| Literature DB >> 21556116 |
R Song1, W Xu, Y Chen, Z Li, Y Zeng, Y Fu.
Abstract
This study was designed to investigate the relationship between SIRTs 1 and 4 in peripheral blood leukocytes (PBLs) and human type 2 diabetes mellitus (T2DM). SIRTs 1 and 4 have been confirmed to be associated with homeostasis of glucose/lipid metabolism, but their roles in T2DM are still poorly understood. Peripheral blood and biochemical data were collected from 52 healthy individuals (normal control group, NC group) and 113 cases of T2DM patients. Immunocytochemical staining was used to detect SIRT1 and SIRT4 and reverse transcription polymerase chain reaction (RT-PCR) was used to detect SIRT1 or SIRT4 mRNA levels in PBLs. Immunocytochemical staining showed that SIRT1 is expressed in both nucleus and cytoplasm, and SIRT4 in the cytoplasm of granulocytes and monocytes. No SIRT1 or SIRT4 was found in lymphocytes. RT-PCR showed that SIRT1 and SIRT4 mRNA levels in T2DM group were lower than those in NC group (P<0.01). Correlation analysis showed that there is a negative correlation between SIRTs 1 and 4 and fasting plasma glucose (FPG) (P<0.05) (r= -0.161 and -0.156), a positive correlation between SIRT4 mRNA levels and triglyceride (TG)/lipoprotein a (LPa) levels (P<0.05), and a negative correlation between SIRT4 mRNA levels and high density lipoprotein cholesterol (HDL) (P<0.05). SIRTs 1 and 4 may have a role in the pathogenesis of T2DM and their expression in granulocytes and monocytes may indirectly reflect the homeostasis of glucose/lipid metabolism in T2DM.Entities:
Mesh:
Substances:
Year: 2011 PMID: 21556116 PMCID: PMC3167349 DOI: 10.4081/ejh.2011.e10
Source DB: PubMed Journal: Eur J Histochem ISSN: 1121-760X Impact factor: 3.188
The primers used in polymerase chain reaction.
| Genes | Forward primer (5′–3′) | Reverse primer (5′–3′) |
|---|---|---|
| SIRT1 | GCAACATCTTATGATTGGCACA | AAATACCATCCCTTGACCTGAA |
| SIRT4 | ACCCTGAGAAGGTCAAAGAGTTAC | TTCCCCACAATCCAAGCAC |
| 18S rRNA | TTGGTGGAGCGATTTGTCTG | AATGGGGTTCAACGGGTTAC |
Comparison clinical data of the two groups.
| Group | Sex | BMI | SBP | DBP |
|---|---|---|---|---|
| NC group | 32/20 | 22.40±1.35 | 115.87±10.32 | 75.81±8.71 |
| T2DM group | 57/56 | 23.81±2.79[ | 140.24±25.07 | 83.26±10.68 |
BMI, body mass index; SBP, systolic blood pressure; DBP, diastolic blood pressure; ; BMI, body mass index; SBP, systolic blood pressure; DBP, diastolic blood pressure; NC, control group;
P<0.01;
P<0.05.
Blood glucose and lipid data of the two groups.
| Group | FPG | TC | TG | HDL | LDL | LPa |
|---|---|---|---|---|---|---|
| NC group | 4.97±0.53 | 4.83±0.75 | 1.14±0.31 | 1.09±0.15 | 2.97±0.74 | 198.26±64.26 |
| T2DM group | 9.42±3.40 | 4.88±1.49 | 1.85±1.01 | 1.10±0.29 | 2.84±1.04 | 299.40±132.60 |
FPG, fasting plasma glucose; TC, total cholesterol; TG, triglyceride; HDL, high density lipoprotein; LDL, low density lipoprotein; LPa, lipoprotein a; NC, control group;
P<0. 01;
P<0.05.
Figure 1Comparison of fasting plasma glucose, triglyceride, and lipoprotein a in the two groups; *P<0.01 comparison between the NC group and the T2DM group.
Figure 2Immunocytochemical staining of SIRTs 1 and 4 in PBLs. Pink arrow, monocytes; blue arrow, granulocyte; green arrow, lymphocytes. A, B, positive staining; C, negative control. Scale bar: 10 µm.
Figure 3Agarose gel electrophoresis figure for RT-PCR products of SIRTs 1 and 4 and comparison SIRT1/18S, SIRT4/18S data of the two groups; *P<0.01; #P<0.05, comparison between NC and T2DM groups.
Correlation analysis between SIRT1/18S RNA, SIRT4/18S RNA and blood glucose/lipid.
| SIRT1/18S RNA | SIRT4/18S RNA | |
|---|---|---|
| FPG (mmol/L) | r=−0.161 | r=−0.167 |
| P=0.037 | P=0.045 | |
| WBC (×109/L) | r=−0.135 | r=−0.145 |
| P=0.104 | P=0.106 | |
| TC (mmol/L) | r=0.114 | r=0.090 |
| P=0.157 | P=0.291 | |
| TG (mmol/L) | r=−0.036 | r=−0.169 |
| P=0.656 | P=0.049 | |
| HDL (mmol/L) | r=−0.006 | r=0.182 |
| P=0.938 | P=0.032 | |
| LDL (mmol/L) | r=0.098 | r=0.092 |
| P=0.250 | P=0.308 | |
| LPa (mmol/L) | r=−0.169 | r=−0.235 |
| P=0.111 | P=0.028 |
FPG, fasting plasma glucose; WBC, white blood cell; TC, total cholesterol; TG, triglyceride; HDL, high density lipoprotein; LDL, low density lipoprotein; LPa, lipoprotein a.