Literature DB >> 21592340

Identification of two internal signal peptide sequences: critical for classical swine fever virus non-structural protein 2 to trans-localize to the endoplasmic reticulum.

Kang-kang Guo1, Qing-hai Tang, Yan-ming Zhang, Kai Kang, Lei He.   

Abstract

BACKGROUND: The membrane topology and molecular mechanisms for endoplasmic reticulum (ER) localization of classical swine fever virus (CSFV) non-structural 2 (NS2) protien is unclear. We attempted to elucidate the subcellular localization, and the molecular mechanisms responsible for the localization of this protein in our study. The NS2 gene was amplified by reverse transcription polymerase chain reaction, with the transmembrane region and hydrophilicity of the NS2 protein was predicted by bioinformatics analysis. Twelve cDNAs of the NS2 gene were amplified by the PCR deletion method and cloned into a eukaryotic expression vector, which was transfected into a swine umbilical vein endothelial cell line (SUVEC). Subcellular localization of the NS2 protein was characterized by confocal microscopy, and western blots were carried out to analyze protein expression.
RESULTS: Our results showed that the -NH2 terminal of the CSFV NS2 protein was highly hydrophobic and the protein localized in the ER. At least four transmembrane regions and two internal signal peptide sequences (amino acids103-138 and 220-262) were identified and thought to be critical for its trans-localization to the ER.
CONCLUSIONS: This is the first study to identify the internal signal peptide sequences of the CSFV NS2 protein and its subcellular localization, providing the foundation for further exploration of this protein's function of this protein and its role in CSFV pathogenesis.

Entities:  

Mesh:

Substances:

Year:  2011        PMID: 21592340      PMCID: PMC3113308          DOI: 10.1186/1743-422X-8-236

Source DB:  PubMed          Journal:  Virol J        ISSN: 1743-422X            Impact factor:   4.099


Background

Classical swine fever (CSF) is a highly contagious and often fatal disease of pigs and is classified by the World Organization for Animal Health (OIE) as a notifiable (previously List A) disease. The causative agent of CSF is classical swine fever virus (CSFV), a member of the Pestivirus genus within the Flaviviridae family of viruses, which also contains the genera Flavivirus and Hepacivirus (hepatitis C viruses, HCV)[1]. CSFV harbors a 12.3 kb positive-sense, single-stranded RNA genome that consists of a large open reading frame that encodes a polyprotein which is processed into 12 mature proteins, namely, Npro, C, Erns, E1, E2, p7, NS2, NS3, NS4A, NS4B, NS5A and NS5B [2-4]. In recent years, the nonstructural NS2 protein has been thought to be functional only as an NS2/NS3 auto-protease, which is essential for high productivity of CSFV in vivo. It was speculated that the N-terminal half of NS2 is highly hydrophobic, and that p7 protein may contain a signal sequence to direct the downstream NS2 protein to the membrane [3,5,6]. Our previous study demonstrated that CSFV NS2 was a hydrophobic protein and localized in the endoplasmic reticulum (ER) membrane, independently of CSFV p7 peptides. However, the membrane topology and molecular mechanism of ER localization of this protein remains unclear. The biofunction of a protein is always associated with it's subcellular localization. For instance, HCV NS2 protein, which shares great similarities with CSFV NS2 protein, localizes in the ER membrane and lead to ER stress [7,8]. Interestingly, our results indicated that CSFV NS2 protein contains two internal signal peptide sequences, which are critical for trans-localization to the ER, and this protein probably possesses at least four transmembrane regions. The findings are crucial for elucidating the function of CSFV NS2 protein, and also have potentially important implications for understanding the molecular mechanisms of pathogenesis for this economically important agricultural disease.

Materials and methods

Vectors and cell culture

The pEGFP-C1 eukaryotic expression vector was purchased from Clontech (USA) and competent E. coli DH5α cells, which were used for cloning, were purchased from Tiangen Biotech (China). The pEGFP-NS2 plasmid contained the full-length NS2 gene from the CSFV virulent train Shimen. The established swine umbilical vein endothelial cell line (SUVEC) was cultured as previously described [9].

Antibodies and reagents

Mouse anti-GFP monoclonal antibody (mAb) and horseradish peroxidase-conjugated goat anti-mouse antibodies were purchased from Millipore (USA). The nuclear staining dye Hoechst 33342 and ER-Tracker™ Red probe were obtained from Invitrogen (USA)

Plasmid construction and transfection

To investigate the internal signal sequences in the CSFV NS2 protein, the primers shown in Table 1 were designed according to the CSFV NS2 gene nucleotide sequences. All of the upstream primers contained a SalIsite, and a BamHIsite was incorporated into all of the downstream primers. Using these primers, 12 amino-terminal truncated polymerase chain reaction (PCR) products were obtained and the relative position of each amplified fragment is shown in Figure 1. PCR was carried out according to the following procedures (pEGFP-NS2 was used as a template): an initial denaturation step at 95°C for 5 min, followed by 35 cycles of 95°C for 30 sec, 60°C for 30 sec, 72°C for 1.5 min, and a final extension step at 72°C for 10 min. The 12 PCR products obtained, designated as NS2/1-457, NS2/13-457, NS2/33-457, NS2/103-457, NS2/138-457, NS2/263-457, NS2/337-457, NS2/1-336, NS2/1-170, NS2/1-76, NS2/202-262 and NS2/138-201 were cloned into the SalI/BamHIsites of the expression vector pEGFP-C1 and the recombinant plasmids were identified and verified by enzyme digestion and sequencing. SUVEC were seeded into 15 mm2 confocal dish (Costar, USA) 24 h before being transfected. When they reached 60-70% confluence, the cells were transfected with the 12 recombinant plasmids and the pEGFP-C1 control vector using the Lipofectamine 2000 transfection reagent, according to the manufacturer's instructions (Invitrogen, USA)
Table 1

Primers for construction of 12 subcloning of cDNA.

Primers and sites(amino acid site of NS2)Primer sequences (5"-3")
Anti457CATGGATCCTCTAAGCACCCAGCCAAGG
Anti336CATGGATCCCTTCGGCATCCCATAAACC
Anti170CATGGATCCTGGCAGTATGAGGATCAGGG
Anti76CATGGATCCAATGTAGGTCCAGGTTAGCAACG
S1CATGTCGAC GGAAAGATAGATGGCGGTTG
S13CATGTCGAC ACCAGCTTTGACATCCAACTC
S33CATGTCGAC AAGAGAGATCCGACTACTGTCCC
S103CATGTCGAC AAGGGAATAGGTGAGTTGGATTTAC
S138CATGTCGAC AATCTGGACATAGCCGGATTG
S263CATGTCGAC AAGAAGATCATAGATGAAATAGCAGG
S337CATGTCGAC TTGGTTGGCTTAGTCAAGGC
Anti201CAT GGATCC GTTTACCCTCTTAAAGTTGGTCTTCC
S202CAT GTCGAC GACATATATGAAGTTGACCAAGCTG
Anti262CAT GGATCC GTGGAGGTAGTAAGACACTTCAAATATC

A restriction site sequence was inserted in 5' of each primer. The underlined sequences were restriction sites.

Figure 1

Schematic representation of the CSFV NS2 deletion-mapping results. NS2 is located at aa 1133-1589 in the CSFV strain Shimen polyprotein sequence. The numbers indicate the first and the last amino acids of each NS2 protein sequence used for the studies.

Primers for construction of 12 subcloning of cDNA. A restriction site sequence was inserted in 5' of each primer. The underlined sequences were restriction sites. Schematic representation of the CSFV NS2 deletion-mapping results. NS2 is located at aa 1133-1589 in the CSFV strain Shimen polyprotein sequence. The numbers indicate the first and the last amino acids of each NS2 protein sequence used for the studies.

Western blot analysis

Protein expression was analyzed by western blot as reported previously. Briefly, whole cell extracts were prepared by washing the cells with PBS, harvesting them by scraping and then resuspending the cells in 1 mL of PBS. Following centrifugation, the cells were resuspended in cell lysis buffer (50 mM Tris-HCl, 5 mM EDTA, 150 mM NaCl, 0.1% NP-40, 0.5% deoxycholic acid, 1 mM sodium orthovanadate, 100 μg/mL PMSF and protease inhibitors) and centrifuged at 15,000 × g for 30 min at 4°C. Cell extracts were resolved by 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to a PVDF membrane (Millipore, USA). The membrane was blocked overnight with 5% skimmed milk in TNT buffer (20 mM Tris-HCl [pH 7.5], 150 mM NaCl, and 0.05% Tween 20) and then incubated with mouse anti-GFP mAb for 2 h. Detection of primary antibodies was performed with horseradish peroxidase-conjugated goat anti-mouse antibody, as appropriate. The protein bands were visualized by enhanced chemiluminescence methods according to the manufacturer's instructions (Millipore).

Fluorescence staining and confocal microscopy

To examine the expression and subcellular localization of CSFV NS2 protein, 48 h after transfection, cells were washed with Hank's balanced salt solution (HBSS) and incubated with Hoechst33342 at 37°C for 15 min. The cells were washed twice with HBSS and incubated with ER-Tracker™ Red probe (Invitrogen, USA) at 37°C for 30 min. Cells were again washed with HBSS and then visualized by laser confocal scanning microscopy (Model LSM510 META, Zeiss, Germany).

Bioinformatics analysis

The amino acid sequences of the CSFV NS2 protein was analyzed by the DNAstar software and the online analysis tool available at http://us.expasy.org/tools.

Results

Construction of recombinant expressing plasmid

Using specifically designed primers, 12 amino-terminal truncated fragments of the NS2 genes were amplified by PCR and the sizes of these amplified products were verified by electrophoresis (Figure 2). These PCR products were cloned into the expression vector pEGFP-C1, and the 12 recombinant plasmids were identified and verified by SalI/BamHI enzyme digestion (Figure 3) and sequence analysis.
Figure 2

PCR amplification of 12 subcoloning cDNA of CSFV NS2 gene. M, DL 2000 marker; M3, Plus-DL2000 marker; 1~12, PCR products of 12 subcloning cDNA.

Figure 3

Identificantion of the recombinant vector by enzyme digestion. M1, DL15000 marker; M2, DL 2000 marker; M3, Plus DL 2000 marker; 1~12, Enzyme digestion of 12 recombinant vectors by SalIand BamHI.

PCR amplification of 12 subcoloning cDNA of CSFV NS2 gene. M, DL 2000 marker; M3, Plus-DL2000 marker; 1~12, PCR products of 12 subcloning cDNA. Identificantion of the recombinant vector by enzyme digestion. M1, DL15000 marker; M2, DL 2000 marker; M3, Plus DL 2000 marker; 1~12, Enzyme digestion of 12 recombinant vectors by SalIand BamHI.

Expression and subcellular localization of CSFV NS2 protein

Western blot analysis showed that all the target protein were correctly expressed and displayed the expected molecular weight (Figure 4). The subcellular localization of NS2 was investigated by confocal fluorescence microscopy. The subcloned proteins NS2/1-457, NS2/13-457, NS2/33-457, NS2/103-457, NS2/1-336, NS2/1-170 and NS2/202-262 localized in the ER, whereas, proteins NS2/138-457, NS2/263-457, NS2/1-76 and NS2/337-457 were distributed in the cytoplasm, gathering around the ER. Protein NS2/138-201 was observed in the nucleus and cytoplasm, with no obvious gathering around the ER. In the GFP positive control cells, GFP was observed in the nucleus and cytoplasm (SUVEC-GFP), and no green fluorescence was detected in the negative control SUVECs (Figure 5A and 5B).
Figure 4

Detection of the protein expressed by 12 subcloning cDNA of CSFV NS2 gene. M, Protein Marker; N, negative control; 1~12, Proteins encoded by 12 sub-cloning cDNA of CSFV NS2 gene

Figure 5

Detection of the subcellular localization of the protein expressed by 12 subcloning cDNA of CSFV NS2 gene (A and B). Confocal microscopy images of SUVEC cells. All the cells were stained by Hoechst33342 and ER-Tracker Red. Merged images show co-localization of fusion protein, GFP and the negative control. Bar = 20 μm for all the figures.

Detection of the protein expressed by 12 subcloning cDNA of CSFV NS2 gene. M, Protein Marker; N, negative control; 1~12, Proteins encoded by 12 sub-cloning cDNA of CSFV NS2 gene Detection of the subcellular localization of the protein expressed by 12 subcloning cDNA of CSFV NS2 gene (A and B). Confocal microscopy images of SUVEC cells. All the cells were stained by Hoechst33342 and ER-Tracker Red. Merged images show co-localization of fusion protein, GFP and the negative control. Bar = 20 μm for all the figures.

NS2 contains two internal signal sequences and multiple domains in the ER

Hydrophilicity analysis of the CSFV NS2 amino acid sequences using the DNAstar software showed that the -NH2 terminal was highly hydrophobic; accordingly, five probable transmembrane regions were predicted at the -NH2 terminal of the NS2 protein using the online tool available at http://us.expasy.org/tools (Figure 6A and 6B). Taken together with the data regarding the subcellular localization of 12 the subcloned NS2 fragments, the possible locations of the transmembrane domains were predicted. Thus, four transmembrane domains were predicted to reside within amino acids 1-40, 50-90, 103-170 and 220-262, with two internal signal sequences likely residing within amino acids 103-138 and 220-262. The predicted model of CSFV NS2 membrane topology is show in Figure 7.
Figure 6

Prediction of hydrophilicity region and transmembrane region of CSFV NS2 protein (A and B). I, II, III, and IV indicate the four putative transmembrane domains.

Figure 7

Prediction of membrane topology of CSFV NS2 protein. The numbers represent the amino acids identified by the deletion mapping experiments. Arrows show the locations of the two internal signal sequences.

Prediction of hydrophilicity region and transmembrane region of CSFV NS2 protein (A and B). I, II, III, and IV indicate the four putative transmembrane domains. Prediction of membrane topology of CSFV NS2 protein. The numbers represent the amino acids identified by the deletion mapping experiments. Arrows show the locations of the two internal signal sequences.

Discussion

CSF caused by virulent strains of CSFV is a hemorrhagic disease of pigs, characterized by disseminated intravascular coagulation, thrombocytopenia and immunosuppression. Recently, many researchers have focused on the development of novel vaccine and diagnostic methods, however, the molecular pathogenesis of CSFV is still not well understood. Regarding the function of virus-encoded proteins, Npro, NS3 and NS5B proteins have been studied extensively. However, NS2 protein was thought to function only as an NS2/NS3 auto-protease essential for the high productivity of CSFV in vivo [1,3,5,6]. To date, no reports have focused on the subcellular localization of NS2 protein. Previously, researchers only speculated that CSFV NS2 protein was associated with the membrane, and it's translocation depended on p7 peptide; however, there was no experimental data that demonstrated the molecular mechanism behind it's subcellular localization. Our previous work demonstrated that, CSFV NS2 protein localized in the ER of host cells. The protein tag green fluorescence protein (GFP) was expressed as a fusion with CSFV NS2 protein and ER localization of the fusion protein showed no cell type specificity, and whether GFP was fused to the -COOH terminal or the -NH2 terminal did not effect translocalization of CSFV NS2 protein [7]. To reveal the molecular mechanism of ER localization of NS2 protein, the amino acid sequences of NS2 was analyzed using bioinformatics tools. The results indicated that the -NH2 terminal is highly hydrophobic, containing at least four transmembrane regions. Twelve subcloned cDNAs of the NS2 gene were expressed as GFP fusion proteins and confocal microscopy observation suggested that the proteins lacking the -NH2 terminal (NS2/337-457) distributed in cytoplasm, implying that there was no internal signal sequence in the amino acids 337-457. Proteins NS2/201-262 and NS2/1-170 localized to the ER, and together with the bioinformatics data, this suggested there were internal signal sequences residing within amino acids 220-262 and 103-138. A model of CSFV NS2 membrane topology was predicted, as shown in Figure 7; however further experiments are needed to investigate the natural subcellular localization of NS2 protein in CSFV infected cells. In contrast, the deletion of the NS2 gene by PCR perhaps influences translocalization of the target protein. Truncation by PCR deletion may have disrupted the internal signal sequences of the NS2 protein. Therefore, membrane topology was predicted from confocal microscopy data and through bioinformatics analysis of NS2 amino acid sequences. The biofunction of a protein is always associated with it's subcellular localization. Previous studies showed that HCV NS2 protein localized in the ER independently of p7 protein [8,10], induced ER stress of host cells and consequently played an important role not only in the regulation of the host cells physiological functions but also in the pathogenesis of HCV[11]. Interestingly, CSFV NS2 shares a high level of similarity with the HCV NS2 protein regarding subcellular localization and auto-protease activity[5,12-14]. Both were able to induce ER stress and inhibit the proliferation of the host cells[7,15], and were essential for the production of infectious viral particles [6,16-18]. Therefore, we speculate that CSFV NS2 protein also plays an important role in the pathogenesis of CSF. The findings of this study provided a foundation for further work to reveal the biofunction of NS2 protein.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

KKG and QHT planned and participated in all of the experiments and wrote the manuscript. YMZ designed the project. KK participated in the confocal microscopy; LH contributed to cell culturing, plasmid construction and cell transfection. All authors have read and approved the final manuscript.
  18 in total

1.  HCV NS2 protein inhibits cell proliferation and induces cell cycle arrest in the S-phase in mammalian cells through down-regulation of cyclin A expression.

Authors:  Xiao-Jun Yang; Jing Liu; Li Ye; Qing-Jiao Liao; Jian-Guo Wu; Jin-Rong Gao; Ying-Long She; Zheng-Hui Wu; Lin-Bai Ye
Journal:  Virus Res       Date:  2006-06-23       Impact factor: 3.303

2.  Dissection of a viral autoprotease elucidates a function of a cellular chaperone in proteolysis.

Authors:  T Lackner; H-J Thiel; N Tautz
Journal:  Proc Natl Acad Sci U S A       Date:  2006-01-23       Impact factor: 11.205

Review 3.  Replication of hepatitis C virus.

Authors:  Darius Moradpour; François Penin; Charles M Rice
Journal:  Nat Rev Microbiol       Date:  2007-05-08       Impact factor: 60.633

4.  E2-p7 region of the bovine viral diarrhea virus polyprotein: processing and functional studies.

Authors:  T Harada; N Tautz; H J Thiel
Journal:  J Virol       Date:  2000-10       Impact factor: 5.103

5.  Structure of the catalytic domain of the hepatitis C virus NS2-3 protease.

Authors:  Ivo C Lorenz; Joseph Marcotrigiano; Thomas G Dentzer; Charles M Rice
Journal:  Nature       Date:  2006-07-23       Impact factor: 49.962

6.  Processing in the pestivirus E2-NS2 region: identification of proteins p7 and E2p7.

Authors:  K Elbers; N Tautz; P Becher; D Stoll; T Rümenapf; H J Thiel
Journal:  J Virol       Date:  1996-06       Impact factor: 5.103

7.  Uncleaved NS2-3 is required for production of infectious bovine viral diarrhea virus.

Authors:  Eugene V Agapov; Catherine L Murray; Ilya Frolov; Lin Qu; Tina M Myers; Charles M Rice
Journal:  J Virol       Date:  2004-03       Impact factor: 5.103

8.  Membrane topology of the hepatitis C virus NS2 protein.

Authors:  Ardath K Yamaga; Jing-Hsiung Ou
Journal:  J Biol Chem       Date:  2002-06-24       Impact factor: 5.157

9.  Temporal modulation of an autoprotease is crucial for replication and pathogenicity of an RNA virus.

Authors:  T Lackner; A Müller; A Pankraz; P Becher; H-J Thiel; A E Gorbalenya; N Tautz
Journal:  J Virol       Date:  2004-10       Impact factor: 5.103

Review 10.  The hepatitis C virus NS2/3 protease.

Authors:  Sarah Welbourn; Arnim Pause
Journal:  Curr Issues Mol Biol       Date:  2007-01       Impact factor: 2.081

View more
  8 in total

1.  POD1 regulates pollen tube guidance in response to micropylar female signaling and acts in early embryo patterning in Arabidopsis.

Authors:  Hong-Ju Li; Yong Xue; Dong-Jie Jia; Tong Wang; Dong-Qiao Hi; Jie Liu; Feng Cui; Qi Xie; De Ye; Wei-Cai Yang
Journal:  Plant Cell       Date:  2011-09-27       Impact factor: 11.277

2.  Interactive cellular proteins related to classical swine fever virus non-structure protein 2 by yeast two-hybrid analysis.

Authors:  Kai Kang; Kangkang Guo; Qinhai Tang; Yanming Zhang; Jiang Wu; Weiwei Li; Zhi Lin
Journal:  Mol Biol Rep       Date:  2012-10-18       Impact factor: 2.316

3.  Identification of cytotoxic T lymphocyte epitopes on swine viruses: multi-epitope design for universal T cell vaccine.

Authors:  Yu-Chieh Liao; Hsin-Hung Lin; Chieh-Hua Lin; Wen-Bin Chung
Journal:  PLoS One       Date:  2013-12-17       Impact factor: 3.240

4.  Follistatin-like protein 1 contributes to dendritic cell and T-lymphocyte activation in nasopharyngeal carcinoma patients by altering nuclear factor κb and Jun N-terminal kinase expression.

Authors:  Hong Wang; Senyong Wu; Shiping Huang; Shaolin Yin; Guilong Zou; Kuan'en Huang; Zhe Zhang; Anzhou Tang; Wensheng Wen
Journal:  Cell Biochem Funct       Date:  2016-11-16       Impact factor: 3.685

5.  CSFV Infection Up-Regulates the Unfolded Protein Response to Promote Its Replication.

Authors:  Wencheng He; Hailuan Xu; Hongchao Gou; Jin Yuan; Jiedan Liao; Yuming Chen; Shuangqi Fan; Baoming Xie; Shaofeng Deng; Yangyi Zhang; Jinding Chen; Mingqiu Zhao
Journal:  Front Microbiol       Date:  2017-11-02       Impact factor: 5.640

6.  ERK-mediated Cytoplasmic Retention of USP11 Contributes to Breast Cancer Cell Proliferation by Stabilizing Cytoplasmic p21.

Authors:  Ling Li; Tanggang Deng; Lin Zhang; Yanpeng Wang; Yangyang Zhou; Yan Liu; Hui Li; Jing Dai; Yuan Yang; Neng Ling; Huimin Liu; Jing Liu; Lanqin Cao; Min Xu; Mao Ye
Journal:  Int J Biol Sci       Date:  2022-03-21       Impact factor: 6.580

7.  Classical swine fever virus nonstructural protein p7 modulates infectious virus production.

Authors:  Cheng Zhao; Xiaofang Shen; Rui Wu; Ling Li; Zishu Pan
Journal:  Sci Rep       Date:  2017-10-11       Impact factor: 4.379

8.  Antibody screening identifies 78 putative host proteins involved in Cyprinid herpesvirus 3 infection or propagation in common carp, Cyprinus carpio L.

Authors:  M Gotesman; H Soliman; M El-Matbouli
Journal:  J Fish Dis       Date:  2013-01-24       Impact factor: 2.767

  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.