not have sufficient specificity. Most PCR primer pairs published to date were designed for identification of mycobacteria that have been isolated by culture. Use of selective media and biochemical tests can eliminate many non-M. bovis mycobacteria prior to PCR tests; however, PCR assays on tissues that may have non-M. bovis mycobacteria requires sufficient specificity to differentiate environmental mycobacteria from M. bovis. To address this possibility, DNA from strains of mycobacteria other than M. bovis, that are routinely isolated from diagnostic samples, were tested for cross reactivity with the commonly used IS6110 PCR primer pairs used to detect M. bovis.

Results

Specificity of PCR primers

The following mycobacteria are routinely isolated from tissues submitted for M. bovis diagnostic culture at the National Veterinary Services Laboratories: M. smegmatis, M. terrae, M. goodii, M. fortuitum, M. kansasii, M. wolinskyi, M. simiae, M. peregrinum, M. intracellulare, M. chelonae, M. avium subsp avium, and M.avium subsp paratuberculosis. DNA from these strains were used to determine the specificity of two previously published PCR primer pairs IS41/43[1] and IS6110[2]. Both sets of primers generated a PCR product for M. bovis, M. terrae, M. goodii, and M. wolinskyi (Table 1). The IS41/43 primer pair also detected M. fortuitum; whereas, IS6110 primer pair cross-reacted with M. peregrinum and M. chelonae.
Table 1

Comparison of primer specificity using reference strains of Mycobacteria commonly isolated from clinical samples.

Primers

Conventional PCRReal-time PCR
Mycobacterium speciesIS6110aIS41/IS43bIS6110_TIS6110_T

M. bovis++++
M. terrae++
M. goodii+++
M. fortuitum+
M. kansasii
M. avium subsp. Paratuberculosis
M. wolinskyi++++
M. simiae
M. peregrinum+
M. intracellulare
M. chelonae+
M. avium subsp avium
M. smegmatis

a [2]

b [1]

Comparison of primer specificity using reference strains of Mycobacteria commonly isolated from clinical samples. a [2] b [1]

Development of real-time PCR primers with increased specificity

The cross reactivity of previously published primers with commonly isolated environmental mycobacteria necessitated the development of primers with greater specificity. Primers and probe for real-time PCR were developed that targeted IS6110 (IS6110_T). The primers were tested for specificity using the mycobacteria described above (Table 1). The IS6110_T primer pair generated a PCR product from M. bovis, M. wolinskyi and M. goodii using conventional PCR; however, using the primers and probe in a real-time PCR assay resulted in a positive reaction to only M. bovis and M. wolinskyi (Table 1). A 317 bp region of M. wolinskyi and M. bovis genomes that contained the region amplified by the primers used in this paper were sequenced to determine if a test with higher specificity could be developed using this region. The amplified region from M. wolinskyi was 100% identical to that of M. bovis. Portions of the 16S gene was sequenced to confirmed the identity of M. wolinskyi.

Establishing assay conditions

The limit of detection for IS6110_T was 100 fg of M. bovis DNA. The limit of detection was determined using serial dilutions of M. bovis DNA. Clinical tissue samples will contain bovine (or other species being tested) DNA that may inhibit the real-time PCR reaction. To determine the effect of non-target DNA on the real-time PCR reaction, increasing amounts of bovine DNA was spiked with M. bovis DNA. M. bovis was detectable in up to 1 μg of bovine DNA. At 2 μg of bovine DNA inhibition of the PCR was detected. To test the utility of this assay to detect M. bovis in clinical samples, DNA was isolated from tissue homogenates that were culture positive for M. bovis or M. smegmatis. Real-time PCR using primers for M. bovis and bovine β-actin was performed on each sample in duplicate. β-actin served as a control to detect inhibition of the PCR reaction. A sample was considered positive when a PCR product was detected in both duplicates from β-actin and IS6110. Initial studies using both conventional and real-time PCR assays only detected 2/10 and 1/10 samples respectively. It was hypothesized that the low level of detection was due to relatively little M. bovis DNA relative to bovine DNA present in samples. To test this hypothesis, DNA from 4 homogenized tissues that were culture positive for M. bovis and one that was culture positive for M. smegmatis were chosen. Real-time PCR reactions were prepared with increasing amounts of DNA from these samples (100 ng to 1000 ng). One of the four M. bovis culture positive samples was PCR positive when 100 ng and two of four when 250 ng of DNA was used in the PCR reaction (Table 2). Increasing DNA concentration did not result in detection of the remaining samples.
Table 2

Results of increasing starting DNA on real-time PCR assay performance.

Sample
01916a4022a4477b01870a04034a
DNAcIS6110_Tβ-actinIS6110_Tβ-actinIS6110_Tβ-actinIS6110_Tβ-actinIS6110_Tβ-actin

100++-+-+-+-+
250++++-+-+-+
500++++-+-+-+
1000++++-+-+-+

a M. bovis infected tissues

b M. smegmatis infected tissues

c DNA isolated from homogenized tissues added to PCR reaction in nanograms.

Results of increasing starting DNA on real-time PCR assay performance. a M. bovis infected tissues b M. smegmatis infected tissues c DNA isolated from homogenized tissues added to PCR reaction in nanograms. To increase the sensitivity of the assay, a nested PCR strategy was developed. Initially, conventional PCR was performed using primer IS41 and the IS6110_T reverse primer to generate a 334 base pair product that encompasses the region targeted by the real-time PCR assay. Five microliters of the initial PCR reaction was used as the template in the real-time PCR assay. The samples described above were tested using the nested assay. M. bovis DNA was detected in all four of the samples from infected tissues.

Detection of M. bovis in tissues from naturally infected animals

Additional tissue homogenates were obtained to test the diagnostic potential of this assay. DNA was isolated from tissues of M. bovis infected cattle (n = 30) and non-M. bovis infected animals (n = 18). Of the 30 M. bovis culture positive tissues 20 were PCR positive; whereas, no PCR product was detected in the non-M. bovis infected tissues (Table 3).
Table 3

Results of real-time PCR using IS6110_T to detect M. bovis in diagnostic samples.

Culture Results
Result from PCR assayM. bovisNon-M. bovis

Positive200
Negative1018
Results of real-time PCR using IS6110_T to detect M. bovis in diagnostic samples.

Discussion

A number of factors may affect the ability of a PCR based test to be successful. Uncharacterized PCR inhibitors can be carried over from DNA isolation procedures from blood and tissues. Although these may be a cause of concern, they are irrelevant if primers and probes with sufficient specificity are not available. Environmental mycobacteria present in lymph nodes submitted for diagnostic testing can confound assays that lack sufficient specificity. Detection of M. tuberculosis complex species using primers to IS6110 is well established; as evidenced by the large number of publications referencing the original publication by Eisenach et al. [2]. In the USA, IS6110 is the diagnostic target used at National Veterinary Services Laboratories for detection of M. bovis in fixed tissues [3,4]. Most publications testing the specificity of the method of Eisenach et al. are designed to detect M. tuberculosis with specificity being tested against mycobacteria thought to be common in humans. Because cattle may be infected with a different subset of non-tuberculous mycobacteria than those infecting humans, we sought to determine if established PCR protocols targeting IS6110 would be appropriate for strains isolated from cattle in the USA. In the present study, Eisenach et al. primers cross-reacted with mycobacteria other than M. tuberculosis complex species (Table 1). Redesign of the primers and the addition of a probe increased the specificity against strains commonly isolated from cattle in the USA. Cross-reactivity to M. wolinskyi remained after redesign of the probe used in the real-time PCR reaction. Sequencing of the region targeted by the IS6110 primers and probes revealed that the region was identical between M. bovis and M. wolinskyi. The region of the IS6110 that is targeted by these primers is in the 5' region of the transposase gene, which may be common between IS6110 and another insertion sequence in M. wolinskyi. The 16S gene of the M. wolinskyi sample used in this study was sequenced to confirm the identity of the isolate. The impact of this cross reactivity will be relatively minor since M. wolinskyi was only isolated 3 times between 2004 and October 2010. Thirty M. bovis infected and 18 non-M. bovis infected tissues were used to test the utility of this assay. None of the tissues from non-M. bovis infected animals were positive by PCR. Although the sample size is small the apparent specificity is 100% (95% CI, 44.1%-89.5%). This assay detected M. bovis DNA in 20 of the 30 culture positive samples tested, with an apparent sensitivity of 66.7% (95% CI, 47.2%-82.7%). Several methodologies have previously been employed to increase sensitivity. Parra et al. used a capture probe to isolate mycobacterial DNA from tissue homogenates [5] achieving a similar sensitivity (65.6%) to that reported here. Taylor et al. reported a sensitivity of 70% when performing PCR directly on tissue homogenates, but increased the sensitivity to 91% when PCR was only performed on DNA isolated from lesions excised from the tissues rather than whole tissue homogenates [6]. The limitation of this method is that the assay can only be performed on tissues that have visible lesions, thus excluding samples without readily apparent lesions.

Conclusions

The use of a PCR assay to detect M. bovis in tissue homogenates may provide a more rapid method for providing diagnostic test results to field veterinarians than culture. The IS6110_T real-time PCR assay provides increased specificity over previously published IS6110 assays with a sensitivity of 66.7%. A large-scale study is needed to determine if the sensitivity of the assays are adequate for the Bovine TB Eradication Program in the USA.

Methods

Mycobacterial Strains

The following reference strains obtained from ATCC: M. smegmatis (ATCC 35797), M. terrae (ATCC 15755), M. goodii (ATCC 700504), M. fortuitum (ATCC 6841), M. kansasii (ATCC 12478), M. wolinskyi (ATCC 700010), M. simiae (ATCC 25275), M. peregrinum (ATCC 14467), M. intracellulare (ATCC 13950) and M. chelonae (ATCC 35752). M. bovis, M. avium, and M. avium subspecies paratuberculosis were well characterized clinical field isolates. Mycobacteria were grown in grown in Middlebrook 7H9 medium supplemented with 10% oleic acid-albumin-dextrose complex (Becton Dickinson Microbiology Systems, Franklin Lakes, NJ. Mycobactin J was added to culture media when growing M. paratuberculosis. DNA was isolated using the following method. Mycobacteria from 1.5 ml o f culture were washed once with 1 × Tris-EDTA (TE) buffer and resuspended in 500 μl TE. Twenty microliters of 100 mg/ml Lysozyme (Sigma, St. Louis, MO) was added and incubated for a minimum of 3 hours or overnight at 37°C. SDS was added to a final concentration of 1% followed by the addition of 150 μg of Proteinase K (Roche Applied Science, Indianapolis, IN) and incubated for 3 hours at 65°C. Following protein digestion, 100 μl of 5 M NaCl was added. One hundred microliters of CTAB/NaCl (274 mM hexadecyltrimethylammonium bromide/0.7 M NaCl, Sigma). The resulting solution was mixed thoroughly by inverting tube then incubated at 65°C for 10 minutes. An equal volume of Phenol/chloroform/isoamyl alcohol (25:24:1) was added and an emulsion formed by vortexing then centrifuged at 16,000 × g for 5 minutes at room temperature. The aqueous phase was removed to a fresh tube and equal volume of isopropanol was added and the samples were placed at -80°C. Precipitated DNA was collected by centrifugation at 16,000 × g for 150 minutes at 4°C. The isopropanol was removed and 1 ml of ice-cold 70% ethanol was added. The sample was centrifuged at 16,000 × g for 5 minutes and the ethanol removed. The samples were then dried at room temperature until dry. The DNA pellet was resuspended in PCR grade water.

Isolation of DNA from fresh tissues

Forty-eight (42 bovine, 5 cervine, 1 porcine) homogenized lymph nodes submitted as part of USDA's National Bovine Tuberculosis Eradication Program were obtained from the Mycobacteria and Brucella Section at the National Veterinary Services Laboratories during 2005 and 2006. Homogenization and decontamination of tissues was performed according to established protocols [7] in preparation for recovery of M. bovis by culture. Homogenates not used to inoculate culture media were frozen at -80°C until used in PCR assays. Five hundred microliters of the homogenate was heat inactivated by incubating the sample in a screw-topped microcentrifuge tube at 80°C for 40 minutes. After 20 minutes the sample was mixed. Particulate matter (including mycobacteria) was collected by centrifuging the sample for 10 minutes at 13,000 × g. The supernatant was discarded and the pellet resuspended in 500 μl ASL buffer (Qiagen, Valencia, CA) followed by a 5 min incubation at 95°C. After cooling to 56°C, 125 μg of Proteinase K (Sigma, St. Louis, MO) was added to samples. Buffer AL (Qiagen) was then added and the sample was incubated overnight at 56°C. Liberated DNA was isolated using the Qiamp Blood Mini Kit according to the manufacturer's directions except that 500 μl of cold 100% ethanol was added before the sample was applied to the column.

Detection of mycobacterial DNA by conventional PCR

The following primer pairs were tested IS41/43 [1], IS6110 [2], and primers designed in house IS6110_T forward (5'-AGTTTGGTCATCAGCCGTTC-3') and IS6110_T reverse (5'-CGAACTCAAGGAGCACATCA-3') using Primer3 [8]. The following optimized protocols were used with 50 μl PCR reactions. IS41/43: A 50 μl reaction was prepared using 1 × PCR reaction buffer (final MgCl2 2 mM), 1 U FastStart Taq, 2.5 mM each dNTP's (Roche), 5 μg BSA (Ambion), 2.5 pmol of each primer, and with 0.5 μl DNA. A touch down PCR method was used to reduce false priming and increase specificity. The following conditions were used: an initial activation step of 94°C for 2 min. The following cycle was repeated 7 times: 94°C for 45 seconds, 72°C for 1 min (-1°C/cycle), then 72°C extension for 2 min. Amplification was continued by cycling through the following conditions for an additional 28 times: 94°C for 1 minute, 65°C for 1 min then 72°C for 2 min. A final 10 min extension was performed. IS6110_T: 50 μl reactions were prepared as for the IS41/43 primers except that 1 pmol of each primer was added. PCR with these primers was performed using the following thermocycler conditions: an initial activation step of 94°C for 2 min. The following cycle was repeated 14 times: 94°C for 45 seconds, 65°C for 1 min (-1°C/cycle), then 72°C extension for 2 min. Amplification was continued by cycling through the following conditions an additional 28 times: 94°C for 1 minute, 50°C for 1 min then 72°C for 2 min. A final 10 min extension was performed. IS6110 Primers: A 50 μl reaction was prepared with the following components: 1 × Gene Amp PCR Buffer II (final MgCl2 concentration 2.5 mM), 1.25 U AmpliTaq Gold (Applied Biosystems), 2.5 mM each dNTP (Roche), 2.5 pmol each primer, and 0.5 μl template. All PCR products were analyzed on a 1.5% agarose gel (Invitrogen) stained with ethidium bromide and visualized with a Bio-Rad Gel Doc XR.

Detection of mycobacterial DNA by real-time PCR

Detection of Mycobacterial DNA by real-time PCR was performed using the IS6110_T primers and a 5' Hex labeled probe (5'-AGCCACACTTTGCGGGCACC-3') with a 3' Iowa Black FQ quencher (Integrated DNA Technologies). Taqman Universal PCR Mastermix (Applied Biosystems) was used according to the manufacturer's directions with a final primer concentration of 0.4 μM each and 0.1 μM probe. The real-time PCR was run in an ABI7500. Detection of β-actin was used as a PCR control.

Detection of β-actin

PCR reactions to detect mammalian β-actin were performed parallel with each sample. The primers 5'- TCCCTGGAGAAGAGCTACGA -3' and 5'- AGGAAGGAAGGCTGGAAGAG -3' and FAM labeled probe 5'- TCACCATCGGCAATGAGCGG -3' with a 3' Iowa Black FQ quencher (Integrated DNA Technologies) were designed using Primer3Plus [9]. β-actin PCR was performed as described for IS6110_T. β-actin was included as a positive control for the PCR reaction and to detect successful DNA extraction from tissue homogenates. Lack of amplification was assumed to indicate that the PCR reaction was inhibited. For a sample to be considered positive PCR products from both the IS6110 PCR and β-actin PCR needed to occur.

Nested real-time PCR

The initial outside PCR reaction was carried out as described for IS6110_T (conventional PCR) except 2.5 pmol of the primers IS41 and IS6110_T reverse with 5 μg bovine serum albumin (Ambion). The second step was carried out as described above.

Sequencing

IS6110 Products: PCR products were excised from a 1% agarose gel after electrophoresis. The PCR products were extracted from the gel and purified using a Gel extraction Kit (Qiagen) according to the manufacturer's instructions. Sequencing was performed by the Genomics facility at the National Animal Disease Center using standard techniques. 16S Gene: Primers T39 and T13 from Talaat et al. [10] were used to PCR amplify a portion of the 16S Gene. The PCR product was purified using a MinElute PCR Purification Kit (Qiagen) according to the manufacturer's instructions. The purified product was sequenced as above. The sequence was identified as M. wolinskyi using the Ridom Databse with 100% identity [11].

Statistical analysis

Calculation of the diagnostic specificity and sensitivity along with 95% confidence intervals (CI) were done using epiR package (version 0.9-26) in R (version 2.11.1) [12].

Authors' contributions

TCT conceived the study, participated in its design, data acquisition and analysis, and wrote the paper. BH participated in design of the study and data analysis. MVP and WRW participated in study design and data interpretation. All authors read and approved the final manuscript.
  11 in total

1.  Primer3 on the WWW for general users and for biologist programmers.

Authors:  S Rozen; H Skaletsky
Journal:  Methods Mol Biol       Date:  2000

2.  RIDOM: Ribosomal Differentiation of Medical Micro-organisms Database.

Authors:  Dag Harmsen; Jörg Rothgänger; Matthias Frosch; Jürgen Albert
Journal:  Nucleic Acids Res       Date:  2002-01-01       Impact factor: 16.971

3.  Differentiation of Mycobacterium tuberculosis and Mycobacterium bovis BCG by a polymerase chain reaction assay.

Authors:  B B Plikaytis; K D Eisenach; J T Crawford; T M Shinnick
Journal:  Mol Cell Probes       Date:  1991-06       Impact factor: 2.365

4.  Polymerase chain reaction amplification of a repetitive DNA sequence specific for Mycobacterium tuberculosis.

Authors:  K D Eisenach; M D Cave; J H Bates; J T Crawford
Journal:  J Infect Dis       Date:  1990-05       Impact factor: 5.226

5.  Identification of mycobacteria infecting fish to the species level using polymerase chain reaction and restriction enzyme analysis.

Authors:  A M Talaat; R Reimschuessel; M Trucksis
Journal:  Vet Microbiol       Date:  1997-11       Impact factor: 3.293

6.  Comparison of the recovery of Mycobacterium bovis isolates using the BACTEC MGIT 960 system, BACTEC 460 system, and Middlebrook 7H10 and 7H11 solid media.

Authors:  Nichole Hines; Janet B Payeur; Lorraine J Hoffman
Journal:  J Vet Diagn Invest       Date:  2006-05       Impact factor: 1.279

7.  Development of a molecular diagnostic test applied to experimental abattoir surveillance on bovine tuberculosis.

Authors:  A Parra; N García; A García; A Lacombe; F Moreno; F Freire; J Moran; J Hermoso de Mendoza
Journal:  Vet Microbiol       Date:  2007-09-18       Impact factor: 3.293

8.  Polymerase chain reaction detection of Mycobacterium tuberculosis complex and Mycobacterium avium organisms in formalin-fixed tissues from culture-negative ruminants.

Authors:  Janice M Miller; Allen L Jenny; Janet B Payeur
Journal:  Vet Microbiol       Date:  2002-06-05       Impact factor: 3.293

9.  Detection of Mycobacterium bovis in formalin-fixed, paraffin-embedded tissues of cattle and elk by PCR amplification of an IS6110 sequence specific for Mycobacterium tuberculosis complex organisms.

Authors:  J Miller; A Jenny; J Rhyan; D Saari; D Suarez
Journal:  J Vet Diagn Invest       Date:  1997-07       Impact factor: 1.279

10.  Primer3Plus, an enhanced web interface to Primer3.

Authors:  Andreas Untergasser; Harm Nijveen; Xiangyu Rao; Ton Bisseling; René Geurts; Jack A M Leunissen
Journal:  Nucleic Acids Res       Date:  2007-05-07       Impact factor: 16.971

View more
  21 in total

1.  Early Detection of Circulating Antigen and IgM-Associated Immune Complexes during Experimental Mycobacterium bovis Infection in Cattle.

Authors:  Konstantin P Lyashchenko; Rena Greenwald; Alina Sikar-Gang; Archana A Sridhara; Ashley Johnathan; Paul Lambotte; Javan Esfandiari; Mayara F Maggioli; Tyler C Thacker; Mitchell V Palmer; W Ray Waters
Journal:  Clin Vaccine Immunol       Date:  2017-06-05

2.  Pathology and diagnosis of Mycobacterium bovis in naturally infected dromedary camels (Camelus dromedarius) in India.

Authors:  Shirish Dadarao Narnaware; Shyam Singh Dahiya; Fateh Chand Tuteja; Govindasamy Nagarajan; Kashi Nath; Nitin Vasantrao Patil
Journal:  Trop Anim Health Prod       Date:  2015-08-23       Impact factor: 1.559

3.  Effects of Serial Skin Testing with Purified Protein Derivative on the Level and Quality of Antibodies to Complex and Defined Antigens in Mycobacterium bovis-Infected Cattle.

Authors:  W Ray Waters; Mitchell V Palmer; Molly R Stafne; Kristin E Bass; Mayara F Maggioli; Tyler C Thacker; Rick Linscott; John C Lawrence; Jeffrey T Nelson; Javan Esfandiari; Rena Greenwald; Konstantin P Lyashchenko
Journal:  Clin Vaccine Immunol       Date:  2015-04-08

4.  Heterozygosity at the A625C polymorphic site of the MyD88 gene is associated with Mycobacterium bovis infection in cattle.

Authors:  Rosanna Capparelli; Francesco De Chiara; Nunzia Nocerino; Chiara Medaglia; Rosa Di Costanzo; Luigi Ramunno; Federico Capuano; Francesco Casalinuovo; Antonio Di Matteo; Domenico Iannelli
Journal:  Infect Immun       Date:  2013-04-01       Impact factor: 3.441

5.  Direct PCR on Tissue Samples To Detect Mycobacterium tuberculosis Complex: an Alternative to the Bacteriological Culture.

Authors:  V Lorente-Leal; E Liandris; M Pacciarini; A Botelho; K Kenny; B Loyo; R Fernández; J Bezos; L Domínguez; L de Juan; B Romero
Journal:  J Clin Microbiol       Date:  2021-01-21       Impact factor: 5.948

6.  Circulating Mycobacterium bovis peptides and host response proteins as biomarkers for unambiguous detection of subclinical infection.

Authors:  Elise A Lamont; Harish K Janagama; Joao Ribeiro-Lima; Lucy Vulchanova; Meetu Seth; My Yang; Kiran Kurmi; W Ray Waters; Tyler Thacker; Srinand Sreevatsan
Journal:  J Clin Microbiol       Date:  2013-12-04       Impact factor: 5.948

7.  Interleukin-17A as a Biomarker for Bovine Tuberculosis.

Authors:  W Ray Waters; Mayara F Maggioli; Mitchell V Palmer; Tyler C Thacker; Jodi L McGill; H Martin Vordermeier; Linda Berney-Meyer; William R Jacobs; Michelle H Larsen
Journal:  Clin Vaccine Immunol       Date:  2015-12-16

8.  The rapid detection and differentiation of Mycobacterium tuberculosis complex members from cattle and water buffaloes in the delta area of Egypt, using a combination of real-time and conventional PCR.

Authors:  Mohamed Sabry Abd Elraheam Elsayed; Ali Amer
Journal:  Mol Biol Rep       Date:  2019-04-30       Impact factor: 2.742

9.  Development of integrated surveillance systems for the management of tuberculosis in New Zealand wildlife.

Authors:  D P Anderson; D S L Ramsey; G W de Lisle; M Bosson; M L Cross; G Nugent
Journal:  N Z Vet J       Date:  2015-03-12       Impact factor: 1.628

10.  An epidemiological perspective on bovine tuberculosis spotlighting facts and dilemmas in Iran, a historically zebu-dominant farming country.

Authors:  Keyvan Tadayon; Nader Mosavari; Mohammad Mehdi Feizabadi
Journal:  Iran J Microbiol       Date:  2013-03
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.