| Literature DB >> 21687555 |
Arti Sharma1, Rajinder Singh Chauhan.
Abstract
Castor bean and Jatropha contain seed oil of industrial importance, share taxonomical and biochemical similarities, which can be explored for identifying SSRs in the whole genome sequence of castor bean and utilized in Jatropha curcas. Whole genome analysis of castor bean identified 5,80,986 SSRs with a frequency of 1 per 680 bp. Genomic distribution of SSRs revealed that 27% were present in the non-genic region whereas 73% were also present in the putative genic regions with 26% in 5'UTRs, 25% in introns, 16% in 3'UTRs and 6% in the exons. Dinucleotide repeats were more frequent in introns, 5'UTRs and 3'UTRs whereas trinucleotide repeats were predominant in the exons. The transferability of randomly selected 302 SSRs, from castor bean to 49 J. curcas genotypes and 8 Jatropha species other than J. curcas, showed that 211 (∼70%) amplified on Jatropha out of which 7.58% showed polymorphisms in J. curcas genotypes and 12.32% in Jatropha species. The higher rate of transferability of SSR markers from castor bean to Jatropha coupled with a good level of PIC (polymorphic information content) value (0.2 in J. curcas genotypes and 0.6 in Jatropha species) suggested that SSRs would be useful in germplasm analysis, linkage mapping, diversity studies and phylogenetic relationships, and so forth, in J. curcas as well as other Jatropha species.Entities:
Year: 2011 PMID: 21687555 PMCID: PMC3115337 DOI: 10.1155/2011/286089
Source DB: PubMed Journal: Comp Funct Genomics ISSN: 1531-6912
SSRs used to detect polymorphisms in Jatropha curcas genotypes.
| SSR locus | Repeat motif | Primer sequence | Location of repeat motif | No. of alleles detected | HO | HE | PIC |
|---|---|---|---|---|---|---|---|
| JM1 | (TA)22 | F: TTTGAGTGCTCCTATTTGGCTAGAA | 5′UTR | 3 | 0.1832 | 0.1833 | 0.2 |
| JM2 | (TA)20 | F: GAAATGAGAAGCCTTTACCCTCATT | 5′UTR | 2 | 0.5114 | 0.5115 | 0.4 |
| JM3 | (AT)20 | F: TCATCGAATGGTAGAGAACTAATGG | 5′UTR | 2 | 0.2832 | 0.2832 | 0.3 |
| JM4 | (AT)29 | F: ATTTGATACAGGAGCAGACCTCAAC | 5′UTR | 2 | 0.1166 | 0.1166 | 0.1 |
| JM5 | (TTA)22 | F: GCAGAAACTCGGTAGAACTGTGAGT | 5′UTR | 3 | 0.2998 | 0.2999 | 0.2 |
| JM6 | (AT)24 | F: CCAATCGGAGAGTGAAATAGAACAT | Intron | 6 | 0.2149 | 0.2149 | 0.2 |
| JM7 | (TA)24 | F: TGAGAGTGTTACAGAGAGTGTTGCTT | Intron | 4 | 0.1499 | 0.1499 | 0.1 |
| JM8 | (TC)23 | F: GAATTTAGAAGCCACATTTGAGACG | Intron | 3 | 0.1499 | 0.1499 | 0.1 |
| JM9 | (TC)15 | F: GTTAGAGAAGGCCAAATTGAAACTG | Exon | 2 | 0.1832 | 0.1833 | 0.2 |
| JM10 | (GAA)15 | F: TGGAAGACGAATACTATGACGATGA | Exon | 2 | 0.1149 | 0.115 | 0.1 |
| JM11 | (CAT)12 | F: GCATGCAAACCCTGAATTATGTACT | Exon | 2 | 0.2149 | 0.2149 | 0.2 |
| JM12 | (TA)33 | F: TTGGCTCATAATAACTCCTCAAAGC | Non genic | 2 | 0.1149 | 0.115 | 0.1 |
| JM13 | (AT)25 | F: GTCAGTACCTACAAGCTGCCTTCAT | Non genic | 5 | 0.1832 | 0.1833 | 0.2 |
| JM14 | (AT)34 | F: GTTTGGCGATGAGCTAATTGAGATT | Non genic | 2 | 0.2732 | 0.2732 | 0.2 |
| JM15 | (TA)42 | F: TGTAGATAGCCTTAGCTGTGCATTG | Non genic | 2 | 0.5397 | 0.5398 | 0.5 |
| JM16 | (TA)38 | F: TTGGCTCATAATAACTCCTCAAAGC | Non genic | 2 | 0.4481 | 0.4481 | 0.4 |
JM: Jatropha microsatellite; F: forward; R: reverse.
SSRs used to detect polymorphisms in Jatropha species.
| SSR locus | Repeat motif | Primer sequence | Location of repeat motif | No. of alleles detected | HO | HE | PIC |
|---|---|---|---|---|---|---|---|
| JM8 | (TC)23 | F: GAATTTAGAAGCCACATTTGAGACG | Intron | 3 | 0.7654 | 0.7654 | 0.7 |
| JM10 | (GAA)15 | F: TGGAAGACGAATACTATGACGATGA | Exon | 2 | 0.5925 | 0.5926 | 0.5 |
| JM11 | (CAT)12 | F: GCATGCAAACCCTGAATTATGTACT | Exon | 2 | 0.5679 | 0.5679 | 0.5 |
| JM15 | (TA)42 | F: TGTAGATAGCCTTAGCTGTGCATTG | Non genic | 2 | 0.4938 | 0.4938 | 0.4 |
| JM16 | (TA)38 | F: TTGGCTCATAATAACTCCTCAAAGC | Non genic | 2 | 0.6913 | 0.6914 | 0.6 |
| JM17 | (TA)31 | F: CTTCTCAGCAACATCACATCAAACT | 5′UTR | 3 | 0.6172 | 0.6173 | 0.6 |
| JM18 | (AT)25 | F: ATTCAGGCCATCCACATAGTCTAAC | 5′UTR | 2 | 0.5925 | 0.5926 | 0.5 |
| JM19 | (TA)33 | F: GCCTTAGTTGTGCATTGCTCTATTT | 5′UTR | 2 | 0.7407 | 0.7407 | 0.7 |
| JM20 | (TA)23 | F: AGATTTAGAAATGGTAATAGGGCGG | 5′UTR | 7 | 0.6419 | 0.642 | 0.6 |
| JM21 | (AT)25 | F: GCAAGAAATAAGGTACAACCGAAAC | 5′UTR | 2 | 0.6913 | 0.6914 | 0.6 |
| JM22 | (AT)29 | F: ATGCTATCGGAATAGATCCTTCGAG | 5′UTR | 3 | 0.4444 | 0.4444 | 0.3 |
| JM23 | (AT)32 | F: GAGATGGAAATGATTGGTGTTGAGT | 5′UTR | 3 | 0.7654 | 0.7654 | 0.7 |
| JM24 | (AT)20 | F: TGATGGATTGAGAACTGAAGAGGAT | 5′UTR | 4 | 0.6913 | 0.6914 | 0.6 |
| JM25 | (CT)20 | F: CTGACATATCTTATTGGGTGTGGAA | 5′UTR | 2 | 0.6913 | 0.6914 | 0.6 |
| JM26 | (TC)18 | F: GCCTTTAAGAGATTGATGGCAACTA | 3′UTR | 2 | 0.7160 | 0.716 | 0.7 |
| JM27 | (TA)24 | F: TTGGAGGTTACAATCAATGGCA | 3′UTR | 3 | 0.7654 | 0.7654 | 0.7 |
| JM28 | (AT)27 | F: CCATTTGGTGTTAATCACATGAGTC | 3′UTR | 2 | 0.7160 | 0.716 | 0.7 |
| JM29 | (AT)25 | F: CTGTTTGAGGATCAGACTTTGAAGC | Intron | 2 | 0.7160 | 0.716 | 0.7 |
| JM30 | (AT)25 | F: GCATGGAAATTCAATTCTGTGCTAC | Intron | 2 | 0.7160 | 0.716 | 0.7 |
| JM31 | (ATA)19 | F: TGCTCCCAGTAAGCATAAGAAGAAG | Intron | 2 | 0.7160 | 0.716 | 0.7 |
| JM32 | (AT)22 | F: AGCAAGAAACCATACTTCGAGTGTC | Intron | 2 | 0.6666 | 0.6667 | 0.6 |
| JM33 | (GA)21 | F: TTCAATAACAGATTTGGCTAGGCTC | Intron | 3 | 0.4938 | 0.4938 | 0.4 |
| JM34 | (AT)24 | F: CAGACCCATCTGATCATCATTGTAG | Intron | 3 | 0.5679 | 0.5679 | 0.5 |
| JM35 | (CT)12 | F: CAGCGTCCCTCTCTCTCTTCC | Exon | 2 | 0.6419 | 0.642 | 0.6 |
| JM36 | (AT)29 | F: GAAAGCTAGAAATCAATGAACGCAC | Non genic | 3 | 0.6419 | 0.642 | 0.6 |
| JM37 | (AAT)16 | F: AATCACATCAGTTGTAACGGCA | Non genic | 3 | 0.7407 | 0.7407 | 0.7 |
Extent of amplification and polymorphism among SSRs of varying repeat units in J. curcas.
| Repeat units | SSRs tested (%) | SSRs with amplification (%)1 | Polymorphic SSRs (%)2 |
|---|---|---|---|
| 10–15 | 11 | 3.00 | 1.89 |
| 16–20 | 13 | 12.26 | 3.31 |
| 21–25 | 14 | 18.20 | 6.16 |
| 26–30 | 26 | 20.20 | 3.31 |
| 31–35 | 22 | 9.00 | 1.89 |
| 36–40 | 8 | 3.20 | 0.47 |
| >40 | 6 | 4.00 | 0.47 |
1Percent amplification was calculated as: SSRs amplified from the corresponding repeat unit X100/total no. of SSRs tested for amplification from the corresponding repeat unit.
2Percent polymorphism was calculated as: SSRs polymorphic from the corresponding repeat unit X100/total no. of SSRs amplified from the corresponding repeat unit.
Figure 1Number of alleles per locus for SSRs of different repeat units in J. curcas genotypes (black) and Jatropha species (gray).
Figure 2Dendrogram based on allele sharing genetic distances of 49 genotypes of J. curcas on the basis of Jaccard's similarity coefficient.