BACKGROUND: The translocator protein 18 kDa (TSPO), previously known as the peripheral-type benzodiazepine receptor (PBR), is important for many cellular functions in mammals and bacteria, such as steroid biosynthesis, cellular respiration, cell proliferation, apoptosis, immunomodulation, transport of porphyrins and anions. Arabidopsis thaliana contains a single TSPO/PBR-related gene with a 40 amino acid N-terminal extension compared to its homologs in bacteria or mammals suggesting it might be chloroplast or mitochondrial localized. RESULTS: To test if the TSPO N-terminal extension targets it to organelles, we fused three potential translational start sites in the TSPO cDNA to the N-terminus of GFP (AtTSPO:eGFP). The location of the AtTSPO:eGFP fusion protein was found to depend on the translational start position and the conditions under which plants were grown. Full-length AtTSPO:eGFP fusion protein was found in the endoplasmic reticulum and in vesicles of unknown identity when plants were grown in standard conditions. However, full length AtTSPO:eGFP localized to chloroplasts when grown in the presence of 150 mM NaCl, conditions of salt stress. In contrast, when AtTSPO:eGFP was truncated to the second or third start codon at amino acid position 21 or 42, the fusion protein co-localized with a mitochondrial marker in standard conditions. Using promoter GUS fusions, qRT-PCR, fluorescent protein tagging, and chloroplast fractionation approaches, we demonstrate that AtTSPO levels are regulated at the transcriptional, post-transcriptional and post-translational levels in response to abiotic stress conditions. Salt-responsive genes are increased in a tspo-1 knock-down mutant compared to wild type under conditions of salt stress, while they are decreased when AtTSPO is overexpressed. Mutations in tetrapyrrole biosynthesis genes and the application of chlorophyll or carotenoid biosynthesis inhibitors also affect AtTSPO expression. CONCLUSION: Our data suggest that AtTSPO plays a role in the response of Arabidopsis to high salt stress. Salt stress leads to re-localization of the AtTSPO from the ER to chloroplasts through its N-terminal extension. In addition, our results show that AtTSPO is regulated at the transcriptional level in tetrapyrrole biosynthetic mutants. Thus, we propose that AtTSPO may play a role in transporting tetrapyrrole intermediates during salt stress and other conditions in which tetrapyrrole metabolism is compromised.
BACKGROUND: The translocator protein 18 kDa (TSPO), previously known as the peripheral-type benzodiazepine receptor (PBR), is important for many cellular functions in mammals and bacteria, such as steroid biosynthesis, cellular respiration, cell proliferation, apoptosis, immunomodulation, transport of porphyrins and anions. Arabidopsis thaliana contains a single TSPO/PBR-related gene with a 40 amino acid N-terminal extension compared to its homologs in bacteria or mammals suggesting it might be chloroplast or mitochondrial localized. RESULTS: To test if the TSPO N-terminal extension targets it to organelles, we fused three potential translational start sites in the TSPO cDNA to the N-terminus of GFP (AtTSPO:eGFP). The location of the AtTSPO:eGFP fusion protein was found to depend on the translational start position and the conditions under which plants were grown. Full-length AtTSPO:eGFP fusion protein was found in the endoplasmic reticulum and in vesicles of unknown identity when plants were grown in standard conditions. However, full length AtTSPO:eGFP localized to chloroplasts when grown in the presence of 150 mM NaCl, conditions of salt stress. In contrast, when AtTSPO:eGFP was truncated to the second or third start codon at amino acid position 21 or 42, the fusion protein co-localized with a mitochondrial marker in standard conditions. Using promoter GUS fusions, qRT-PCR, fluorescent protein tagging, and chloroplast fractionation approaches, we demonstrate that AtTSPO levels are regulated at the transcriptional, post-transcriptional and post-translational levels in response to abiotic stress conditions. Salt-responsive genes are increased in a tspo-1 knock-down mutant compared to wild type under conditions of salt stress, while they are decreased when AtTSPO is overexpressed. Mutations in tetrapyrrole biosynthesis genes and the application of chlorophyll or carotenoid biosynthesis inhibitors also affect AtTSPO expression. CONCLUSION: Our data suggest that AtTSPO plays a role in the response of Arabidopsis to high salt stress. Salt stress leads to re-localization of the AtTSPO from the ER to chloroplasts through its N-terminal extension. In addition, our results show that AtTSPO is regulated at the transcriptional level in tetrapyrrole biosynthetic mutants. Thus, we propose that AtTSPO may play a role in transporting tetrapyrrole intermediates during salt stress and other conditions in which tetrapyrrole metabolism is compromised.
Higher plants synthesize four major tetrapyrroles (chlorophyll, haem, sirohaem and phytochromobilin) via a common branched pathway [1-3] (Additional file 1). In metazoans, heme and siroheme are synthesized in mitochondria, but in plants tetrapyrrole biosynthesis is plastid-localized, suggesting that tetrapyrroles are transported from the chloroplast to the mitochondria. This suggests that late stages of the heme biosynthetic pathway are present in both chloroplasts and mitochondria (Additional file 1). The concentration of tetrapyrrole intermediates is tightly controlled because these compounds are photoreactive and can generate reactive oxygen species (ROS). Additionally, many of the enzymes in this pathway are regulated by environmental stimuli and development signals [4,5].In mammals, an 18-kDa peripheral-type benzodiazepine receptor (TSPO/PBR) is localized in the outer mitochondrial membrane [6] where it binds other proteins, such as the 34-kDa voltage-dependent anion channel and the inner membrane adenine nucleotide carrier [7]. TSPO was originally named the "peripheral benzodiazepine receptor" (PBR), however, it has more recently been renamed "TSPO" reflecting its structural and functional similarity to the bacterial tryptophan-rich sensory protein [8].TSPO primarily functions to transport heme, porphyrins, steroids and anions [8-11]. However, TSPO proteins are also important for cellular respiration [12], cell proliferation [13] and apoptosis [14]. For example, in erythroids, in response to stress, TSPO is important for transporting porphyrins, which induce the expression of heme biosynthesis genes. Likewise, in mouseerythroleukemia cells TSPO has been shown to transport protoporphyrin IX playing a key role in tetrapyrrole and heme biosynthesis [15].In the α-proteobacterium Rhodobacter sphaeroidesTSPO is localized in the outer membrane and its expression is induced by oxygen [16]. Under conditions of high oxygen, TSPO negatively regulates the expression of photosynthetic genes by exporting excess intermediates of the tetrapyrrole pathway, such as Mg-Protoporphyrin IX (Mg-ProtoIX) and MgProtoIX Monomethyl ester [17]. The ratTSPO homologue complements the Rhodobactertspo mutant, suggesting that the function of TSPO is conserved in R. sphaeroides and metazoans [18].Evidence for a functional TSPO protein in Arabidopsis thaliana and other plants has been previously reported [19]. Transport studies with the recombinant ArabidopsisTSPO in Escherichia coli revealed a benzodiazepine-stimulated high-affinity uptake of protoporphyrin and cholesterol, leading to the hypothesis that the Arabidopsis homologue functions in the transport of protoporphyrinogen IX to the mitochondria where heme can be synthesized. However, the role of AtTSPO in plant metabolism is still unknown.In animals and yeast, TSPO is found in the outer membrane of the mitochondria [6,20]. However the localization of TSPO in plants remains controversial. Lindenman et al. [19] used immunogold staining to show that TSPO is localized in the outer membrane of plastids and mitochondria in Digitalis lanata leaves. However, follow up Western blot experiments could only detect TSPO in mitochondrial fractions. In a separate study, TSPO was found in nuclear fractions prepared from Solanum tuberosum meristematic tissues, while low levels were detected in chloroplast fractions [21]. In Physcomitrella patens, transient expression of TSPO fused to the N-terminus of GFP, PpTSPO:GFP, localized to the mitochondria [22]. In Arabidopsis, fusion of TSPO to the C-terminus of YFP resulted in YFP:TSPO being found in the endoplasmic reticulum and the Golgi stacks [23].The Arabidopsis genome contains a single TSPO-related gene (AtTSPO). The predicted protein shares a high degree of similarity to the central domain of its bacterial and mammalian homologs. However, AtTSPO has a 40 amino acid N-terminal extension that is not present in either bacteria or mammals. Moreover, within these 40 amino acids are three in-frame ATG-codons that could code for the first methionine (at positions M1, M21 and M42) (Additional file 2) [19]. To determine whether this region contains organellar targeting information, we developed a series of fusion proteins using the 3 different start sites. Our results demonstrate that AtTSPO was found in different organellar compartments depending on environmental stress. These results, along with analysis of an insertional mutation and expression studies, show that AtTSPO plays an important role in allowing Arabidopsis to cope with high salt stress.
Results
Induction AtTSPO gene expression by abiotic stress
In Physcomitrella patens, the expression of PpTSPO-1 is induced by salt stress and abscisic acid (ABA) [22]. AtTSPO is also induced by salt stress in Arabidopsis [24], as well as in Arabidopsis cell cultures [23]. We further defined the transcript abundance of AtTSPO in 5-day old seedlings treated with NaCl, mannitol, ABA and methyl viologen (MV), by extracting total RNA from these plants and performing quantitative real-time PCR (qRT-PCR).Compared to untreated plants, 150 mM NaCl, 250 mM mannitol, 1 μM ABA and 0.2 μM methyl viologen (MV) resulted in increased AtTSPO expression (Figure 1A). The kinetics of AtTSPO induction by NaCl and ABA stress were similar, peaking 3 hours after treatment and slowly decreasing between 6-25 h (Figure 1A-a and 1A-b respectively). Addition of mannitol resulted in peak AtTSPO expression between 3-6 h and then slowly decreased in abundance (Figure 1A-a, 1A-b and 1A-c). However mannitol treatment showed a two-fold induction compared to treatment with NaCl for 3 h (Figure 1A-a and 1A-c), which suggests that AtTSPO is induced by osmotic stress rather than salt stress. AtTSPO is rapidly induced by MV treatment, showing induction at 1 h, peaking by 3 h and then falling to basal levels within before increasing between 12-24 h (Figure 1A-d).
Figure 1
Induction of . (A) Quantitative real-time PCR analyses of AtTspO transcripts upon treatment of different stresses, (a) 150 mM NaCl, (b) 1 μM ABA, (c) 250 mM mannitol and (d) 0.2 μM methyl viologen. Relative expression levels were calculated and ACTIN (At3g18780) and 18S rRNA (At3g41768) here used as reference genes. (B) GUS expression in AtTSPO-437::GUS and LHCB::GUS lines in 15-day-old transgenic Arabidopsis plants either untreated or treated with 150 mM NaCl.
Induction of . (A) Quantitative real-time PCR analyses of AtTspO transcripts upon treatment of different stresses, (a) 150 mM NaCl, (b) 1 μM ABA, (c) 250 mM mannitol and (d) 0.2 μM methyl viologen. Relative expression levels were calculated and ACTIN (At3g18780) and 18S rRNA (At3g41768) here used as reference genes. (B) GUS expression in AtTSPO-437::GUS and LHCB::GUS lines in 15-day-old transgenic Arabidopsis plants either untreated or treated with 150 mM NaCl.To determine if AtTSPO accumulation was a transcriptional response to NaCl stress, a construct, containing 437 bp upstream the putative translational start site of the AtTSPO gene was fused to the uidA reporter gene (AtTSPO-437::GUS), and transformed into plants, allowing in vivo analysis of AtTSPO transcriptional response to stress conditions. AtTSPO-437::GUS was found to be induced by 150 mM NaCl within 3 h of treatment, which is similar to qRT-PCR results of the endogenous gene (Figure 1B). In control experiments, 150 mM NaCl resulted in a small decrease of expression of LHCB::GUS (Figure 1B). Together these results suggest that the 437 bp region of AtTSPO promoter is sufficient for transcriptional regulation of TSPO.
Identification and characterization of AtTSPO mutants
To determine the function of AtTSPO in vivo, we obtained a T-DNA insertional mutant (SALK_135023) [25] in AtTSPO. This line (tspo-1) was found to have two tandem T-DNA insertions, 123 bp upstream from the translational initiation codon of the AtTSPO gene (Figure 2A). Homozygous lines were then confirmed to be knock-down mutants by quantitative real time PCR (qRT-PCR) analysis. In this mutant, TSPO mRNA levels are about 20% of wild type (Figure 2B).
Figure 2
Phenotype of mutants with different levels of . (A) Schematic representation of isolated insertional mutant of AtTSPO in Arabidopsis. Two copies of the T-DNA were inserted in tandem 123 bp upstream from the translational initiation codon of AtTSPO. (B) Total RNA was isolated from 5 day-old seedlings, reverse-transcribed and subjected to qRT-PCR. Data shown represent mean values obtained from independent amplification reactions (n = 3) and biological replicates (n = 2). Bars represent the standard error of biological replicates. (C) Root lengths of at least 100 individual 7-day-old seedlings grown in 16 h photoperiods. (D) Chlorophyll concentrations in 14-day-old, in vitro-grown plants of the indicated genotypes were determined spectrophotometrically. Values shown are means derived from three independent samples, each sample containing 100 mg of fresh weight. Units are μg of chlorophyll a + b per g of fresh weight (fw).
Phenotype of mutants with different levels of . (A) Schematic representation of isolated insertional mutant of AtTSPO in Arabidopsis. Two copies of the T-DNA were inserted in tandem 123 bp upstream from the translational initiation codon of AtTSPO. (B) Total RNA was isolated from 5 day-old seedlings, reverse-transcribed and subjected to qRT-PCR. Data shown represent mean values obtained from independent amplification reactions (n = 3) and biological replicates (n = 2). Bars represent the standard error of biological replicates. (C) Root lengths of at least 100 individual 7-day-old seedlings grown in 16 h photoperiods. (D) Chlorophyll concentrations in 14-day-old, in vitro-grown plants of the indicated genotypes were determined spectrophotometrically. Values shown are means derived from three independent samples, each sample containing 100 mg of fresh weight. Units are μg of chlorophyll a + b per g of fresh weight (fw).AtTSPO fused or not to the N-terminus of GFP was constitutively overexpressed from the CaMV35S promoter in transgenic Arabidopsis lines (OxM1TSPO and OxM1TSPO:eGFP). We obtained 10 over-expression lines, but focused on the two homozygous lines that exhibited ~500 fold over-expression of AtTSPO (Figure 2B). The tspo-1, OxM1TSPO:eGFP and wild-type lines were grown side-by-side on either Murashige & Skoog (MS) agar medium or soil, and were monitored for possible abnormal phenotypes. The knock-down plants had longer roots compared to the wild type and the over-expression lines (Figure 2C). Moreover, tspo-1 accumulated ~30% less chlorophyll than either the wild type or the overexpression lines in the presence of 150 mM NaCl (Figure 2D).
The expression of stress-response genes is enhanced in tspo-1
AtTSPO expression was previously shown to be regulated by osmotic stress in germination and seedling growth assays [23]. Because TSPO regulates the expression of photosynthetic genes in R. sphaeroides [16], we hypothesized that tspo-1 or OxM1TSPO:eGFP mutants might have an impaired salt stress response. We examined the expression of some well-known salt stress-regulated genes (RAB18, ERD10 and DREB2A) [26]. As expected, stress marker genes were induced by 150 mM NaCl in wild-type plants (Figure 3A, B and 3C). In AtTSPO over-expression lines, the levels of DREB2A and RAB18 were lower but no significant change ERD10 expression was observed (Figure 3A, B and 3C).
Figure 3
Stress-response genes are up-regulated in . (A)-(C) Stress-induced gene expression in OxM1TSPO:eGFP and tspo-1 lines compared to wild type plants, by qPCR. 5-day-old seedlings grown under standard conditions and transferred for 3 hours to plates containing 150 mM NaCl. (A) DREB2A, (B) RAB18 and (C) ERD10 mRNA levels were determined by quantitative qRT-PCR. Relative amounts were calculated and normalized relative to Col-0 non-treated (100%). The ACTIN and 18S rRNA were used as reference genes. ACTIN, At3g18780; 18S RNA, At3g41768; RAB18, At5g66400; ERD10, At1g20450; DREB2A, At5g05410. Data shown represent mean values obtained from independent amplification reactions (n = 3) and biological replicates (n = 2). Relative expression levels were calculated. Bars represent the standard error of biological replicates.
Stress-response genes are up-regulated in . (A)-(C) Stress-induced gene expression in OxM1TSPO:eGFP and tspo-1 lines compared to wild type plants, by qPCR. 5-day-old seedlings grown under standard conditions and transferred for 3 hours to plates containing 150 mM NaCl. (A) DREB2A, (B) RAB18 and (C) ERD10 mRNA levels were determined by quantitative qRT-PCR. Relative amounts were calculated and normalized relative to Col-0 non-treated (100%). The ACTIN and 18S rRNA were used as reference genes. ACTIN, At3g18780; 18S RNA, At3g41768; RAB18, At5g66400; ERD10, At1g20450; DREB2A, At5g05410. Data shown represent mean values obtained from independent amplification reactions (n = 3) and biological replicates (n = 2). Relative expression levels were calculated. Bars represent the standard error of biological replicates.In tspo-1 mutants, 3 h of 150 mM NaCl treatment resulted in the increased expression of all three stress marker genes (Figure 3A, B and 3C). Taken together these results show that AtTSPO plays an important role in regulating the expression of stress response genes.
Expression of light-regulated tetrapyrrole genes are repressed in the tspo-1 knock-down mutant
Consistent with TSPO transporting tetrapyrroles [17,19,27], tspo-1 plants accumulated less chlorophyll than wild-type plants (Figure 2D). Because we found that TSPO is involved in the salt stress response and because TSPO negatively regulates photosynthetic genes in R. sphaeroides [17]. We next analyzed the expression of a few key chlorophyll biosynthesis genes in tspo-1 plants.Initially, we determined the mRNA levels of most of the key genes in the tetrapyrrole pathway (Additional file 1) in tspo-1 and gun5 mutants. GUN5 encodes the H subunit of chloroplastic Mg-chelatase, which is involved in the perception of altered levels of tetrapyrrolic intermediates [28]. All tetrapyrrole biosynthetic genes known to be light-dependent [29] were found to be down-regulated in tspo-1, as well as in gun5 mutants [28] (Figure 4A, C, E, F, G and 4H), whereas the expression of the two light-independent genes were unaffected in wild-type and tspo-1 mutant (Figure 4B and 4D).
Figure 4
Expression of tetrapyrrole biosynthesis genes in . qRT-PCR analyses of tetrapyrrole biosynthesis genes in Col-0, tspo-1 and gun5 5-days-old seedlings grown in constant light. Relative amounts were calculated and normalized relative to Col-0 non-treated (100%). With the exception of HEMA2 and FC1, all the genes have been show to be regulated by light. The data are presented following the enzymes order in the tetrapyrrole biosynthesis. The ACTIN and 18S rRNA genes were used as control. ACTIN, At3g18780; 18S rRNA, At3g41768; (A) HEMA1 (Glutamyl-tRNA reductase 1 - At1g58290) (B) HEMA2 (Glutamyl-tRNA reductase 2 - At1g04490); (C) PPO (Protoporphyrinogen oxidase - At4g01690); (D) FC1 (Ferrochelatase 1 - At5g26030); (E) FC2 (Ferrochelatase 2 - At2g30390); (F) GUN2 (Heme oxygenase 1 - At2g26670); (G) GUN4 (Regulator of Mg-porphyrin synthesis - At3g59400); (H) GUN5 (Mg-chelatase subunit H - At5g13630); (I) CAO (Chlorophyllide A oxygenase - At1g44446); and (J) GUN1 (Pentatricopeptide repeat (PPR) protein - At2g31400). Data shown represent mean values obtained from independent amplification reactions (n = 3) and biological replicates (n = 2). Relative expression levels were calculated. Bars represent the standard error of biological replicates.
Expression of tetrapyrrole biosynthesis genes in . qRT-PCR analyses of tetrapyrrole biosynthesis genes in Col-0, tspo-1 and gun5 5-days-old seedlings grown in constant light. Relative amounts were calculated and normalized relative to Col-0 non-treated (100%). With the exception of HEMA2 and FC1, all the genes have been show to be regulated by light. The data are presented following the enzymes order in the tetrapyrrole biosynthesis. The ACTIN and 18S rRNA genes were used as control. ACTIN, At3g18780; 18S rRNA, At3g41768; (A) HEMA1 (Glutamyl-tRNA reductase 1 - At1g58290) (B) HEMA2 (Glutamyl-tRNA reductase 2 - At1g04490); (C) PPO (Protoporphyrinogen oxidase - At4g01690); (D) FC1 (Ferrochelatase 1 - At5g26030); (E) FC2 (Ferrochelatase 2 - At2g30390); (F) GUN2 (Heme oxygenase 1 - At2g26670); (G) GUN4 (Regulator of Mg-porphyrin synthesis - At3g59400); (H) GUN5 (Mg-chelatase subunit H - At5g13630); (I) CAO (Chlorophyllide A oxygenase - At1g44446); and (J) GUN1 (Pentatricopeptide repeat (PPR) protein - At2g31400). Data shown represent mean values obtained from independent amplification reactions (n = 3) and biological replicates (n = 2). Relative expression levels were calculated. Bars represent the standard error of biological replicates.
Correlation of tetrapyrrole pathway flux and AtTSPO mRNA levels
tspo-1 mutants present reduced levels of light-regulated tetrapyrrole metabolism genes (Figure 4A, C, E, F, G, and 4H) and also have low chlorophyll content (Figure 2D). In order to investigate if decreasing flux of tetrapyrrole intermediates would affect AtTSPO expression in wild-type plants, we used two different drugs that interfere with tetrapyrrole biosynthesis, Gabaculine and Norflurazon. Gabaculine acts as a tetrapyrrole biosynthesis inhibitor by blocking the glutamate-1-semi aldehyde aminotransferase activity [30,31]. The herbicide Norflurazon inhibits carotenoid biosynthesis and indirectly affects enzymes in tetrapyrrole biosynthesis [32-34]. AtTSPO mRNA levels increased 2-fold in plants treated with 50 μM of gabaculine and up to 500-fold after 500 nM norflurazon treatment (Figure 5A).
Figure 5
Relationship between tetrapyrrole flux and . (A) AtTSPO expression in wild-type plants germinated in 50 μM of gabaculine or 500 nM of norflurazon compared to untreated plants. (B) AtTSPO mRNA levels in different mutants of the tetrapyrrole pathway. Relative amounts were calculated and normalized relative to Col-0 non-treated (100%). The ACTIN and 18S rRNA genes were used as control. ACTIN, At3g18780; 18S RNA, At3g41768. Data shown represent mean values obtained from independent amplification reactions (n = 3) and biological replicates (n = 2). Relative expression levels were calculated. Bars represent the standard error of biological replicates.
Relationship between tetrapyrrole flux and . (A) AtTSPO expression in wild-type plants germinated in 50 μM of gabaculine or 500 nM of norflurazon compared to untreated plants. (B) AtTSPO mRNA levels in different mutants of the tetrapyrrole pathway. Relative amounts were calculated and normalized relative to Col-0 non-treated (100%). The ACTIN and 18S rRNA genes were used as control. ACTIN, At3g18780; 18S RNA, At3g41768. Data shown represent mean values obtained from independent amplification reactions (n = 3) and biological replicates (n = 2). Relative expression levels were calculated. Bars represent the standard error of biological replicates.To explore if AtTSPO expression is affected by genetic alterations of the tetrapyrrole biosynthesis pathway, we analyzed the expression of AtTSPO in different mutant backgrounds (Additional file 1). We found that AtTSPO levels are differently altered in various tetrapyrrole pathway mutants. AtTSPO steady-state levels were increased in gun2 (allele of hy1 - required for phytochromobilin synthesis from heme) [35], gun4 (mutant in the Protoporphyrin IX- and Mg-Protoporphyrin IX-binding protein) [36], fc1 (mutant in the ferrochelatase) [37], hemA1hemA2 double mutant (mutant in both glutamyl-tRNA reductases genes) [38] and lin-2 (mutant in the coproporphyrinogen III oxidase) [39] (Figure 5B). The increased expression of AtTSPO in these mutants with reduced tetrapyrrole levels is consistent with AtTSPO transporting tetrapyrroles for roles in other compartments. The only biosynthetic mutant that resulted in reduced AtTSPO levels was crd1 (mutant in the Mg-protoporphyrin IX monomethyl ester cyclase) [40] (Figure 5B). All these mutations, in exception of crd1 [41], inhibit somehow ALA synthesis, suggesting that disturbances in tetrapyrrole biosynthesis or accumulation affect AtTSPO mRNA expression.
AtTSPO localization depends on the translational start site used
AtTSPO (At2g47770) encodes a protein with a predicted molecular weight of 18 kDa. This protein has three possible in-frame ATG-start codons (M1, M21 and M42) in its N-terminal extension region (Additional file 2) [19].Since reports of plant TSPO localization have resulted in different findings subcellular localization of plant TSPO [19,21,23] we re-examined the subcellular location of AtTSPO and evaluated the roles of the N-terminal extension in targeting AtTSPO within the cell. Past studies [20,23] have utilized N-terminal GFP fusions that might block potential organellar targeting of AtTSPO, particularly mitochondrial or plastid localization. To allow proper targeting of AtTSPO fusions to GFP, AtTSPO was placed on the N-terminus of GFP. Three constructs were made, representing each of the potential start codons M1 (OxM1TSPO:eGFP), M21 (OxM21TSPO:eGFP) and M42 (OxM42TSPO:eGFP) and expressed from the CaMV35S promoter in Arabidopsis.AtTSPO:eGFP subcellular localization was observed in root, hypocotyls and cotyledons of these lines by confocal microscopy. Full-length AtTSPO:eGFP (OxM1TSPO:eGFP) was found in the endoplasmic reticulum (ER) of the root tip (Figure 6A) and cotyledons (Figure 6C) in five day-old seedlings. However, in the hypocotyls of these plants, the fusion protein was found in the ER and in vesicles of unknown identity (Figure 6B). When M21 (OxM21TSPO:eGFP) or M42 (OxM42TSPO:eGFP) were used, the fusion proteins always co-localized with mitotracker, indicating a mitochondrial localization (Figure 6D, E, F, G, H and 6I) (Additional file 3). These results corroborate the previous observations of mitochondrial localization of TSPO in D. Lanata leaves by immunogold staining and in Arabidopsis by western blot experiments [19], as well as the endoplasmic reticulum located protein [23], indicating that the alternative use of three initiation codons could be important for AtTSPO localization and its post-translational control.
Figure 6
. Confocal images of OxM1TSPO:eGFP (A-C), OxM21TSPO:eGFP (D-F) and OxM42TSPO:eGFP (G-I) localization. OxM1TSPO:eGFP localizes in the ER and vesicles of unknown function in the root (A), hypocotyl (B) and cotyledon (C). OxM21TSPO:eGFP localizes in the mitochondria of root (D), hypocotyl (E) and cotyledon (F). OxM42TSPO:eGFP show mitochondria localization in root (G), hypocotyls (H) and cotyledons (I). GFP fluorescence is represented by green and chlorophyll auto fluorescence in red. The samples were incubated with Mitotracker to identify mitochondria (see Additional file 3). Homozygous transgenic plants harboring 35S-TSPO:eGFP in wild-type background were used for the analysis. Scale bars = 50 μm.
. Confocal images of OxM1TSPO:eGFP (A-C), OxM21TSPO:eGFP (D-F) and OxM42TSPO:eGFP (G-I) localization. OxM1TSPO:eGFP localizes in the ER and vesicles of unknown function in the root (A), hypocotyl (B) and cotyledon (C). OxM21TSPO:eGFP localizes in the mitochondria of root (D), hypocotyl (E) and cotyledon (F). OxM42TSPO:eGFP show mitochondria localization in root (G), hypocotyls (H) and cotyledons (I). GFP fluorescence is represented by green and chlorophyll auto fluorescence in red. The samples were incubated with Mitotracker to identify mitochondria (see Additional file 3). Homozygous transgenic plants harboring 35S-TSPO:eGFP in wild-type background were used for the analysis. Scale bars = 50 μm.
OxM1TSPOeGFP becomes associated with plastids following high salt stress
Having established a key role for AtTSPO in response to abiotic stress, we next examined the localization of AtTSPO:eGFP fusion proteins in plants subjected to various stress conditions. 5 day-old seedlings were treated with 250 mM mannitol, 1 μM ABA, 0.2 μM MV and 150 mM NaCl. After 18 hours of treatment, OxM1TSPO:eGFP became localized to the plastid (Figure 7G, H, I, J, K and 7L), while neither OxM21TSPO:eGFP nor OxM42TSPO:eGFP had altered localization even with 5 day extended NaCl treatment (data not shown). AtTSPO:GFP localization did not change when plants were treated with mannitol, ABA or MV (data not shown).
Figure 7
OxM1TSPOeGFP localizes in chloroplasts upon salt stress. (A-F) Confocal analyses show OxM1TSPO:eGFP localization in the ER and vesicles of unknown function in hypocotyls of 5-day-old seedlings grown in the standard conditions. (G-L) Confocal analyses show OxM1TSPO:eGFP chloroplast localization in hypocotyls of 5-day-old seedlings grown in the presence of 150 mM NaCl. GFP fluorescence channel is represented in green and chlorophyll auto fluorescence channel is represented in red. Homozygous transgenic plants harboring 35S-TSPO:eGFP in wild-type background were used for the analysis. Scale bars = 50 μm.
OxM1TSPOeGFP localizes in chloroplasts upon salt stress. (A-F) Confocal analyses show OxM1TSPO:eGFP localization in the ER and vesicles of unknown function in hypocotyls of 5-day-old seedlings grown in the standard conditions. (G-L) Confocal analyses show OxM1TSPO:eGFP chloroplast localization in hypocotyls of 5-day-old seedlings grown in the presence of 150 mM NaCl. GFP fluorescence channel is represented in green and chlorophyll auto fluorescence channel is represented in red. Homozygous transgenic plants harboring 35S-TSPO:eGFP in wild-type background were used for the analysis. Scale bars = 50 μm.To verify the expression levels of AtTSPO during salt stress, total protein from each lines was immunoblotted with antibodies to GFP (Figure 8A). In all cases, AtTSPO:GFP protein was found to increase significantly after 24h of salt treatment. Accumulation of AtTSPO:GFP was dependent on the presence of AtTSPO because empty vector controls using CaMV or Ubiquitin 10 [42] promoters to drive the expression of GFP did not change in response to salt stress (Figure 8A and not shown). These results indicate that AtTSPO accumulation is regulated at the transcriptional, post-transcriptional and post-translational levels.
Figure 8
. (A) Immunoblot analysis of OxAtTSPO:eGFP (OxM1TSPO:eGFP, OxM21TSPO:eGFP and OxM42TSPO:eGFP) fusion proteins detected in plants with an antibody to GFP. Plants were untreated, or treated with 150 mM NaCl. As a control wild-type plants and plants over-expressing GFP (OxeGFP) seedlings were used. (B) Anti-GFP immunoblot of trypsinized chloroplasts from Arabidopsis plants either untreated or treated with 150 mM NaCl. Control immunoblots were probed with antibodies chloroplast proteins RuBisCo and D1; and to cytosolic UGPase. Each lane represents equal amounts of chloroplasts.
. (A) Immunoblot analysis of OxAtTSPO:eGFP (OxM1TSPO:eGFP, OxM21TSPO:eGFP and OxM42TSPO:eGFP) fusion proteins detected in plants with an antibody to GFP. Plants were untreated, or treated with 150 mM NaCl. As a control wild-type plants and plants over-expressing GFP (OxeGFP) seedlings were used. (B) Anti-GFP immunoblot of trypsinized chloroplasts from Arabidopsis plants either untreated or treated with 150 mM NaCl. Control immunoblots were probed with antibodies chloroplast proteins RuBisCo and D1; and to cytosolic UGPase. Each lane represents equal amounts of chloroplasts.To confirm the location of AtTSPO we performed protease protection assays on isolated chloroplasts from OxM1TSPO:eGFP lines that were grown with or without 150 mM NaCl treatment. Following chloroplast isolation and protease protection, equal quantities of chloroplasts were subjected to immunoblotting with antibodies to GFP. AtTSPO was detected in chloroplast fractions near its predicted monomeric molecular mass (Additional file 4 and 5) in plants treated 18 hours with 150 mM NaCl, but not in untreated plants (Figure 8B). Chloroplasts prepared from OxTSPO:eGFP lines occasionally displayed a lower molecular mass band that is approximately the mass of GFP. This band probably results from proteolysis between AtTSPO and the GFP tag during sample preparation, although we cannot rule out other possibilities since we do not have an antibody to AtTSPO protein itself. Antibodies to RuBisCo and D1 confirmed the integrity and presence of chloroplasts following protease protection. Antibodies to the cytosolic protein UGPase also verified these fractions were free of cytoplasmic contamination (Additional file 5). These data together with confocal microscopy indicate that the region between the M1 and M21 is important for targeting AtTSPO to chloroplasts during salt stress. Since AtTSPO was protected from trypsin digestion (Figure 8B), AtTSPO may be integral to the chloroplast outer envelope.
Discussion
The localization of TSPO in both chloroplasts and mitochondria is consistent with its role in porphyrin trafficking. Plant TSPO has been proposed to participate in the interaction between plastid and mitochondrial tetrapyrrole biosynthetic pathways [19]. In higher plants, tetrapyrroles are synthesized almost exclusively in plastids, with the exception of the two last steps of heme synthesis that may occur in both chloroplasts and mitochondria. If AtTSPO is involved in tetrapyrrole transport [19], it is reasonable to assume that AtTSPO may translocate tetrapyrrole intermediates across organellar membranes, explaining why plants would need chloroplastic and mitochondrial isoforms of TSPO.Consistent with this hypothesis, the AtTSPO protein is longer than its mammalian and bacterial counterparts. The targeting determinants for chloroplasts and mitochondria are usually located at the N-terminus of the protein; therefore, a fusion protein with GFP fused to the C-terminus of TSPO was made. Using this strategy we demonstrated that AtTSPO had different sub-cellular localization patterns depending on the translational start codon, tissue type or the abiotic stress to which the plant was subjected. Placement of the GFP fusion on either the N- or C-terminus of TSPO probably explains the inconsistencies in previous studies [19,21,23] compared to those presented here. The construct used by Guillaumot [23] had the YFP fused to the N-terminus of AtTSPO, which could potentially mask the transit peptide that targets TSPO to chloroplasts and mitochondria. Indeed, a similar case was observed recently for the ArabidopsisHEMERA protein (HMR). When HMR had CFP on its C-terminus, it was localized exclusively in chloroplasts, however, fusion of HMR to the C-terminus of YFP (YFP-HMR) was localized to the nucleus and cytoplasm but not chloroplasts [43].Salt-stress of Arabidopsis results in movement of ER-localized AtM1TSPO:eGFP to the chloroplast. We also demonstrated that the different start codons within the TSPO N-terminal extension could target the TSPO protein to different organelles. Other plant proteins such as MDAR (ArabidopsisMonodehydroascorbate Reductase) and tRNA nucleotidyltransferase [44,45] are also known to be targeted to different organelles owing to alternative transcriptionsal start sites. Thus, it is tempting to speculate that, cloroplastic AtTSPO may protect the chloroplast from saltstress damage and the mitochondrial AtTSPO may normally import chloroplast-synthesized porphyrins into the mitochondria. Alterations in the sub-cellular localization of TSPO have been observed in mammals. The mammalianTSPO localizes to the mitochondrial outer membrane but during fast cell proliferation, such as metastatic processes, it relocates to the nuclear membrane, suggesting developmental control of its sub-cellular localization [46].Our results suggest the existence of a chloroplast targeting region in AtTSPO that operates during salt stress. Constructs lacking the N-terminus of AtTSPO (AtM2TSPO:eGFP and AtM3TSPO:eGFP) are not able to be target to this organelle. These results suggest that the first twenty aminoacids of AtTSPO may be part of the chloroplast targeting peptide of this protein. Further experiments should be conducted to precisely characterize this chloroplast targeting determinant.TSPO localization in plant cells is complex, involving a relocation of the protein from ER and vesicles to chloroplasts during salt-stress. In recent years, several new mechanisms for import of proteins into chloroplasts have been proposed. For example, it is hypothesized that close contacts between the envelopes of chloroplasts, mitochondria and other organelle membranes could allow protein movement between them [47]. Such fusions have been observed between the mitochondria and ER [48], where it was suggested that vesicle associated membrane protein 1 (VAMP-1) might be involved in the docking of mitochondria to target membranes [49]. This, in turn, could facilitate a re-localization of proteins from mitochondria to other compartments. The recent discoveries of close intracellular membrane contacts in plants, namely between chloroplasts and the ER [50], as well as between mitochondria and the nucleus [51], corroborates this hypothesis. At the present moment it is not clear which pathway is used during AtTSPO relocation during salt-stress. However our data indicate that AtTSPO changes its localization during stress, and that it is also possible that the mitochondrial isoform observed previously by Frank et al. [22]in P. patens and by Lindenman et al. [19] in D. lanata and Arabidopsis could be generated in Arabidopsis by the use of alternative translation start codons.Transcriptional levels of AtTSPO in wild-type Arabidopsis plants increase in response to salt, mannitol, ABA and paraquat. The promoter region of AtTSPO was also found to be sufficient for salt stress transcriptional response. The induction of AtTSPO by salt stress was also observed when constitutive promoters (35S and UBI10) were used to express AtTSPO, suggesting that the induction of AtTSPO occurs at both transcriptional and post-transcriptional levels.AtTSPO over-expression lines have decreased levels of stress response genes (ERD10, DREB2A and RAB18), while tspo-1 mutants over express these genes. This suggests that AtTSPO expression and/or function is necessary for the proper regulation of these genes during stress conditions. These results also imply that AtTSPO is important for stress adaptation in Arabidopsis, and this idea is consistent with results from P. patens [22]. Since RhodobacterTSPO is a negative regulator of photosynthetic genes [17], it is possible that AtTSPO operates similarly in regulating stress responsive genes in plants.The precise function of AtTSPO in tetrapyrrole transport during salt stress remains to be established. There are, however, many reports suggesting that alterations in tetrapyrrole flow can be involved in salt tolerance. Exogenous 5-Aminolevulinate (ALA) can improve salt tolerance in higher plants [51-56]. It has been also shown that transgenic Arabidopsis, tobacco and rice that overproduce ALA have improved salt tolerance [57,58]. Abdelkader et al. [59] assumed that high salt stress inhibited chlorophyll accumulation mainly by reducing the rate of porphyrin formation, and Zhang et al. [58] showed that salt stress caused a significant decrease in heme content. Thus in higher plants, ALA and tetrapyrrole synthesis is sensitive to salt stress.Additionally, we demonstrated that AtTSPO is important for tetrapyrrole flux and/or metabolism. The herbicide Norflurazon, a non-competitive inhibitor of phytoene desaturase, [31-33] and the neurotoxin Gabaculine, which inhibits tetrapyrrole biosynthesis by blocking glutamate-1-semi aldehyde aminotransferase activity [29,30] were used in this study to decrease the flux through the tetrapyrrole biosynthesis pathways. Our data showed that mutations in tetrapyrrole biosynthesis genes and the application of these two different drugs that decrease flux of tetrapyrrole intermediates affect AtTSPO expression. All mutations tested that inhibit the synthesis of ALA increase AtTSPO mRNA steady-state levels. The same was observed when the formation of ALA is inhibited by the norflurazon and the gabaculine. The only mutant tested with decreased AtTSPO expression is crd1, which accumulates Mg-Protoporphyrin monomethyl ester and this accumulation does not affect the inhibition of ALA synthesis [40]. Finally, it is possible that AtTSPO could be involved in the partitioning of different tetrapyrrolic signal molecules within plant cells. The steady state levels of several light-regulated mRNAs of tetrapyrrole metabolism genes are down-regulated in the tspo-1 mutant, suggesting that, AtTSPO could act as a regulator of tetrapyrrole biosynthesis similar to its bacterial counterpart [16].
Conclusions
TSPO has been shown to transport a number of small molecules in multiple organisms, however its function in plants is not known. Here we demonstrate that ArabidopsisTSPO is regulated at the transcriptional, post-transcriptional and post-translational levels in response to abiotic stress conditions such as salt stress. Our results suggest that AtTSPO can localize to ER and mitochondria, but when plants are salt stressed AtTSPO is found in chloroplasts. Also our data suggest that under normal conditions AtTSPO may be important for the import of chloroplastic synthesized heme into the mitochondria. However, targeting AtTSPO to the chloroplast during salt stress may protect chloroplasts from damage. In addition, tetrapyrrole intermediates has been suggested to operate in the chloroplast-to-nucleus retrograde signaling [35,60]. It is possible that AtTSPO could be involved in the partitioning of different tetrapyrrole signal molecules within plant cells depending on environmental conditions. AtTSPO may play a role in re-directing tetrapyrrole intermediates during salt stress or under conditions where tetrapyrrole metabolism is compromised. This is suggested by our finding that mutation or inhibition of the tetrapyrrole biosynthesis pathway increases AtTSPO expression. At the same time, AtTSPO may directly contribute to the detoxification of highly reactive porphyrins in the cytoplasm. We are currently investigating these possibilities.
Methods
Plant material and growth conditions
Arabidopsis thaliana seeds ecotype Col-0 were surface sterilized and plated on MS1/2 medium [61] with or without 50 mM kanamycin. Seedlings were maintained for three days at 4°C and than grown under 16/8 hours light/dark cycles at 23°C in growth chambers. Root length measurements were conducted using plants grown on vertically oriented in standard conditions for 10 days. For abiotic stress treatment, 150 mM NaCl, 250 mM mannitol, 1 μM ABA (Sigma; St Louis, MO) or 0.2 μM paraquat was added to MS1/2agar plates, and the 5-day-old seedlings were incubated under normal growth condition. For Norflurazon or Gabaculine experiments seeds were plated on MS1/2 containing 1 or 2% sucrose with or without 5 μM norflurazon (Sandoz Pharmaceuticals; Vienna, Austria) or 50 μM of gabaculine (Sigma, USA). All experiments were repeated three times independently and the average was calculated.
RNA extraction and qRT-PCR analysis
Total RNA was isolated using Spectrum™ Plant Total RNA Kit (Sigma #STRN250-1KT), according to manufacturer's instructions. One microgram of total RNA was added to each cDNA synthesis reaction using the First Strand cDNA Synthesis Kit (#K1611). For qRT-PCR, DNA amplification was performed in the presence of SYBR® Green qPCR Detection (Invitrogen) in a MyIQ™ Single Color Real-Time PCR Detection System (BioRad), using the primer pairs at table 1. The cycle use was: 95 C, 1 min and 30 sec; 40 × (95 C, 10 sec; 60 C, 1 min); 95 C, 1 min; 60 C, 1 min and 81 × (60 C, 10 sec). The relative mRNA levels were determined by normalizing the PCR threshold cycle number with Actin and 18S RNA. All experiments were repeated three times independently and the average was calculated.
Table 1
Primers used for quantitative real time PCR (qRT-PCR)
PRIMER NAME FOR qPCR
SEQUENCE
TSPO FWD
ACAAAGGAAAACGCGATCAAA
TSPO RVS
ACTTGAGACCACGTTTCGCC
GUN1 FWD
GCGATTCTGAATGCTTGCAG
GUN1 RVS
AGGAGCCATACATTCTCTCT
GUN2 FWD
AGACTCCAATTTCCCAACTT
GUN2 RVS
TTACCAGGACGTGTTGGTTC
GUN4 FWD
GAAACCGCGACCATATTCGAC
GUN4 RVS
CGGCTTCTCCGGATATCTGAA
GUN5 FWD
CATCCACTTGCTCCAACCATG
GUN5 RVS
CCGACAACCGTTGCATCTTT
HEMA1 FWD
GCTTCCGCAGTCTTCAAACG
HEMA1 RVS
CCAGCGCCAATTACACACATC
HEMA2 FWD
AGCTCCTGCACGGTCCAAT
HEMA2 RVS
TGCTATCGTTCCCATCGCAT
FC1 FWD
ATACCAGAGTCGTGTTGGCCC
FC1 RVS
TCATCGGTGTATGGCTTCAGC
FC2 FWD
TGGTGCTATGGCTGTCTCAAAC
FC2 RVS
AGCGGAACTAACGACTGTCGA
CAO FWD
TGATGAGCCACCTGCACCTAT
CAO RVS
AAGTAAACCGTGTTCCACCGG
PPO FWD
GCTTCTTCCGTCGTTTTCGAA
PPO RVS
TTGAAGATCCGACGGTTGGTC
DREB2A FWD
CAGGCTTAAATCAGGACCGG
DREB2A RVS
ATGAACCGTTGGCAACACTG
ERD10 FWD
CACCGTTCCAGAGCAGGAGA
ERD10 RVS
GCCGATGATTCCTCTGTTGC
RAB18 FWD
AAGGAGAAGTTGCCAGGTCATC
RAB18 RVS
CATCGCTTGAGCTTGACCAG
ACTIN 2/8 FWD
TCTTGTTCCAGCCCTCGTTT
ACTIN 2/8 RVS
TCTCGTGGATTCCAGCAGCT
18S RNA FWD
TATAGGACTCCGCTGGCACC
18S RNA RVS
CCCGGAACCCAAAAACTTTG
Primers used for quantitative real time PCR (qRT-PCR)
Verification of TSPO knock-out
The tspo-1 T-DNA mutant, SALK_135023, was obtained from the Salk collection [24]. Homozygous mutants were isolated by PCR-based genotyping using gene specific PCR primers AtTSPO-LP and AtTSPO-BP together with LBa1 (Table 2). Only homozygous lines were used for the phenotypic investigation.
Table 2
Primers used for cloning and genotyping
PRIMER NAME FOR GENOTYPING AND CLONING
SEQUENCE
AtTSPO LP
agagcaaatcgcatcagcgtc
AtTSPO RP
ggaacgtaaccggatcccaaa
LBa1
tggttcacgtagtgggccatcg
TSPO NT1
aaaaagcaggctccatggattctcaggaca
TSPO NT2
aaaaagcaggctccatggccgagacagagagg
TSPO NT3
aaaaagcaggctccatggcgaaacgtggtctc
TSPO CT1
agaaagctgggtccgcgacagcaagctttaca
TSPO CT80
agaaagctgggtcggacttagctcgattcccgta
Primers used for cloning and genotyping
Construction of AtTSPO GUS Fusion Vector and GUS Assay
The 437 bp upstream of the translational star site of the AtTSPO gene (At2g47770) was translational fused into uidA gene in pKGWFS7 vector by Gateway® (Invitrogen™) [62] and introduced into Arabidopsis via Agrobacterium-mediated transformation [63]. For cloning primers and constructs information see Tables 2 and 3, respectively. For histochemical GUS expression plant samples were soaked at 37°C for 16 hours in GUS assay solution (1 mm 5-bromo-4-chloro-3-indolylglucronide, 0.5 mm K3Fe(CN)6, 0.5 mm K4Fe(CN)6, 0.3% (v/v) Triton X-100, 20% (v/v) methanol, and 50 mm inorganic phosphate-buffered saline). The reaction was further conducted at 37°C in the dark for a maximum of 16 hours.
Table 3
Constructs information
CONSTRUCT NAME
BINARY VECTOR
RESISTANCE IN PLANT
UBQ10mCITRINE
pB7m34GW
basta
UBQ10M1TSPOmCITRINE
pB7m34GW
basta
UBQ10M2TSPOmCITRINE
pB7m34GW
basta
UBQ10M3TSPOmCITRINE
pB7m34GW
basta
OxeGFP
pK7FWG2
kanamycin
OxMITSPO:eGFP
pK7FWG2
kanamycin
OxM2TSPO:eGFP
pK7FWG2
kanamycin
OxM3TSPO:eGFP
pK7FWG2
kanamycin
AtTSPO-437::GUS
pKGWFS7
kanamycin
Constructs information
Subcellular localization of AtTSPO fusion proteins
For the GFP fusion constructs, clones containing the coding region of AtTSPO as well as fusions starting at methionine 21 and 42 were generated and cloned into pK7FWG2 [62] (Table 3) according to the manufacturer's instructions (Invitrogen, CA, USA). Primers used were: AtTSPO M1: TSPO NT1 and TSPOCT1; AtTSPO M2: TSPO NT2 and TSPOCT1; AtTSPO M3: TSPO NT3 and TSPOCT1; AtTSPO 80aa: TSPO NT1 and TSPO CT80 (Table 2). Arabidopsis thaliana was observed in a confocal laser scanning microscope Leica DM IRE2 (Leica microsystems). For the mitochondrial-specific staining, Arabidopsis seedlings were incubated in MitoTracker® Red CMXRos (Invitrogen, #M7512) according to manufactures instructions. Excitation and emission wavelengths were 488 and 505-530 nm (BP 505-530 filter) for GFP and, 543 and 560-615 nm (BP 560-615 filter) for MitoTracker® respectively. All images were processed on Leica DM IRE2 Image Browser program (Leica microsystems).
Determination of chlorophyll contents
Seedlings at 10 days after germination were weighted, frozen in liquid nitrogen, and ground in 80% (v/v) acetone. Ground tissue was centrifuged at 2,000 g for 5 min to pellet any insoluble material. The absorbance of the extracted chlorophyll at 645 and 663 nm was then determined. Chlorophyll (a and b) contents of the samples were determined according to Lichtenthaler [64].
Chloroplast Isolation
Isolation of chloroplasts from plate-grown Arabidopsis seedlings was performed as described previously [65]. Final resuspension of chloroplast was in buffer (330 mM sorbitol, 50 mM HEPES-KOH, pH 8.0) at a concentration of 1 mg chlorophyll ml-1.
Immunoblotting
Total protein was extracted from 10-day-old seedlings by adding protein extraction buffer (50 mM HEPES pH 7.9, 300 mM Sucrose, 150 mM NaCl, 10 mM Potassium acetate, protease inhibitors cocktail - Roche, 1% (w/v) Triton, 1 mM DTT). Ground tissue was centrifuged at 5,000 × g for 5 min to pellet the tissue and proteins were quantify by Bradford assay [66]. Samples were boiled for 5 min in 250 mM Tris-HCl, pH 6.8, 10% (w/v) SDS, 30% (v/v) glycerol, 5% (v/v) β- mercaptoethanol and 0.02% (w/v) bromophenol blue. SDS-PAGE was performed using standard procedures. Chloroplast protein samples were normalized loaded by equal amounts of total chlorophyll. Following SDS-PAGE, the separated proteins were transferred to a polyvinylidene difluoride membrane (Bio-Rad). For immunodetection, membranes were incubated with antibody against GFP (ROCHE, #11814460001), UGPase (AGRISERA, #AS05086), RuBisCo (AGRISERA, #AS03037) and D1(AGRISERA, #AS05084). With the exception of GFP detection that uses mouse secondary antibody, all the immunoreactive proteins were detected by using rabbit secondary antibody. The immunoreaction was detected by chemiluminescence kit (Thermo Scientific, #34076) according to manufacturer's instructions.
EBP, JC and GSM conceived and designed the experiments. EBP performed all the experiments, analyzed the data and wrote the paper. YJ helped in the confocal microscopy analyses. BJSCO helped in the fractionation experiment. LRA and JGU gave technical support. JC and GSM were project supervisors, participated in the discussion of all experiments from the project and preparation of the manuscript. All authors read and approved the final manuscript.
Additional file 1
Schematic representation of tetrapyrrole biosyntheses pathway in plants showing genes analyzed in this study. In blue, are the genes already described for each step in the pathway. The enzymes that correspond to these genes names and the AGI code are: HEMA1 (Glutamyl-tRNA reductase 1, At1g58290); HEMA2 (Glutamyl-tRNA reductase 2, At1g09940); HEMA3(Glutamyl-tRNA reductase 3, At2g31250); FLU (Regulator of ALA synthesis, At3g14110); LIN2 (Coproporphyrinogen oxidase 1, At1g03475); GUN2 (Heme oxygenase 1, At2g26670); GUN3 (Phytochromobilin synthase, At3g09150); GUN4 (Regulator of Mg-porphyrin synthesis, At3g59400); GUN5 (Mg-chelatase subunit H, At5g13630); CHLI (Mg-chelatase subunit I, At4g18480 and At5g45930); CHLD (Mg-chelatase subunit D, At1g08520); CHLM (Mg-Protoporphyrin IX methyltransferase, At4g25080); CRD1 (Mg-Protoporphyrin IX monomethylester cyclase, At3g56940); FC1 (Ferrochelatase 1, At5g26030); FC2 (Ferrochelatase 2, At2g30390).Click here for file
Additional file 2
Alignment of TSPO sequences from different organisms. ClustalW sequence alignment of TSPO proteins from Rhodobacter sphaeroides (AF195122.1), Rattus norvegicus (J05122) and ArabidopsisTSPO (AtTSPO - At2g47770). The numbers in the left side represent the amino acid position from the primary protein. In the consensus line the conserved aminoacids are highlighted as (*), and as (.) when one conserve position is observed. M1, M21 and M42 AtTSPO isoforms are highlighted. The black arrow represents the first 80 aminoacids (AtTSPO80aa) of ArabidopsisTSPO.Click here for file
Additional file 3
. AtM42TSPO:eGFP 5-day-old seedlings transgenic lines (A-C) were incubated with mitotracker to identify mitochondria. (A) Image from GFP channel is shown in green. (B) Image from mitotracker channel is shown in red. (C) Merge between GFP and mitotracker channels shown in yellow. Scale bar = 50 μM.Click here for file
Additional file 4
Immunoblot showing that . Immunoblot analysis of protein level in all three isoforms of OxAtTSPO:eGFP (OxM1TSPO:eGFP, OxM21TSPO:eGFP and OxM42TSPO:eGFP) during salt stress show accumulation of the protein. As a control wild-type plants and plants over-expressing GFP (OxeGFP) were used. Anti-UGPase and Red-ponceau staining were used as loading controls. Equal amounts of total protein were loaded.Click here for file
Additional file 5
Immunoblot of chloroplasts prepared from OxTSPO:eGFP plants. Arabidopsis chloroplasts were prepared from 10-days-old seedlings either untreated or treated with 150 mM NaCl and immunoblotted with antibodies to GFP, RuBisCo, D1 and UGPase. Equal amounts of OxM1TSPO:eGFP chloroplast protein samples were loaded in each lane. (TP) Total Protein; (Chl) Chloroplast protein; PP (Protease Protection treatment).Click here for file
Authors: Stephen Tottey; Maryse A Block; Michael Allen; Tomas Westergren; Catherine Albrieux; Henrik V Scheller; Sabeeha Merchant; Poul Erik Jensen Journal: Proc Natl Acad Sci U S A Date: 2003-12-12 Impact factor: 11.205
Authors: José M Alonso; Anna N Stepanova; Thomas J Leisse; Christopher J Kim; Huaming Chen; Paul Shinn; Denise K Stevenson; Justin Zimmerman; Pascual Barajas; Rosa Cheuk; Carmelita Gadrinab; Collen Heller; Albert Jeske; Eric Koesema; Cristina C Meyers; Holly Parker; Lance Prednis; Yasser Ansari; Nathan Choy; Hashim Deen; Michael Geralt; Nisha Hazari; Emily Hom; Meagan Karnes; Celene Mulholland; Ral Ndubaku; Ian Schmidt; Plinio Guzman; Laura Aguilar-Henonin; Markus Schmid; Detlef Weigel; David E Carter; Trudy Marchand; Eddy Risseeuw; Debra Brogden; Albana Zeko; William L Crosby; Charles C Berry; Joseph R Ecker Journal: Science Date: 2003-08-01 Impact factor: 47.728