Literature DB >> 21529387

Molecular epidemiology of Oropouche virus, Brazil.

Helena Baldez Vasconcelos1, Márcio R T Nunes, Lívia M N Casseb, Valéria L Carvalho, Eliana V Pinto da Silva, Mayra Silva, Samir M M Casseb, Pedro F C Vasconcelos.   

Abstract

Oropouche virus (OROV) is the causative agent of Oropouche fever, an urban febrile arboviral disease widespread in South America, with >30 epidemics reported in Brazil and other Latin American countries during 1960-2009. To describe the molecular epidemiology of OROV, we analyzed the entire N gene sequences (small RNA) of 66 strains and 35 partial Gn (medium RNA) and large RNA gene sequences. Distinct patterns of OROV strain clustered according to N, Gn, and large gene sequences, which suggests that each RNA segment had a different evolutionary history and that the classification in genotypes must consider the genetic information for all genetic segments. Finally, time-scale analysis based on the N gene showed that OROV emerged in Brazil ≈223 years ago and that genotype I (based on N gene data) was responsible for the emergence of all other genotypes and for virus dispersal.

Entities:  

Mesh:

Substances:

Year:  2011        PMID: 21529387      PMCID: PMC3321770          DOI: 10.3201/eid1705.101333

Source DB:  PubMed          Journal:  Emerg Infect Dis        ISSN: 1080-6040            Impact factor:   6.883


Oropouche virus (OROV) is one of the most common orthobunyaviruses (family Bunyaviridae, genus Orthobunyavirus) () and is the causative agent of Oropouche fever in humans, which is clinically characterized as an acute febrile disease (). The first isolation of OROV was reported in Trinidad and Tobago in 1955, when the virus was isolated from the blood of a febrile patient and from a pool of Coquillettidia venezuelensis mosquitoes (). OROV was described in Brazil in 1960, when it was isolated from a sloth (Bradypus tridactylus) captured near a forested area during construction of the Belem–Brasilia highway and from a pool of Ochlerotatus (Ochlerotatus) serratus mosquitoes, captured near the same site (). Since the first isolation of OROV, >30 outbreaks have been reported in Brazil, Peru, Panama, and Trinidad and Tobago during 1960–2009. At least half a million persons are estimated to have been infected (,). Similar to the genomes of other orthobunyaviruses, the OROV genome comprises 3 single-stranded negative-sense RNA segments—large, medium, and small. The large RNA segment encodes a large protein that has RNA polymerase activity for transcription and replication of genomic RNA segments. The medium segment encodes a precursor polyprotein, which gives rise to the viral surface glycoproteins (Gc and Gn) and to a nonstructural protein NSM. The small RNA encodes a structural nucleocapsid (N) protein, as well as a smaller nonstructural protein (NSS) in overlapping reading frames (). Studies of the molecular biology of the OROV small RNA segment have suggested its monophyletic origin and the existence of at least 3 genotypes (I, II, and III) (). Recently, genotype III was isolated from a wild vertebrate host (Callithrix sp.) in southeastern Brazil, suggesting possible dispersion of the virus to susceptible and populated areas in Brazil (). Further molecular analyses that used OROV strains recovered during outbreaks in Pará State during 2003–2007 demonstrated the association of at least 2 different genotypes (I and II) with Oropouche fever cases in the area (,). In this study, we describe new information regarding the molecular epidemiology of OROV. This information will help clarify the evolution, dispersal, and genotyping classification of this human pathogen in the Brazilian Amazon region.

Material and Methods

Virus Strains

The OROV strains used in this study (Table A1) were relatively low-passage isolates obtained from the virus collection of the Department of Arbovirology and Hemorrhagic Fevers, Evandro Chagas Institute (Ananindeua, Brazil). These strains corresponded to viruses recovered from different hosts and geographic locations that were isolated during 1960–2009.
Table A1

Oropouche virus strains used for phylogenetic analysis and time-scaled analysis*

LabelStrainsSource of isolationYearPlace of isolation†GenBank accession no.
TR01TRVL 9760Human1955Sangre Grande, Trinidad and TobagoS: AF164531
PA01AR 19886Ochlerotatus serratus mosquitoes1960BR 14 KM 94 (Ipixuna), ParáS: HM470107; M: HQ830373; L: HQ830408
PA02AN 19991 Bradypus tridactylus 1960São Miguel do Guamá, ParáS: AF164532; M: AF 441119; L: AF 484424
PA03H 29086Human1961Belém, ParáS: HM470108; M: HQ830374; L: HQ830409
PA04H 29090Human1961Belém, ParáS: HM470109; M: HQ830375; L: HQ830410
PA 05H 121293Human1967Bragança, ParáS: HM470110; M: HQ830376; L: HQ830411
PA06AR 136921Culex quinquefasciatus mosquitoes1968Belém, ParáS: HQ830443; M: HQ830377; L: HQ830412
PA07AN 206119 B. trydactilus 1971Maracanã, ParáS: AY993909; M: HQ830378; L: HQ830413
PA08AN 208402 B. trydactilus 1971Maracanã, ParáS:AY993910; M: HQ830379; L: HQ830414
PA09AN 208819 B. trydactilus 1971Maracanã, ParáS:AY993911; M: HQ830380; L: HQ830415
PA10AN 208823 B. trydactilus 1971Maracanã, ParáS: AY993912
PA11H 244576Human1973Belém, ParáS: HQ830444
PA12H 271708Human1975Santarém, ParáS: HQ830445
PA13AR 2718151975Santarém, ParáS: AF164533
PA14H 355173Human1978Ananindeua, ParáS: HM470114; M: HQ830381; L: HQ830416
PA15H 355186Human1978Tomé-Açu, ParáS: HQ830446
PA16H 356898Human1978Belém, ParáS: HQ830447
PA17AR 366927Culicoides paraensis mosquitoes1979Belém, ParáS: HQ830448; M: HQ830382; L: HQ830417
PA18H 366781Human1979Belém, ParáS: HQ830449
PA19H 381114Human1980Belém, ParáS: AF164435
PA20H 384192Human1980Portel, ParáS: HQ830450
PA21H 384193Human1980Portel, ParáS: HQ830451
PA22H 385591Human1980Belém, ParáS: HQ830452; M: HQ830383; L: HQ830418
AM01H 389865Human1980Manaus, AmazonasS: HQ830453; M: HQ830384; L: HQ830419
AM02H 390233Human1980Manaus, AmazonasS: AF154536
AM03H 390242Human1980Manaus, AmazonasS: HQ830454; M: HQ830385; L: HQ830420
MA01AR 4733581988Porto Franco, MaranhãoS: AF164539
MA02H 472433Human1988Porto Franco, MaranhãoS: HQ830455; M: HQ830386; L: HQ830421
MA03H 472435Human1988Porto Franco, MaranhãoS: HQ830456; M: HQ830387; L: HQ830422
MA04H 472200Human1988Porto Franco, MaranhãoS: AF154537
MA05H 472204Human1988Porto Franco, MaranhãoS: AF164538
PA23H 475248Human1988Tucurui, ParáS: AF164540
PN01GML 444477Human1989Chame, PanamaS: AF164555
PN02GML 444911Human1989Chame, PanamaS: AF164556
PN03GML 445252Human1989San Miguelito, PanamaS: AF164557
PN04GML 450093Human1989Chilibre, PanamaS: AF164558
RO01H 498913Human1990Machadinho D'Oeste, RondôniaS: HQ830457; M: HQ830388; L: HQ830423
RO02H 505442Human1991Ouro Preto D'Oeste, RondôniaS: AF164542
RO03H 505663Human1991Ariquemes, RondôniaS: AF164543
RO04H 505764Human1991Ariquemes, RondôniaS: HQ830458
RO05H 505768Human1991Ariquemes, RondôniaS: HQ830459; M: HQ830389; L: HQ830424
RO06H 505805Human1991Ariquemes, RondôniaS: HQ830460
PA24H 504514Human1991Santa Izabel, ParáAF164541
PE01IQT 16901992Iquitos, PeruAF164549
MA06H 521086Human1993Barra do Corda, MaranhãoS:AY704559; M: HQ830390; L: HQ830425
PE02MD O 23Human1993Madre de Dios, PeruS: AF164550
PE03DE I209Human1993Iquito, PeruS: AF164551
PA25H 532314Human1994Serra Pelada, ParáS: HQ830461; M: HQ830391; L: HQ830426
PA26H 532422Human1994Serra Pelada, ParáS: HQ830462; M: HQ830392; L: HQ830427
PA27H 532490Human1994Serra Pelada, ParáS: HQ830463; M: HQ830393; L: HQ830428
PA28H 532500Human1994Serra Pelada, ParáS: HQ830464; M: HQ830394; L: HQ830429
PA29H 541140Human1994Altamira, ParáS: HM470126; M: HQ830395; L: HQ830430
PA30H 541863Human1996Vitória do Xingu, ParáS: AF164544
PA31H 544552Human1996Altamira, ParáS: AF164546
PA32H 543033Human1996Oriximiná, ParáS: AF164545
AC01H 543091Human1996Xapuri, AcreS: HQ830465
AC02H 543100Human1996Xapuri, AcreS: HQ830466; M: HQ830396; L: HQ830431
AC03H 543087Human1996Xapuri, AcreS: AF164547
PA33H 543618Human1996Oriximina, ParáS: AF164548
PA34H 543629Human1996Oriximina, ParáS: HQ830467; M: HQ830397; L: HQ830432
PA35H 543638Human1996Oriximina, ParáS: HQ830468
PA36H 543639Human1996Oriximina, ParáS: HQ830469
PA37H 543733Human1996Oriximina, ParáS: AY704560
PA38H 543760Human1996Oriximina, ParáS: HQ830470; M: HQ830398; L: HQ830433
PA39H 543857Human1996Oriximina, ParáS: HQ830471; M: HQ830399; L: HQ830434
PA40H 543880Human1996Oriximina, ParáS: HQ830472
PE04IQT 40831997Iquitos, PeruS: AF164552
PE05IQT 1–8121998Iquitos, PeruS: AF164553
PE06IQT 70851998Iquitos, PeruS: AF164554
MG01AN 622998Callitrhix sp.monkeys2000Arinos, Minas GeraisS: AY117135; M: HQ830401; L: HQ830436
TO01H 622544Human2002Paranã, TocantinsS: EF467368
PA41H 669314Human2003Parauapebas, ParáS: EF467370; M: HQ830400; L: HQ830435
PA42H 669315Human2003Parauapebas, ParáS: EF467369; M: HQ830402; L: HQ830437
PA43H 682426Human2004Porto de Moz, ParáS: EF467371; M: HQ830403; L: HQ830438
PA44H 682431Human2004Porto de Moz, ParáS: EF467372; M: HQ830404; L: HQ830439
PA45H 706890Human2006Igarapé Açu, ParáS: HQ830473
PA46H 706893Human2006Igarapé Açu, ParáS: HQ830474
PA47H 708139Human2006Magalhães Barata, ParáS: HQ830475; M: HQ830405; L: HQ830440
PA48H 707157Human2006Maracanã, ParáS: HQ830476
PA49H 707287Human2006Magalhães Barata, ParáS: HM470137; M: HQ830406; L: HQ830441
PA50H 708717Human2006Maracanã, ParáS: HQ830477; M: HQ830407; L: HQ830442
AP01H 758687Human2009Mazagão, AmapáS: HQ830478
AP02H 758669Human2009Mazagão, AmapáS: HQ830479
AP03H 759525Human2009Mazagão, AmapáS: HQ830480
AP04H759541Human2009Mazagão, AmapáS: HQ830481
AP05H 759531Human2009Mazagão, AmapáS: HQ830482
AP06H 759558Human2009Mazagão, AmapáS: HQ830483
AP07H 759038Human2009Mazagão, AmapáS: HQ830484
AP08H 759562Human2009Mazagão, AmapáS: HQ830485
AP09H 759018Human2009Mazagão, AmapáS: HQ830486
AP10H 759023Human2009Mazagão, AmapáS: HQ830487
AP11H 759041Human2009Mazagão, AmapáS: HQ830488
AP12H 759042Human2009Mazagão, AmapáS: HQ830489
AP13H 759043Human2009Mazagão, AmapáS: HQ830490
AP14H 759044Human2009Mazagão, AmapáS: HQ830491
AP15H 759483Human2009Mazagão, AmapáS: HQ830492

*TRVL, Trinidad Virus Laboratory; S, small RNA; AR: arthropod; M, medium RNA; L, large RNA; H: human; An: animal; GML, Gorgas Memorial Laboratory; IQT, Iquitos; MD, Madre de Dios; DE, OROV strain from Iquitos.
†All locations in Brazil except as indicated.

Virus Culture and RNA Extraction

Viruses were propagated in monolayer cultures of Vero cells. After 75% of cells showed cytopathic effects, the supernatants of infected cell cultures were collected. RNA extraction was conducted by using a commercial kit (QIAmp Viral RNA Mini Kit; QIAGEN, Valencia, CA, USA) according to the manufacturer’s instructions.

Reverse Transcription–PCR and Nucleotide Sequencing

For the synthesis and amplification of the OROV small RNA, medium RNA, and large RNA cDNA (cDNA), a 1-step reverse transcription–PCR (RT-PCR) was conducted by using a combination of specific-segment sets of the following primers: small RNA (NORO5: AAAGAGGATCCAATAATGTCAGAGTTCATTT; ORO N3: GTGAATTCCACTATATGCCAATTCCGAATT), medium RNA (Gn15S: GGCAACAAACAGTGACAAT and Gn659R: CTATGTTAACGCACATTGCT), and large RNA (LOROF: CCGAAACAAACAAAAACAAT; and large RNA (LOROF: CCGAAACAAACAAAAACAAT and LOROR: GGATGAGTAAGCAATTCTGG) (). Amplicon lengths were expected to be 693 bp, 644 bp, and 634 bp for small RNA, medium RNA, and large RNA, respectively. The RT-PCR products were visualized onto 1.2% agarose gel stained with ethidium bromide (0.5 μg/mL). Amplicons were sequenced by using the same primers applied for the RT-PCR cycling and the ABI PRISM Dye Terminator Kit (Applied Biosystems, Foster City, CA, USA) by using the dideoxyribonucleotide chain terminator method (). The ABI 3130 capillary automated sequencer (Applied Biosystems) was used to obtain the sequence. Both cDNA strands were sequenced from at least 3 RT-PCR products.

Sequence Analysis and Phylogeny

Sequences obtained for the N (complete), Gn, and large (partial) genes were first inspected in quality by the SeqMan LaserGene package (DNA STAR, Madison, WI, USA) and then used for multiple sequencing alignments with other OROV sequences available in GenBank (www.ncbi.nlm.nih.gov/genbank). The genetic divergence for each gene was determined by using MEGA4 software () based on the dataset generated by the alignments. Confidence interval for inclusion into a given phylogenetic group was estimated according to the mean of genetic divergence calculated for the known OROV genotypes (I, II, and III) and used as a criterion for searching other genotype groups. The phylogenetic analysis was performed by comparing the 66 entire N genes and 36 partial Gn genes and large sequences of Brazilian OROV strains, respectively, with homologous sequences obtained from other OROVs isolated from different regions of Central and South America, periods of time, and source of isolation (Table 1). Phylogenetic trees were constructed by using the neighbor-joining (), maximum-likelihood, and maximum-parsimony methods in the PAUP 4.0 software () as described (). Bayesian and time-scaled (chronologic) analyses also were conducted as described by Rodrigues et al. (). Sequences obtained from the OROV isolates were deposited in GenBank (Table, GenBank accession numbers of previously sequenced OROV and other Simbu group virus strains; Table A1).
Table 1

Percentage of genetic divergence between Oropouche virus phylogenetic groups on the basis of the complete N (small RNA) and partial Gn (medium RNA) and L (large RNA) gene sequences, Brazil*

Gene and group
Divergence among genotypes, %Mean of genetic divergence intergroup
I
II
III
IV
N gene
I
II3.0 (2.0)
III4.4 (3.1)3.0 (2.0)
IV5.3 (3.6)5.3 (3.6)6.8 (3.9)
IV in relation to I, II, and III5.8 (4.0)
I, II, and III3.5 (2.3)
I, II, III, and IV




4.6 (3.4)
Gn gene
I
II4.5
III7.25.6 (3.8)
III in relation to I and II




5.7 (3.8)
L gene
I
II0.8 (0)
II in relation to I0.5 (0)

*Percentages within parenthesis are the amino acid sequence divergences among Oropouche virus strains.

*Percentages within parenthesis are the amino acid sequence divergences among Oropouche virus strains.

Evaluation of RNA Segment Topologies

To evaluate the topologies presented by the different RNA segments, we used 36 OROV strains for which all 3 segments were sequenced. The evaluation was performed by using the Kishino-Hasegawa method (), comparing a topology generated for a given RNA segment with the other segments. We considered p values <0.01 significant.

Results

Genetic Variability of OROV

The nucleotide sequences obtained for the studied strains were 693 nt (231 aa), 644 nt (214 aa), and 634 nt (211 aa) in length for N, Gn, and large genes, respectively. The multiple sequencing analysis of the new 66 full-length OROV N (small RNA) and for the 36 partial Gn (medium RNA) and large RNA gene sequences showed high nucleotide and amino acid identities (>90%). The mean of genetic divergence among the N gene nucleotide sequence was ≈6.8%. Genetic distances (nucleotide sequence) within the 3 well-established genotypes (I, II, and III) ranged from 3% between genotypes I and II to 4.4% between genotypes I and III (mean 3.5%) and were used as a confidence value for inclusion within a given genotype. On the basis of this criterion, a fourth group was established, and a genetic divergence ranging from 5.3% with genotype I to 6.8% with genotype III (mean 5.8%) was determined. The mean of genetic divergence among the 4 OROV lineages was 4.6% (Table 1). Regarding the Gn gene nucleotide sequences, the analysis showed values of genetic divergence of 0.9%–9.5% (mean 6.5%). In contrast to the N gene sequences, for the Gn gene partial sequences, 3 lineages were identified, showing an intergroup divergence of 4.5% (between groups I and II) to 7.2% (between groups I and III) (mean 5.7%), which was used as a confidence value for group inclusion or exclusion (Table 1). For the polymerase gene nucleotide sequences (large RNA), genetic divergence was 0.1%–0.8% (mean 0.5%). Only 2 large RNA segments were distinguished into groups (Table 1).

Phylogeny and Time-scaled Analysis

Regardless of the method used, the trees were similar in topology, showing high support values (bootstrap, likelihood, or posterior probability values). The Bayesian method showed high support values (>0.90) and was therefore used to represent the final tree. As previously reported (–), the comparative phylogeny that used the entire N gene sequences (96 strains; Table A1) confirmed the monophyletic origin of OROV in comparison with other Simbu group viruses (Figure 1),
Figure 1

Phylogenetic analysis between Oropouche virus (OROV) (N gene: 693 nt) and homologue sequences of different viruses that belong to the Simbu group. AINOV, Aino virus; AKAV, Akabane virus; TINV, Tinaroo virus; BUTV, Buttonwillow virus; FPV, Facey’s Paddock virus; MERV, Mermet virus; INGV, Ingwavuma virus. The numbers above each main node correspond to bootstrap values for phylogenetic groups. Scale bar indicates 10% genetic divergence.

Phylogenetic analysis between Oropouche virus (OROV) (N gene: 693 nt) and homologue sequences of different viruses that belong to the Simbu group. AINOV, Aino virus; AKAV, Akabane virus; TINV, Tinaroo virus; BUTV, Buttonwillow virus; FPV, Facey’s Paddock virus; MERV, Mermet virus; INGV, Ingwavuma virus. The numbers above each main node correspond to bootstrap values for phylogenetic groups. Scale bar indicates 10% genetic divergence. The 4 major phylogenetic groups depicted (I–IV) corresponded to 4 distinct genotypes (Figure 2 [Bayesian method]). Genotype I included the Brazilian strains isolated in the states of Acre, Amazonas, Maranhão, Tocantins, and Pará, as well as strains from Trinidad and Tobago. Three subgenotypes were described: Ia, Ib, and Ic (Figure 1). Genotype II grouped strains obtained during outbreaks in the states of Amapá, Pará, and Rondônia in Brazil and the strains from Peru. Three subgenotypes also were assigned to this group (II a, II b, and II c). Genotype III was formed by strains isolated in the Brazilian states of Acre, Minas Gerais, and Rondônia, and the isolates from Panama showing 2 distinct sublineages: the subgenotypes II a and III b. Finally, genotype IV included the Brazilian strains isolated in Amazonas State, Brazil (Figure 2).
Figure 2

Phylogenetic tree based on the complete nucleotide (nt) sequence of the N gene (693 nt) of 96 Oropouche virus (OROV) strains isolated from different hosts, locations, and periods. The main phylogenetic groups are represented by genotypes I (red), II (dark blue), III (green), and IV (light blue). The values above the main nodes represent the dates of emergence of common ancestors, expressed in years before 2009. The arrows indicate the probable date of emergence of genotypes I, II, III, and IV. Numbers in parentheses are value for 95% highest probability density. Scale bar indicates time scale of molecular dating. MRCA, most recent common ancestor.

Phylogenetic tree based on the complete nucleotide (nt) sequence of the N gene (693 nt) of 96 Oropouche virus (OROV) strains isolated from different hosts, locations, and periods. The main phylogenetic groups are represented by genotypes I (red), II (dark blue), III (green), and IV (light blue). The values above the main nodes represent the dates of emergence of common ancestors, expressed in years before 2009. The arrows indicate the probable date of emergence of genotypes I, II, III, and IV. Numbers in parentheses are value for 95% highest probability density. Scale bar indicates time scale of molecular dating. MRCA, most recent common ancestor. Chronologic analysis was used to investigate the emergence period of OROV in the Americas. The nucleotide substitution rate that determined the 96 OROV N gene sequences was 3.7 × 10–4 substitutions per site per year and was used to estimate the divergence dates among the strains. The emergence of the most recent common ancestor (MRCA) for OROV in the Americas was estimated to have occurred ≈223 years ago (95% highest probability density [HPD] 148–342 years) from the location where the other parental viruses for the different genotypes (I, II, III, and IV) emerged (Figure 2). The estimated emergence dates suggest that genotype I was the first genotype that emerged ≈112 years ago (95% HPD 95–189 years). Genotype II emerged ≈91 years ago (95% HPD 59–144 years) and originated from strains isolated in the states of Pará and Rondônia, and strains recently isolated in Amapá State, in 2009. Genotype III was estimated to have originated 37 years ago (95% HPD 33–70 years) and probably evolved in Rondônia State 33 years ago (95% HPD 29–58 years), and other Amazonian states, such as Acre and Pará, emerging almost simultaneously in Panama 32 years ago (95% HPD 22–45 years) and, more recently, in Minas Gerais State. Genotype IV emerged in Amazonas State ≈43 years ago (95% HPD 31–56 years; Figure 2). Trees generated from entire N and partial Gn and large gene sequences obtained for 36 OROV strains demonstrated different topologies. By using all phylogenetic methods, we found differences in virus clustering. For the small RNA, 4 distinct groups were identified: group I (20 strains), group II (9 strains), group III (5 strains), and group IV (2 strains). For the medium RNA, 3 groups were assigned and distributed as follows: group I (28 strains), group II (4 strains), and group III (4 strains). The large RNA depicted only 2 major groups, including 32 strains in group I and 4 strains in group II (Figure 3). Maximum likelihood was used to analyze these competing small, medium, and large segment topologies by using the Kishino-Hasegawa test. Sequence evolution models were optimized by applying all genome segments and using the competing topologies. Regardless of which model was selected, each topology generated by using maximum parsimony and neighbor-joining methods with a given genome segment was significantly more likely than the competing topology generated by using the other genome segment (likelihood probability between S and M topologies = 0.00005623; likelihood probability between S and L topologies = 0.000354664; likelihood probability between M and L topologies = 0.00043154; p<0.001).
Figure 3

Phylogenetic analysis of 36 Oropouche virus strains: A) N gene (693 nt), B) Gn gene (644 nt), and C) large (L) gene (634 nt), showing different topologies. Bootstrap values obtained by using maximum parsimony and neighbor-joining methods are placed over each main node of the tree corresponding to the phylogenetic groupings. The arrow indicates the exact position of the bootstrap value in the tree. Scale bars indicate 10% nt divergence.

Phylogenetic analysis of 36 Oropouche virus strains: A) N gene (693 nt), B) Gn gene (644 nt), and C) large (L) gene (634 nt), showing different topologies. Bootstrap values obtained by using maximum parsimony and neighbor-joining methods are placed over each main node of the tree corresponding to the phylogenetic groupings. The arrow indicates the exact position of the bootstrap value in the tree. Scale bars indicate 10% nt divergence.

Geographic Dispersion of OROV Genotypes

On the basis of results obtained for the N gene data by time-scaled analysis (evolutionary rate and emergence date) and epidemiologic data association (date and place of isolation), the possible dispersal event could be predicted for the distinct OROV genotypes in the Americas (Figure 4). Genotype I (dispersion route in red), originally isolated in Brazil in the municipality of Ipixuna, Pará State (BR 010 Highway, km 94), possibly dispersed continuously toward distinct directions: initially to several municipalities in western Pará, and simultaneously in Trinidad and Tobago. Later, genotype I moved toward the states of Amazonas and Acre and, more recently, to the eastern Amazon region including Pará, Maranhão, and Tocantins States. Genotype II (dispersion route in dark blue), apparently emerged simultaneously in the states of Amapá, Pará, and Rondônia, as well as in Peru, and dispersed in these places, emerging in the municipality of Mazagão, Amapá State, in 2009. Genotype III (dispersion route in green), emerged in Rondônia State, moving toward Panama and the states of Acre and Maranhão. From Maranhão, a new route led genotype III to the Minas Gerais State. Genotype IV (black dot in Manaus), apparently more ancient than genotype III, emerged in the city of Manaus, Amazonas State, and it has not apparently dispersed from there (Figure 4).
Figure 4

Geographic dispersion of Oropouche virus (OROV) genotypes in South America during 1955–2009 based on data from the N gene. Yellow shading, coverage area of OROV in Brazil; red line, dispersion route for genotype I; blue line, dispersion route for genotype II; green line, dispersion route for genotype III; black dot, genotype IV. AC, Acre; AP, Amapá; AM, Amazonas; MA, Maranhão; MG, Minas Gerais; PA, Pará; RO, Rondônia, TO, Tocantins.

Geographic dispersion of Oropouche virus (OROV) genotypes in South America during 1955–2009 based on data from the N gene. Yellow shading, coverage area of OROV in Brazil; red line, dispersion route for genotype I; blue line, dispersion route for genotype II; green line, dispersion route for genotype III; black dot, genotype IV. AC, Acre; AP, Amapá; AM, Amazonas; MA, Maranhão; MG, Minas Gerais; PA, Pará; RO, Rondônia, TO, Tocantins.

Discussion

The molecular epidemiology of OROV has been extensively studied on the basis of genetic data generated for the small RNA segment, and the data have provided information about the genetic diversity of OROV and geographic distribution in countries in which the virus is endemic, such as Brazil, Peru, and Trinidad and Tobago (–,). The analysis of additional 66 gene sequences of the entire N and partial Gn and Gc provided a better understanding of the molecular epidemiology of OROV in Brazil. In our analysis, distinct phylogenetic groups were observed when the different RNA segments were analyzed. In case of the small RNA, 4 major groups were found, including the 3 genotypes previously described (–,). Although a fourth genetic lineage has been well established by the small RNA phylogeny (strains AM 01 and AM 03), the topologies depicted by the medium RNA and large RNA sequences did not support this result. Maximum likelihood analyses were used to test these competing small, medium, and large segment topologies by using the Kishino-Hasegawa test. Evolution models were optimized for all 3 genome segment sequences and by using the competing topologies. Regardless of which model was selected, each topology generated by using maximum parsimony and neighbor-joining methods with a given RNA segment was significantly more likely than the competing topology generated by the other genome segment (p<0.001) (Figure 3). These results ensured that the testing topologies obtained for each RNA segment differed significantly, which suggests that each OROV RNA segment had a different evolutionary history and probably contributes to the genetic variability of the virus. The assessment of additional genetic data for the small RNA segment contributed substantially to the understanding of the emergence of the virus, geographic distribution, and dispersal events. On the basis of chronologic dating of the N gene, epidemiologic data, and lineage definition (genotypes I–IV), we were able to elucidate the possible origin of OROV in the Americas (Figure 2, Figure 4). In contrast to information about the event in Trinidad and Tobago in 1955 that was associated with the first description of the Oropouche fever case, molecular data provided by the small RNA sequences indicated that OROV emerged in South America, more precisely in Pará State (strains PA 01–PA 05) in northern Brazil, ≈89 years ago, and then in Trinidad and Tobago probably through humans carrying the virus during the viremic phase or through illegal shipment of wild animals, as has been suggested for yellow fever virus (). The dispersal history of OROV strains is initially associated with genotype I, more precisely with the subgenotype Ia, isolated from wild animals and humans during epidemics in Pará State, during the 1960s–1970s. Their dispersion routes were simultaneously west to east in the Amazon toward Acre State (subgenotype Ib) from 1988 to 1994 and, more recently, in a vast area in Pará State and in Manaus, Amazonas State, at the end of the 1990s and the beginning of the 2000s. Regarding genotype II, the most probable origins were in eastern Pará (Porto de Moz) toward Iquitos, Peru (subgenotype IIb), and from Iquitos toward Ariquemes, Rondônia State (subgenotype IIc), where the virus probably then dispersed to Madre de Dios in Peru and to Pará State. The origin of subgenotype IIa, which is represented by the strains recently associated with the epidemic in Mazagão, Amapá State, in the beginning of 2009 (P.F.C. Vasconcelos et al., pers. comm.) is probably related to a common ancestor that evolved independently from other subgenotypes (IIb and IIc) over time and probably emerged in the Amazon ≈24 years ago. The existence of genetic data for a single genotype III Brazilian strain isolated in Minas Gerais State, southeastern Brazil (), limited our ability to study its origin and evolutionary aspects. With the identification of other genotype III strains in Brazil, isolated in the states of Rondônia (Ariquemes and Machadinho d’Oeste), Acre (Xapuri), and Maranhão (Porto Franco), we were able to make inferences about the most possible dispersion route. In fact, it constitutes a complex dynamics of evolutionary origin between subgenotypes IIIa (predominantly from Brazil) and IIIb (predominantly from Panama). In this context, genotype III probably originated from the sublineage IIIa, which was isolated in Ariquemes, Rondônia State, from which the sublineage IIIb ancestor has segregated independently, leading to the emergence of strains in Chame and San Miguelito, Panama. In a more detailed view, the subgenotype IIIa found in Ariquemes, Rondônia State, had its initial dispersion to a neighboring municipality (Machadinho d’Oeste), subsequently to Porto Franco in Maranhão State, and finally to Arinos, Minas Gerais State. Although Minas Gerais State is geographically distant from the official OROV-endemic area, the virus may have been introduced through Maranhão State by the intense traffic of humans from Maranhão to other states and regions in Brazil. In Minas Gerais, OROV has been maintained in silent cycles, probably because of inadequate epidemiologic conditions, such as the high density of Culicoides paraensis mosquitoes in urban areas, a limiting factor for an epidemic cycle deflagration. Furthermore, the sporadic detection of OROV was recently reported in Acre State (); these reports confirmed that the virus actually circulates silently in the Brazilian Amazon, as suggested by Azevedo et al. (), and can be transported by viremic patients and human carriers of subclinical illness from region to region within the country. This approach should result in stronger data when new isolates are sequenced in other OROV-endemic countries because limited information about dispersal of OROV in Peru, Panama, and Trinidad and Tobago does not infer a more robust analysis. In conclusion, even with the limited data obtained in this study from other OROV-endemic countries, we were able to reach a more complete understanding of the molecular epidemiology of the virus, and we provided evidence of which distinct genes (N, Gn/Gc, and L) are under different selective evolutionary pressures in nature. We also observed the great genetic diversity of OROV, the description of a new genotype IV, the complex dynamics of evolution, and viral dispersal. Finally, our findings suggest the necessity of obtaining genetic data regarding full-length sequencing of different OROV strains (medium and large segments) to elucidate the correct genotype classification and to improve the molecular diagnostics of this human pathogen in Latin America.
  13 in total

1.  Likelihood-based tests of topologies in phylogenetics.

Authors:  N Goldman; J P Anderson; A G Rodrigo
Journal:  Syst Biol       Date:  2000-12       Impact factor: 15.683

2.  MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0.

Authors:  Koichiro Tamura; Joel Dudley; Masatoshi Nei; Sudhir Kumar
Journal:  Mol Biol Evol       Date:  2007-05-07       Impact factor: 16.240

3.  Molecular epidemiology of Saint Louis encephalitis virus in the Brazilian Amazon: genetic divergence and dispersal.

Authors:  Sueli G Rodrigues; Márcio R T Nunes; Samir M M Casseb; Assis S C Prazeres; Daniela S G Rodrigues; Mayra O Silva; Ana C R Cruz; José C Tavares-Neto; Pedro F C Vasconcelos
Journal:  J Gen Virol       Date:  2010-06-30       Impact factor: 3.891

4.  The neighbor-joining method: a new method for reconstructing phylogenetic trees.

Authors:  N Saitou; M Nei
Journal:  Mol Biol Evol       Date:  1987-07       Impact factor: 16.240

5.  Oropouche virus. I. A review of clinical, epidemiological, and ecological findings.

Authors:  F P Pinheiro; A P Travassos da Rosa; J F Travassos da Rosa; R Ishak; R B Freitas; M L Gomes; J W LeDuc; O F Oliva
Journal:  Am J Trop Med Hyg       Date:  1981-01       Impact factor: 2.345

6.  Nucleotide sequences and phylogeny of the nucleocapsid gene of Oropouche virus.

Authors:  M F Saeed; H Wang; M Nunes; P F Vasconcelos; S C Weaver; R E Shope; D M Watts; R B Tesh; A D Barrett
Journal:  J Gen Virol       Date:  2000-03       Impact factor: 3.891

7.  DNA sequencing with chain-terminating inhibitors.

Authors:  F Sanger; S Nicklen; A R Coulson
Journal:  Proc Natl Acad Sci U S A       Date:  1977-12       Impact factor: 11.205

8.  Genetic divergence and dispersal of yellow fever virus, Brazil.

Authors:  Pedro F C Vasconcelos; Juliet E Bryant; Travassos P A da Rosa; Robert B Tesh; Sueli G Rodrigues; Alan D T Barrett
Journal:  Emerg Infect Dis       Date:  2004-09       Impact factor: 6.883

9.  Oropouche virus isolation, southeast Brazil.

Authors:  Márcio Roberto Teixeira Nunes; Lívia Carício Martins; Sueli Guerreiro Rodrigues; Jannifer Oliveira Chiang; Raimunda do Socorro da Silva Azevedo; Amelia P A Travassos da Rosa; Pedro Fernando da Costa Vasconcelos
Journal:  Emerg Infect Dis       Date:  2005-10       Impact factor: 6.883

10.  Reemergence of Oropouche fever, northern Brazil.

Authors:  Raimundado Socorro da Silva Azevedo; Márcio Roberto Teixeira Nunes; Jannifer Oliveira Chiang; Gilberta Bensabath; Helena Baldez Vasconcelos; Ana Yecê das Neves Pinto; Lívia Carício Martins; Hamilton Antônio de Oliveira Monteiro; Sueli Guerreiro Rodrigues; Pedro Fernando da Costa Vasconcelos
Journal:  Emerg Infect Dis       Date:  2007-06       Impact factor: 6.883

View more
  24 in total

1.  Interferon-Regulatory Factor 5-Dependent Signaling Restricts Orthobunyavirus Dissemination to the Central Nervous System.

Authors:  Jose Luiz Proenca-Modena; Jennifer L Hyde; Renata Sesti-Costa; Tiffany Lucas; Amelia K Pinto; Justin M Richner; Matthew J Gorman; Helen M Lazear; Michael S Diamond
Journal:  J Virol       Date:  2015-10-14       Impact factor: 5.103

2.  Molecular Characterization and Seroprevalence in Pigs of SC0806, a Cat Que Virus Isolated from Mosquitoes in Sichuan Province, China.

Authors:  Jiake Zhang; Jinglin Wang; Lihua Wang; Shihong Fu; Minghua Li; Guoyan Zhao; Wuyang Zhu; David Wang; Guodong Liang
Journal:  Vector Borne Zoonotic Dis       Date:  2015-07       Impact factor: 2.133

3.  Oropouche virus infection and pathogenesis are restricted by MAVS, IRF-3, IRF-7, and type I interferon signaling pathways in nonmyeloid cells.

Authors:  Jose Luiz Proenca-Modena; Renata Sesti-Costa; Amelia K Pinto; Justin M Richner; Helen M Lazear; Tiffany Lucas; Jennifer L Hyde; Michael S Diamond
Journal:  J Virol       Date:  2015-02-25       Impact factor: 5.103

Review 4.  Presence and Multi-Species Spatial Distribution of Oropouche Virus in Brazil within the One Health Framework.

Authors:  Sofia Sciancalepore; Maria Cristina Schneider; Jisoo Kim; Deise I Galan; Ana Riviere-Cinnamond
Journal:  Trop Med Infect Dis       Date:  2022-06-20

5.  Isolation of Madre de Dios Virus (Orthobunyavirus; Bunyaviridae), an Oropouche Virus Species Reassortant, from a Monkey in Venezuela.

Authors:  Juan-Carlos Navarro; Dileyvic Giambalvo; Rosa Hernandez; Albert J Auguste; Robert B Tesh; Scott C Weaver; Humberto Montañez; Jonathan Liria; Anderson Lima; Jorge Fernando Soares Travassos da Rosa; Sandro P da Silva; Janaina M Vasconcelos; Rodrigo Oliveira; João L S G Vianez; Marcio R T Nunes
Journal:  Am J Trop Med Hyg       Date:  2016-05-23       Impact factor: 2.345

6.  Examining the potential for South American arboviruses to spread beyond the New World.

Authors:  Víctor Hugo Peña-García; Michael K McCracken; Rebecca C Christofferson
Journal:  Curr Clin Microbiol Rep       Date:  2017-10-19

7.  Genetic analysis of members of the species Oropouche virus and identification of a novel M segment sequence.

Authors:  Natasha L Tilston-Lunel; Joseph Hughes; Gustavo Olszanski Acrani; Daisy E A da Silva; Raimunda S S Azevedo; Sueli G Rodrigues; Pedro F C Vasconcelos; Marcio R T Nunes; Richard M Elliott
Journal:  J Gen Virol       Date:  2015-03-03       Impact factor: 3.891

8.  Genomic characterization of group C Orthobunyavirus reference strains and recent South American clinical isolates.

Authors:  Jun Hang; Brett M Forshey; Yu Yang; Víctor Fiestas Solórzano; Robert A Kuschner; Eric S Halsey; Richard G Jarman; Tadeusz J Kochel
Journal:  PLoS One       Date:  2014-03-14       Impact factor: 3.240

9.  Orthobunyavirus ultrastructure and the curious tripodal glycoprotein spike.

Authors:  Thomas A Bowden; David Bitto; Angela McLees; Christelle Yeromonahos; Richard M Elliott; Juha T Huiskonen
Journal:  PLoS Pathog       Date:  2013-05-16       Impact factor: 6.823

10.  Distribution of mosquitoes in the south east of Argentina and first report on the analysis based on 18S rDNA and COI sequences.

Authors:  Leonardo M Díaz-Nieto; Arnaldo Maciá; Gustavo Parisi; Juan L Farina; María E Vidal-Domínguez; M Alejandra Perotti; Corina M Berón
Journal:  PLoS One       Date:  2013-09-30       Impact factor: 3.240

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.