Literature DB >> 21717061

The use of microsatellite polymorphism in genetic mapping of the ostrich (Struthio camelus).

M Kawka1, R Parada, K Jaszczak, J O Horbańczuk.   

Abstract

The aim of this study was to determine microsatellite polymorphism in ostriches and using it in creation the genetic map of the ostrich. The polymorphism analysis covered 30 microsatellite markers characteristic of ostrich, for the CAU (China Agricultural University) group. The material consisted of 150 ostriches (Struthio camelus). The 30 microsatellite loci was examined and a total of 343 alleles was identified. The number of alleles at a single locus ranged from 5 at locus CAU78 to 34 at locus CAU85. The values for the observed heterozygosity H(o) ranged from 0.467 (locus CAU78) to 0.993 (locus CAU16), whereas for the expected heterozygosity H(e)--from 0.510 (locus CAU78) to 0.953 (locus CAU85). Analyzing the individual loci, the highest PIC value, more than 0.7 was observed for: loci CAU85 (0.932), CAU64 (0.861) and CAU32, 75 (0.852), respectively. It should be noted, that the microsatellite markers used in our study were very polymorphic as evidenced by the large number of detected alleles and high rates of heterozygosity, PIC and PE as well. The analysed microsatellite markers may be used in genetic linkage mapping of ostrich, the construction of a comparative genetic map with other ratites, such as emu and rhea, and population genetics studies or phylogenetic studies of these birds.

Entities:  

Mesh:

Year:  2011        PMID: 21717061      PMCID: PMC3271206          DOI: 10.1007/s11033-011-1107-5

Source DB:  PubMed          Journal:  Mol Biol Rep        ISSN: 0301-4851            Impact factor:   2.316


Introduction

In the recent years, the study of molecular genetics have contributed to a more profound recognition the genetic information of farm animals. This led to the creation of interdisciplinary programs of genomes mapping of important animal species. The principal aim of animal genome mapping is to determine the location and distances between genes on chromosomes as well as to search genetic markers, determining production traits (quantitative traits loci–QTLs). Identification of QTL provide genetic maps of high resolution i.e., containing a large number of equally distributers markers. From the breeding point of view genome mapping offers information facilitating selection for the necessary traits as it bases it on the genetic markers linked to them. Up to now, several genetic maps in agriculturally important animals have been reported such as pig [21], cattle [16], sheep [7], and chicken [8, 9]. Over the past several years, ostrich farming and breeding have been gaining popularity throughout the world as a new agricultural activity [2], since these birds provide dietetic meat, valuable skins, feathers and eggs [3, 4, 12, 22]. Recent interest in ratite farming, especially ostrich and emu, has led to an increasing demand for information about these birds [5, 13, 23], especially the genetics aspects [6, 11, 14, 17–19, 25, 26]. These studies are aimed at determining the genetic structure of these birds e.g., estimation of the genetic variability and analysis of the relationship between individuals belonging to a given populations [28]. In turn, we performed genetic analysis of the polish ostrich population using molecular methods [17]. The obtained results encourage for testing the available pool of ostrich microsatellites and identification a new microsatellite sequences. The next stage comprises the recognition of ostrich genome, which up to now has been studied very poor. It should be emphasized that currently in available literature there is a shortage of data on genetic linkage maps for any ratites. First, a preliminary genetic map of ostrich developed Huang et al. [14], analyzing 104 polymorphic microsatellite markers using a two-generation ostrich reference family. The main aim of this study was to determine the polymorphism of selected microsatellite markers characteristic for the ostriches, since microsatellite polymorphism is widely used in research on genome mapping. The study included also evaluation of the suitability of the analyzed loci for genome mapping of the ostrich.

Materials and methods

The experimental material consisted of feathers collected from 150 ostriches, collected from ostrich farm in Stypułów, which maintains the birds in conditions compliant with EU recommendations by the Committee of the European Convention for the Protection of Animals Kept for Farming Purposes (T-AP)—Draft Recommendation Concerning Ratites (Ostriches, Emus and Rheas) [24]. Ostrich genomic DNA was isolated from feathers (noninvasive methods) using Dneasy Tissue KIT 250 from QUIAGEN. Each sample was examined by spectrophotometer and electrophoresis. An analysis of 30 microsatellite sequences characteristic of ostrich [25], for the CAU (China Agricultural University) group was performed. One of the primer pairs has been labeled with one of the four dyes: 6-FAM, VIC, NED, PET. The characteristic of the loci is presented in Table 1. The amplification of selected microsatellite sequences was performed using a thermal cycler PTC-200 Engine (MJ Research). The PCR was carried out in a total volume of 10 ml comprising 10 ng of template DNA, 0.5 mM of each nucleotide, 100 pmol of each primer, 1.5 mM MgCl2, 50 mM KCL, 10 mM Tris–HCl, 0.01% Tryton X-100 and 0.5 units of DNA polymerase (POLGEN). The PCR conditions were optimized for all 30 primer pairs. The PCR protocol began with a denaturing step for 5 min at 94°C, 35 cycles of 94°C for 45 s, 52.5–69.5°C for 45 s (annealing), and at 72°C for 90 s (extension), with the final 10 min elongation step at 72°C. The fluorescent PCR products were separated by electrophoresis using the four-capillary genetic analyzer Applied Biosystems 3130 and the computer software GeneScan. The results were visualized and the genotyping was completed with GeneScan 2.1. In addition, the computer program GeneMapper (Applied Biosystems) was used to automatically determine of allele size for the individual markers.
Table 1

Characteristics of 30 ostrich microsatellite loci used in the study

MicrosatelliteSequence of microsatelliteRepeat motifNumber of allelesLength of alleles (bp)
CAU1TTACAAGCAAGGTAGAACCCA(AC)8AT(GC)3(AC)7 1086–104
GCAAGCAACCCAATCCCTG
CAU3AACTAAGTATAGCCCTGTTACA(CA)9 6115–125
TGCGAGTCTTTCTAGTTCTAC
CAU7CACTCCTGTCCCCTACTTG(AC)18 12185–211
CTGTAGTGTATTTAGAGACTGA
CAU11CCTTGACAGTCTTCCCATATGAC(CA)12 798–114
AACACAGAGGGCTTAGTCCTACA
CAU14ATTTAACTTCTCTAAGGCACTC(CA)16 14142–178
GAGGAGCAATTCAGACAGAC
CAU16TGTCCCTGCAGTCTCAGTTTT(CA)27 7188–204
GCCAGGTATGTGCATGTGTC
CAU17CGTAAACCCAGATAATCACAA(CA)22 11160–180
AGTGGCATTGTAGCTCTTCA
CAU22TGACTGTTAAATAAGCGAATGT(AC)11 7140–154
CATATATTAAGCCACTCTAAAAT
CAU23AGGAACCGTGGAACACATTT(CA)10 7165–193
GAGCTGTGAACGTCTTCATCC
CAU25ATGGGGCAGCATAAGAGTGT(CA)5CT(CA)8 6197–207
CCAGGTGAATTTGCCACATA
CAU30AGGGGAGCGTTCTCACTCA(CA)19 9117–137
GCCACAAAGCAAAAGACCAC
CAU32ATACTGGTTTTGATTTGTGTGAT(CA)10 7177–205
CATGGGAAGGGCAATAGATTT
CAU34ATTTGATAGCCAGAGCAGTTC(CA)12 7194–208
TCTTACAAGATTTCACTATATACA
CAU40ACGGGGAGACTCAAGGATG(CA)9 9138–156
GCTTGCGTGTGCATGAGTAT
CAU42AGTCCAGCCCGCATACAC(CA)10 7182–198
CCTCTGTGGAGAGAACTGTGTG
CAU43ACTGAGTGCCCAGGTTTGAG(CA)17 6211–221
TGCTGTTTCTTCTTCTTTTAGGG
CAU44GCAAAGCAGTGTCCTTAGTCAA(CA)12 5227–237
AGCGTGTATCTGCCACATGA
CAU57AAGAGGCAACAGGAATAGGTA(CA)7(TA)5(CA)5 6201–221
CAAAAATCTGGCTTGTCACTTA
CAU64AGCACCTCATCCCTCAAAC(CATA)7(CA)6(TA)4 9161–183
AGATTTGGAGCATGGACTATT(CA)15
CAU65TGAGAGTCTCCCAGAAATGC(TA)12(CA)9 6181–191
CAGAGAAATATATGCCTGTAAAT
CAU68TCTAAGCACTACCATCACGG(TA)7(CA)8…(CA)15 6265–275
GCTCCTTTTCATCTTTTAGGC
CAU69TGAGTAAGGCATGCTGCTTC(GA)19 6100–112
CCTAAATGCAACCCTTCTGTTT
CAU75ACAGACCAGGGAGTCCAGCA(GC)7(AC)18 7186–210
ACCCTGCACCTTGACAACAT
CAU76GCACCAATCTTGATGTCCTG(CA)11CG(CA)5 10220–254
ACCTACCCAGAATGGCTTGA
CAU78CAGGTGGAAAGTGGGTATGC(AC)8C5 5113–121
GCTTTGTAAGTGTGGGTGTGG
CAU83AAACAAGCCGCTAGTGAGGA(AC)16 8198–218
TGCAGACTCAGACCAGCATC
CAU84TATCAGTGCCATTATCGTCTC(CA)12 7202–214
TGTCCCTTCTGTTTCTAATACT
CAU85GAGGTGCCTGTCTTGTTTAC(AC)26 16204–276
AAAAGCACCTTCCCACATTG
CAU97TGCACGCACTAACTCCTGTC(CA)10 5152–166
AGTTCCCCTTCCAAATGCTT
CAU98CACTCCACCGAATGCCTTTA(CA)12 8134–178
TTTGTTCAGGTGCAGAATGC
Characteristics of 30 ostrich microsatellite loci used in the study The statistical analysis of obtained results was performed using Cervus [15] program. It included: determine the frequency of identified alleles, estimate the observed and expected heterozygosity, the polymorphic information content (PIC) and the exclusion probability (PE). The observed heterozygosity Ho was assessed for all the microsatellite loci examined in the population as the share of heterozygous genotypes in the overall pool of genotypes in the population. The expected heterozygosity He was calculated according to the formula by Ott [20] and Weir [27] but the PIC was estimated according to Botstain et al. [1]. In addition, the exclusion probability (PE) for each locus was valueted.

Results and discussion

We analyzed the ostrich population consisted of 150 birds. At the 30 microsatellite loci examined a total of 343 alleles were identified. The most polymorphic were loci: CAU84, CAU32, CAU7, CAU75 and CAU76, as characterized by the highest number of alleles. The number of alleles at a single locus ranged from 5 at locus CAU78 to 34 at locus CAU85. At each of the microsatellite loci studied a mean of 11.43 alleles was recorded. In the previous research Kawka et al. [17], analyzing 5 microsatellites identified 51 alleles. The number of alleles per locus ranged from 5 (locus VIAS-OS22) to 16 alleles (locus VIAS-OS29). The mean number of alleles per locus was 10.2. The similar research on isolation and characterization of 70 new microsatellite markers from ostrich conducted Tang et al. [25]. The number of alleles obtained by them ranged from 2 to 16—a mean of 5.6 per locus. However, in the studies of Ward et al. [26], the number of alleles per locus ranged from 5 to 18 and at Kimwele and Graves [19]—from 6 to 25. Based on the frequency of individual alleles for the studied microsatellite loci was estimated the observed heterozygosity (Ho), which included heterozygous genotypes and the expected heterozygosity (He), taking into consideration the number and frequency of alleles and the polymorphic information content (PIC) as well. The values for the observed heterozygosity Ho ranged from 0.467 at locus CAU78 to 0.993 at locus CAU16 (Table 2). The mean for all loci value of Ho was 0.840. In turn, the values for expected heterozygosity (He) estimated for population analyzed, ranged from 0.510 at locus CAU78 to 0.953 at locus CAU85. The mean He amounted to 0.791 per locus (Table 2). It should be noted that both values (Ho and He) in the studied ostrich population were relatively high. By comparison, Kimwele and Graves [19] indicated, that the value of mean heterozygosity He for a ostrich populations living in Nairobi National Park and ostriches kept on farms in Kenya, ranged from 0.40 to 0.79. In turn, Kawka et al. [17], examining the genetic variability within and among 3 ostrich breeds reported a mean observed and expected heterozygosity ranking from 0.463 to 0.663 and from 0.481 to 0.679, respectively. In a preliminary study of genetic diversity of emu populations (based on 5 microsatellite loci) kept on farms in Australia and Thailand and in the wild emu [10] obtained a wide range of value of He. In turn, for emus kept on a farm in Australia, this ratio ranged from 0.44 to 1, whereas in Thailand from 0.28 to 0.89.
Table 2

Observed heterozygosity (Ho) and expected heterozygosity (He) within the ostrich analysed

LocusHo He LocusHo He
CAU10.8800.867CAU430.9130.836
CAU30.9530.737CAU440.8600.688
CAU70.8070.701CAU570.7130.832
CAU110.9600.839CAU640.8930.876
CAU140.9600.821CAU650.7000.820
CAU160.9930.862CAU680.7800.850
CAU170.8400.859CAU690.9670.840
CAU220.9130.814CAU750.8670.869
CAU230.7800.724CAU760.8730.853
CAU250.8200.738CAU780.4670.510
CAU300.9670.809CAU830.8330.781
CAU320.6870.868CAU840.8330.841
CAU340.7800.685CAU850.9530.939
CAU400.9530.757CAU970.8530.754
CAU420.5130.664CAU980.9000.722
Mean0.8400.791
SE0.0230.018
Observed heterozygosity (Ho) and expected heterozygosity (He) within the ostrich analysed Another parameter characterizing the genetic variability of the locus and used to determine the value of markers in analyzing the linkage with other loci is the polymorphism information content (PIC). Analyzing the individual loci, the highest value for this parameter more than 0.7 was observed, among others: for loci CAU85 (0.932), CAU64 (0.861) and CAU32, 75 (0.852) (Table 3). These microsatellites are the most polymorphic and most useful in the linkage analysis for ostrich. The lowest values of the PIC (0.462) was recorded for locus CAU78. In previous study conducted on ostriches by Kawka et al. [17], the PIC value ranged from 0.117 to 0.786. One must emphasise that almost all the microsatellite markers selected for our analysis were characterized by a high polymorphism of heterozygosity or by high values of the polymorphism information content. Among the least polymorphic microsatellite markers one may count locus CAU78.
Table 3

Polymorphism information content (PIC) and probability of exclusion (PE) for the microsatellite loci examined within the ostrich analyzed

LocusPICPELocusPICPE
CAU10.8500.888CAU430.8120.841
CAU30.6920.689CAU440.6420.637
CAU70.6770.730CAU570.8120.857
CAU110.8190.860CAU640.8610.905
CAU140.7940.820CAU650.7920.815
CAU160.8450.889CAU680.8280.859
CAU170.8400.877CAU690.8180.852
CAU220.7850.808CAU750.8520.895
CAU230.7040.763CAU760.8340.876
CAU250.6900.677CAU780.4620.446
CAU300.7810.808CAU830.7560.797
CAU320.8520.897CAU840.8180.846
CAU340.6430.656CAU850.9320.972
CAU400.7180.731CAU970.7190.743
CAU420.6460.710CAU980.6890.720
Polymorphism information content (PIC) and probability of exclusion (PE) for the microsatellite loci examined within the ostrich analyzed It was estimated also the probability of exclusion (PE) for each locus when data of both parents are available, taking into consideration the frequency of the n-th co-dominant allele. The values of the probability of exclusion is presented in Table 3. The PE value ranged from 0.446 at locus CAU78 to 0.972 at locus CAU85. Kawka et al. [17] analyzed five microsatellite loci obtained a very high probability of exclusion from 0.77 to 0.98. Analysis of 30 microsatellite loci presented gives a very high probability of exclusion incorrect parent from 0.77 to 0.98. The presented results show that the analysis of these 30 microsatellite loci may be successfully applied in identification the origin of ostriches kept in Poland. In summary, the microsatellite markers used in our study were very polymorphic as evidenced by the large number of detected alleles and high rates of heterozygosity, PIC and PE as well. The microsatellite markers we have analyzed may contribute to genetic linkage mapping of ostrich, the construction of a comparative genetic map with other ratites such as emu and rhea. Further research aimed at creation of two-generation ostrich reference family and evaluation of the distances between markers is recommended.
  17 in total

1.  A consensus linkage map of the chicken genome.

Authors:  M A Groenen; H H Cheng; N Bumstead; B F Benkel; W E Briles; T Burke; D W Burt; L B Crittenden; J Dodgson; J Hillel; S Lamont; A P de Leon; M Soller; H Takahashi; A Vignal
Journal:  Genome Res       Date:  2000-01       Impact factor: 9.043

2.  Cholesterol content and fatty acid composition of ostrich meat as influenced by subspecies.

Authors:  J Horbañczuk; J Sales; T Celeda; A Konecka; G Ziêba; P Kawka
Journal:  Meat Sci       Date:  1998-11       Impact factor: 5.209

3.  Strategies for characterizing highly polymorphic markers in human gene mapping.

Authors:  J Ott
Journal:  Am J Hum Genet       Date:  1992-08       Impact factor: 11.025

4.  Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment.

Authors:  Steven T Kalinowski; Mark L Taper; Tristan C Marshall
Journal:  Mol Ecol       Date:  2007-03       Impact factor: 6.185

5.  Ostrich microsatellite polymorphisms at the VIAS-OS4, VIAS-OS8, VIAS-OS14, VIAS-OS22, and VIAS-OS29 loci.

Authors:  W K Ward; H C McPartlan; M E Matthews; N A Robinson
Journal:  Anim Genet       Date:  1998-08       Impact factor: 3.169

6.  A comprehensive microsatellite linkage map of the chicken genome.

Authors:  M A Groenen; R P Crooijmans; A Veenendaal; H H Cheng; M Siwek; J J van der Poel
Journal:  Genomics       Date:  1998-04-15       Impact factor: 5.736

7.  Carcase characteristics of emus (Dromaius novaehollandiae).

Authors:  J Sales; J Horbañczuk; J Dingle; R Coleman; S Sensik
Journal:  Br Poult Sci       Date:  1999-03       Impact factor: 2.095

8.  A second-generation linkage map of the sheep genome.

Authors:  M J de Gortari; B A Freking; R P Cuthbertson; S M Kappes; J W Keele; R T Stone; K A Leymaster; K G Dodds; A M Crawford; C W Beattie
Journal:  Mamm Genome       Date:  1998-03       Impact factor: 2.957

9.  Microsatellite analysis of genetic diversity in wild and farmed Emus (Dromaius novaehollandiae).

Authors:  E L Hammond; A J Lymbery; G B Martin; D Groth; J D Wetherall
Journal:  J Hered       Date:  2002 Sep-Oct       Impact factor: 2.645

10.  Sex-based comparison of limb segmentation in ostriches aged 14 months with and without tibiotarsal rotation.

Authors:  R G Cooper; H Naranowicz; E Maliszewska; A Tennett; J O Horbańczuk
Journal:  J S Afr Vet Assoc       Date:  2008-09       Impact factor: 1.474

View more
  9 in total

1.  Effect of vegetable wastage and energy in ostrich chick diet on performance and hematology.

Authors:  Mohammadebrahim Tasirnafas; Alireza Seidavi; Behrouz Rasouli; Magdalena Kawka
Journal:  Trop Anim Health Prod       Date:  2015-04-16       Impact factor: 1.559

2.  Development and characterization of ten novel microsatellite loci for the emu (Dromaius novaehollandiae) and genetic diversity of Japanese farm populations.

Authors:  Yuichi Koshiishi; Michiko Murata-Okubo; Shin-Ichiro Fujisawa; Gaku Shimoi; Hiroki Hirayama; Yuichi Kameyama; Kousaku Souma; Kenta Wada
Journal:  Mol Biol Rep       Date:  2020-02-21       Impact factor: 2.316

3.  Contrasting mtDNA and microsatellite data of great reed warbler Acrocephalus arundinaceus breeding populations on a small geographic scale.

Authors:  Gyula Hoffmann; Norbert Mátrai; Gábor Bakonyi; Nóra Vili; József Gyurácz; Mihály Lenczl; Péter Kisfali; Szilvia Stranczinger; Nóra Mária Magonyi; Erika Mátics; Róbert Mátics
Journal:  Biol Futur       Date:  2022-07-29

4.  The effect of dietary energy and protein levels on body weight, size, and microflora of ostrich chicks.

Authors:  Tahereh Nikravesh-Masouleh; Alireza Seidavi; Magdalena Kawka; Mohammad Dadashbeiki
Journal:  Trop Anim Health Prod       Date:  2017-11-24       Impact factor: 1.559

5.  Effects of Packaging Methods on Shelf Life of Ratite Meats.

Authors:  Olaf K Horbańczuk; Agnieszka Wierzbicka
Journal:  J Vet Res       Date:  2017-09-19       Impact factor: 1.744

6.  Nutrients Composition in Fit Snacks Made from Ostrich, Beef and Chicken Dried Meat.

Authors:  Żaneta Zdanowska-Sąsiadek; Joanna Marchewka; Jarosław Olav Horbańczuk; Agnieszka Wierzbicka; Paulina Lipińska; Artur Jóźwik; Atanas G Atanasov; Łukasz Huminiecki; Aleksander Sieroń; Karolina Sieroń; Nina Strzałkowska; Adrian Stelmasiak; Stefaan De Smet; Thomas Van Hecke; Louwrens C Hoffman
Journal:  Molecules       Date:  2018-05-25       Impact factor: 4.411

7.  Cytogenetic and genetic study of a Y-linked microsatellite polymorphism in Polish Black-and-White cattle breed.

Authors:  Rafał Parada; Magdalena Kawka; Mariusz Sacharczuk; Paweł Urbański; Kazimierz Jaszczak
Journal:  Saudi J Biol Sci       Date:  2017-01-28       Impact factor: 4.219

Review 8.  Microsatellite Instability: From the Implementation of the Detection to a Prognostic and Predictive Role in Cancers.

Authors:  Martina Amato; Renato Franco; Gaetano Facchini; Raffaele Addeo; Fortunato Ciardiello; Massimiliano Berretta; Giulia Vita; Alessandro Sgambato; Sandro Pignata; Michele Caraglia; Marina Accardo; Federica Zito Marino
Journal:  Int J Mol Sci       Date:  2022-08-05       Impact factor: 6.208

9.  Using different levels of energy and protein and their effects on bodyweight and blood chemistry of ostriches.

Authors:  Tahereh Nikravesh-Masouleh; Alireza Seidavi; Magdalena Solka; Mohammad Dadashbeiki
Journal:  Vet Res Commun       Date:  2021-04-28       Impact factor: 2.459

  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.