Polymerase chain reaction amplification of a repetitive DNA sequence specific for Mycobacterium tuberculosis.

A segment of DNA repeated in the chromosome of Mycobacterium tuberculosis was sequenced and used as a target for amplification using polymerase chain reaction (PCR). The sequences of the primers (5' to 3') were CCTGCGAGCGTAGGCGTCGG and CTCGTCCAGCGCCGCTTCGG, and a temperature of 68 degrees C was used for annealing the primers in the reaction. Amplification produced a 123-base-pair fragment with an internal SalI site. The specific PCR product was obtained with input DNA from 11 different strains of M. tuberculosis and Mycobacterium bovis and one strain of Mycobacterium simiae. No product was detected with DNA from 28 strains of the Mycobacterium avium complex, Mycobacterium scrofulaceum, Mycobacterium kansasii, Mycobacterium fortuitum, Mycobacterium chelonei, and Mycobacterium gordonae. The PCR product was detected by gel electrophoresis after 30 cycles using 1 fg of input DNA. Amplification of this sequence may provide the basis for an assay to detect M. tuberculosis directly in clinical material.