Literature DB >> 21484159

Microarray analysis revealed different gene expression patterns in HepG2 cells treated with low and high concentrations of the extracts of Anacardium occidentale shoots.

Shaghayegh Khaleghi1, Azlina Abdul Aziz, Nurhanani Razali, Sarni Mat Junit.   

Abstract

In this study, the effects of low and high concentrations of the Anacardium occidentale shoot extracts on gene expression in liver HepG2 cells were investigated. From MTT assays, the concentration of the shoot extracts that maintained 50% cell viability (IC(50)) was 1.7 mg/ml. Cell viability was kept above 90% at both 0.4 mg/ml and 0.6 mg/ml of the extracts. The three concentrations were subsequently used for the gene expression analysis using Affymetrix Human Genome 1.0 S.T arrays. The microarray data were validated using real-time qRT-PCR. A total of 246, 696 and 4503 genes were significantly regulated (P < 0.01) by at least 1.5-fold in response to 0.4, 0.6 and 1.7 mg/ml of the extracts, respectively. Mutually regulated genes in response to the three concentrations included CDKN3, LOC100289612, DHFR, VRK1, CDC6, AURKB and GABRE. Genes like CYP24A1, BRCA1, AURKA, CDC2, CDK2, CDK4 and INSR were significantly regulated at 0.6 mg/ml and 1.7 mg but not at 0.4 mg/ml. However, the expression of genes including LGR5, IGFBP3, RB1, IDE, LDLR, MTTP, APOB, MTIX, SOD2 and SOD3 were exclusively regulated at the IC(50) concentration. In conclusion, low concentrations of the extracts were able to significantly regulate a sizable number of genes. The type of genes that were expressed was highly dependent on the concentration of the extracts used.

Entities:  

Year:  2011        PMID: 21484159      PMCID: PMC3197841          DOI: 10.1007/s12263-011-0216-z

Source DB:  PubMed          Journal:  Genes Nutr        ISSN: 1555-8932            Impact factor:   5.523


Introduction

The cashew plant or Anacardium occidentale L (A. occidentale) has many medicinal properties that are beneficial to health. Various scientific evidences have linked the various parts of cashew plant to several biological activities. The stem bark extract had been shown to have anti-bacterial [1], anti-viral [22], anti-diabetic [32] and anti-inflammatory [29] activities. Anti-tumour activity was detected in the cashew gum [30] and nut [42] while anti-ulcerogenic was reported in the cashew leaf extracts [19]. Antioxidant activities were also detected in the nut skin extracts [16]. In addition to the medicinal properties, the fruit of the A. occidentale is a natural whitening agent that disrupts pigmentation through the inhibition of tyrosinase [21]. In Malaysia, the young leaves or shoots of the A. occidentale are widely consumed as salads, and the locals believed its benefits include diabetic control and prevention. The extracts of the shoots were found to have potent antioxidant activities [35], were able to inhibit the oxidation of LDL and up-regulated LDL receptor activity in cultured HepG2 cells [39]. The antioxidant activities observed in the A. occidentale shoot extracts were attributed to the reported presence of phenolic compounds such as myricetin and quercetin [19, 27]. Intact quercetin glycosides, the most common flavonoids found in human diets, were shown to be absorbed at the small intestine probably through a sodium-dependent glucose transport pathway [9, 14]. Once absorbed, quercetin circulates in the plasma in conjugated forms but its antioxidant properties were maintained [25]. Other active compounds found in the crude extracts of the A. occidentale leaves include catechin, epicatechin, tetramer of proanthocyanidin and biflavanoids amentoflavone [19] and agathisflavone [20]. Agathisflavone was reported to be able to induce apoptosis in Jurkat cells (acute lymphoblastic leukaemia cell line) [20] as well as a potent, competitive inhibitor for the GABAA/benzodiazepine receptor [43]. Scientific molecular studies on the effects of the A. occidentale shoot extracts on cells are still lacking despite its reported antioxidant properties and its use in traditional medicine. We had earlier reported that the methanol extracts of the A. occidentale contained the highest total phenolic content compared to ethyl acetate and hexane extracts [35]. In this study, we explored the effects of the methanol extracts of the A. occidentale shoots on the expression of genes which could be associated with its antioxidant and medicinal properties.

Materials and methods

Chemicals

All reagents and chemicals used in the experiments were of analytical grade and obtained mostly from Sigma–Aldrich. Solvents used for extraction of plants were purchased from Fisher Scientific. Water used was of Millipore quality (ELGA Purelab Ultra Genetic system).

Preparation of methanol extract of the shoots of Anacardium Occidentale

In our previous study [35], we reported that the methanol extract of the A. Occidentale shoots possessed significantly higher antioxidant activities compared to those of the ethyl acetate and hexane extracts. The methanol extracts was subsequently used in this study. Briefly, the shoots were washed, air-dried followed by complete drying in an oven at 40°C. The dried shoots were then ground to powder and then extracted with methanol with a mass to volume ratio of 1:20 (g/mL), at room temperature for 24 h. The resulting extract was filtered and roto-evaporated (Rotavapor R-215) to dryness at 37°C, and the residues were then redissolved in dimethylsulfoxide (DMSO). For the subsequent cell culture experiments, the final concentration of DMSO was kept below 1% to avoid toxicity to the cells.

High-performance liquid chromatography

Acid hydrolyses was conducted on the dried powder of A. occidentale [3]. Samples (20 mg) were mixed with 50% methanol containing 1.2 M HCl and 20 mM sodium diethyldithiocarbamate as an antioxidant, in reactive vials. The samples were hydrolysed for 2 h at 90°C. Following hydrolysis, samples were centrifuged at 5000×g for 5 min and diluted with distilled water (pH 2.5) prior to analysis on the HPLC. The hydrolysed samples contained both free flavonoids and aglycones released from conjugated flavonoids following acid hydrolysis. The HPLC system used for the flavonoid analyses comprised a Shimadzu system consisting of a system controller, a binary pump (LC 20AC), a manual injector (Rheodyne 7725i manual injector), a column oven (CTO-10AS VP) and a dual channel UV detector (SPD-20A UV–VIS). Absorbance of the samples was monitored at a wavelength of 260 nm. Flavonoids in the samples were separated using a reversed-phase column (NovaPak C18, 150 × 3.0 mm, i.d 4 μm) (Waters, USA), at a temperature of 40°C. Separation of flavonoids was conducted using a gradient system containing 7–40% acetonitrile in water (pH 2.5) at a flow rate of 0.5 ml/min over 20 min. Standard solutions containing catechin, epicatechin, rutin, genistin, myricetin, morin, quercetin, genistein, kaempferol and isorhamnetin were prepared and injected on the HPLC under the same conditions.

Cell culture

The human hepatoblastoma HepG2 cell line (ATCC, Manassas, VA, USA) was grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% foetal bovine serum (Flowlab, Australia), 1% penicillin (Flowlab, Australia) and 1% streptomycin (Flowlab, Australia). Cells were maintained in humidified air with 5% CO2 at 37°C.

Cell viability analysis using the MTT assay

Cell viability of HepG2 cells in response to treatment with various concentration of the A. occidentale shoot extracts was analysed using an MTT assay as described by Mosmann, 1983 [28] with slight modifications [36]. Briefly, HepG2 cells at a density of 5000 cells per well were seeded in a 96-well ELISA microplate. The cells were incubated at 37°C in 5% CO2 for 24 h. After 24 h, increasing concentrations of the shoots extracts (0.2–5.0 mg/ml) were added into the wells, and the cells were further incubated for 48 h. Following this, MTT reagent (Merck) was added, and the mixture was incubated for 4 h. Next, the mixture in each well was removed, and formazan crystals formed were dissolved in 10 μl of 75% isopropanol. Spectrophotometric measurement of the mixture was performed in a microplate-reader (Bio-Rad) at 590 and 620 nm wavelengths. A linear plot of cell viability (%) against the concentrations of plant extracts was constructed.

Treatment of HepG2 cells for the microarray analysis

For the gene expression analysis, 80–95% confluent HepG2 cells maintained in DMEM were treated with shoot extracts at 0.4, 0.6 and 1.7 mg/ml. The cells were then incubated at 37°C for 24 h. As a control, cells were incubated in fresh DMEM, in the absence of the extracts. All experiments were performed in triplicate. After 24 h, cells were trypsinized and then precipitated by centrifugation at 261×g for 5 min. Following this, cells were washed with PBS twice before total cellular RNA (tcRNA) was extracted from the treated and untreated cells.

Extraction of total cellular RNA (tcRNA)

tcRNA from both treated and untreated (control) HepG2 cells was isolated and then purified using RNAEasy kit and RNase-free DNAse set (Qiagen) according to the manufacturer’s instructions. The quality of the tcRNA was estimated by measuring the absorbance ratio of 260–280 nm while its integrity was analysed using denaturing gel electrophoresis. An A260/A280 ratio above 1.8 indicated that the tcRNA was of good quality. The integrity of the tcRNA was indicated by the presence of two distinct bands corresponding to the ribosomal 28S and 18S subunits, with the intensity of the larger, 28S band approximately twice than that of the smaller, 18S band.

Microarray analysis

Affymetrix Human Gene 1.0 S.T (sense target) arrays were used for the gene expression analysis according to the conventional Affymetrix eukaryotic RNA labelling protocols (Affymetrix). Briefly, freshly extracted tcRNA (100 ng) isolated from the treated and untreated HepG2 cells was reversed transcribed to single-stranded sense strand DNA (cDNA) in two cycles using the Whole Transcript (WT) cDNA synthesis, amplification kit and sample clean-up module. The sense strand cDNA was then cleaved into small fragments using a mixture of UDP and apurinic/apyrimidinic endonuclease 1 or APE1. Following this, the fragments were end-labeled with biotinylated dideoxynucleotides using the WT Terminal Labeling kit. The biotinylated fragments (5.5 μg) were then hybridized to the Affymetrix Human Gene 1.0 S.T array at 45°C for 16 h in hybridization Oven 640. After hybridization, the arrays were stained and then washed in the Affymetrix Fluidics Station 450 under standard conditions. The stained arrays were scanned at 532 nm using an Affymetrix GeneChip Scanner 3000, and CEL files for each array were generated using the Affymetrix GeneChip® Operating Software (GCOS). The data were pre-analyzed using Affymetrix Expression Console software.

Microarray data normalization and analysis

The CEL files generated were converted to text files and exported to Partek Genomic Suite software to get the whole list of up-regulated and down-regulated genes. Probeset IDs without any annotation in the Partek software were filtered out. The filtered, whole gene list was then subjected to a one-way analysis of variance (ANOVA) in the Partek Genomic software, to determine significantly expressed sets of genes which was set according to P values less than 0.01 (P < 0.01) instead of P < 0.05 to avoid false positive results. Significantly expressed genes were then re-filtered to include only those with fold change difference of equal to or greater than 1.5. Additional information on the biological functions of the genes and the genes products was determined from the Gene Ontology (GO) Enrichment tool in the Partek Genomic Suite Software. Information on function of genes can be derived from the Gene Ontology database which provides a structured annotation of genes with respect to molecular function, biological process and cellular component. Further information on GO could be retrieved from http://www.geneontology.org/.

Validation of the DNA microarray data using qRT–PCR

The microarray data were verified using real-time relative quantitative RT–PCR (qRT–PCR) which was performed in a StepOne™ Real-Time PCR System (Applied BioSystem). The same cDNA and primer pairs for the selected up-regulated and down-regulated genes as well as a housekeeping gene, GADPH, as listed in Table 1 were used. The PCR amplification was carried out in 0.2 ml MicroAmp® Optical 8-tube strips in a final volume of 20 μl containing a mixture of cDNA (30 ng), reverse and forward primers (1 μM), pre-prepared Power SYBR® Green PCR master mix containing SYBR® Green 1 dye, AmpliTaq Gold® DNA Polymerase dNTPs, dUTP, Passive Reference 1 and optimized buffer components. The PCR parameters consisted of 40 cycles of amplification with initial denaturation at 95°C for 15 s, annealing of primers and elongation of the newly synthesized strands at 60°C for 60 s. The PCR mixture was initially held for 10 min at 95°C for AmpliTaq Gold® DNA polymerase activation. The Comparative CT Method (ΔΔCT) was chosen for the relative quantitation of gene expression. Each sample type was run in triplicate. mRNA levels of the selected genes were normalized against that of GADPH.
Table 1

Primer sequences for the selected genes used for validation of the microarray data using real-time relative quantitative PCR (qRT–PCR)

Gene name (Genebank ID)Primer sequencesProduct size (bp)
DHFR (NM_000791)

Forward: 5′ CATGGTCTGGATAGTTGGTGGC 3′

Reverse: 5′ GTGTCACTTTCAAAGTCTTGCATG 3′

108
TYMS (NM_001071)

Forward: 5′ ATCAAGGGATCCACAAATGA 3′

Reverse: 5′ GGTCAACTCCCTGTCCTGAA 3′

205
LIPC (NM_000236)

Forward: 5′ CAAGTGCCCTTGGACAAAGC 3′

Reverse: 5′ TGACAGCCCTGATTGGTTTCT 3′

130
CYP24A1 (NM_000782)

Forward: 5′ CTCATGCTAAATACCCAGGTG 3′

Reverse: 5′ TCGCTGGCAAAACGCGATGGG 3′

300
PLAUR (NM_002659)

Forward: 5′ TGCGGTGCATGCAGTGTAAGAC 3′

Reverse: 5′ TCAAGCCAGTCCGATAGCTCAG 3′

183
PLCXD1 (NM_018390)

Forward: 5′ ACGAGTACCTGGTCGCCTGTAT 3′

Reverse: 5′ CATAGGAGACGATGACCTGTTGG 3′

117
SQSTM1 (NM_003900)

Forward: 5′ CCAGTGACGAGGAATTGACAA 3′

Reverse: 5′ CATCGCAGATCACATTGGGG 3′

156
Primer sequences for the selected genes used for validation of the microarray data using real-time relative quantitative PCR (qRT–PCR) Forward: 5′ CATGGTCTGGATAGTTGGTGGC 3′ Reverse: 5′ GTGTCACTTTCAAAGTCTTGCATG 3′ Forward: 5′ ATCAAGGGATCCACAAATGA 3′ Reverse: 5′ GGTCAACTCCCTGTCCTGAA 3′ Forward: 5′ CAAGTGCCCTTGGACAAAGC 3′ Reverse: 5′ TGACAGCCCTGATTGGTTTCT 3′ Forward: 5′ CTCATGCTAAATACCCAGGTG 3′ Reverse: 5′ TCGCTGGCAAAACGCGATGGG 3′ Forward: 5′ TGCGGTGCATGCAGTGTAAGAC 3′ Reverse: 5′ TCAAGCCAGTCCGATAGCTCAG 3′ Forward: 5′ ACGAGTACCTGGTCGCCTGTAT 3′ Reverse: 5′ CATAGGAGACGATGACCTGTTGG 3′ Forward: 5′ CCAGTGACGAGGAATTGACAA 3′ Reverse: 5′ CATCGCAGATCACATTGGGG 3′

Results

Cell viability analysis

MTT assays were performed to measure the viability of the cells in response to the treatment with different concentrations of the shoot extracts. The dose–response curve of the viability of HepG2 cells in response to the treatment with different concentrations of the methanol extract of A. occidentale shoots is shown in Fig. 1. The graph shows a tri-phasal response. In the first phase, cell viability was maintained above 90% until 0.6 mg/ml of the extract concentration was reached. In the second phase, cell viability decreased steeply to below 20% from 0.6 to 3 mg/ml extract concentrations. In the third phase, the cells barely survived (viability below 10%) beyond 5 mg/ml extract concentration. The concentration of the shoot extract that reduced cell viability by 50% (IC50) was 1.7 mg/ml. Low concentrations of 0.4 and 0.6 mg/ml as well as the IC50 concentration were subsequently chosen for the gene expression analysis.
Fig. 1

A dose–response curve of percentage viability of HepG2 cells (5,000 cells/well) treated with various concentrations of the extract of the A. occidentale shoots (0.2–5.0 mg/ml). Analysis was done in triplicate, and the results were expressed as % of HepG2 cell viability ± std dev. From the plot, the IC50 was found to be 1.7 mg/ml

A dose–response curve of percentage viability of HepG2 cells (5,000 cells/well) treated with various concentrations of the extract of the A. occidentale shoots (0.2–5.0 mg/ml). Analysis was done in triplicate, and the results were expressed as % of HepG2 cell viability ± std dev. From the plot, the IC50 was found to be 1.7 mg/ml

HPLC analysis

HPLC analyses of the hydrolysed samples revealed the presence of quercetin and kaempferol (Fig. 2a) and the absence of catechin, epicatechin, rutin, genistin, genistein, myricetin, morin and isorhamnetin. The quercetin and kaempferol peaks were confirmed by comparing retention times of the peaks with the standards (Fig. 2b) which was run under the same conditions as the samples. The presence of kaempferol has not been reported previously.
Fig. 2

Gradient reverse phase HPLC analysis of flavonoids in the shoots of A. occidentale and the flavonoid standards. HPLC analysis was performed on the hydrolysed samples of A. occidentale (Fig. 2a) and the flavonoid standards (Fig. 2b). Flavonoids were separated on a NovaPak C18 reversed-phase column (150 × 3.0 mm i.d, 4 μm), using a linear gradient system of 7–40% acetonitrile in water (pH 2.5), at a flow rate of 0.5 ml/min. Absorbance was measured at a wavelength of 260 nm. 1:quercetin; 2:kaempferol

Gradient reverse phase HPLC analysis of flavonoids in the shoots of A. occidentale and the flavonoid standards. HPLC analysis was performed on the hydrolysed samples of A. occidentale (Fig. 2a) and the flavonoid standards (Fig. 2b). Flavonoids were separated on a NovaPak C18 reversed-phase column (150 × 3.0 mm i.d, 4 μm), using a linear gradient system of 7–40% acetonitrile in water (pH 2.5), at a flow rate of 0.5 ml/min. Absorbance was measured at a wavelength of 260 nm. 1:quercetin; 2:kaempferol

Microarray analysis: normalization and visualization of data

Figure 3 shows the principal component analysis (PCA) plot of the microarray data for each of the array for the control and samples treated with 0.4, 0.6 and 1.7 mg/ml of the shoot extracts. The three arrays for the control samples were grouped together but separately from those of the treated samples. Figure 4 shows hierarchical clustering of the microarray data generated from each of the arrays where the reproducibility pattern correlates with that shown by the PCA plot.
Fig. 3

A principal component analysis (PCA) plot derived from biological replicates (n = 3) of HepG2 cells grown in 0.4, 0.6 and 1.7 mg/ml of the extracts of the A. occidentale shoots

Fig. 4

Hierarchical cluster analysis of genes showing the differential expression of genes in HepG2 cells in response to the treatment with 0.4, 0.6 and 1.7 mg/ml of extracts of A. occidentale shoots

A principal component analysis (PCA) plot derived from biological replicates (n = 3) of HepG2 cells grown in 0.4, 0.6 and 1.7 mg/ml of the extracts of the A. occidentale shoots Hierarchical cluster analysis of genes showing the differential expression of genes in HepG2 cells in response to the treatment with 0.4, 0.6 and 1.7 mg/ml of extracts of A. occidentale shoots Venn diagram in Fig. 5 shows the number of genes that were significantly regulated (P < 0.01) by at least 1.5-fold. The total number of genes regulated by 0.4, 0.6 and 1.7 mg/ml of the methanol extracts of A. occidentale were 246, 696 and 4,503, respectively. An increase in concentration by 1.5-fold from 0.4 to 0.6 mg/ml was able to increase the number of regulated genes by threefold (65%). In addition, increasing the concentration from 0.4 to 1.7 mg/ml increased the number of regulated genes by 18-fold (95%). Figure 5 also shows that a total of 94 genes were mutually regulated in response to the three concentrations where 5 were up-regulated and 89 were down-regulated. Ninety-eight genes were mutually regulated in response to the 0.4 and 0.6 mg/ml extracts. On the other hand, 178 were mutually regulated in response to the 0.4 and 1.7 mg/ml extracts. A larger number of genes, with a total of 571, were regulated when cells were treated with 0.6 and 1.7 mg/ml of the extracts.
Fig. 5

A Venn diagram illustrating the number of genes in HepG2 cells that were mutually regulated at 0.4, 0.6 and 1.7 mg/ml of the shoot extracts. The total numbers of genes regulated at 0.4, 0.6 and 1.7 mg/ml of the extracts of A. occidentale were 246, 696 and 4503 respectively. An increase in concentration by 1.5-fold from 0.4 to 0.6 mg/ml was able to increase the number of regulated genes by threefold (65%). Increasing the concentration from 0.4 to 1.7 mg/ml increases the number of regulated genes by 18-fold (95%). A total of 94 genes were mutually regulated in response to the 3 concentrations, 5 were up-regulated and 89 were down-regulated. Ninety-eight genes were mutually regulated in response to the 0.4 and 0.6 mg/ml extracts. On the other hand, 178 were mutually regulated in response to the 0.4 and 1.7 mg/ml extracts. A larger number of genes of 571 were mutually regulated when cells were treated with 0.6 and 1.7 mg/ml extracts

A Venn diagram illustrating the number of genes in HepG2 cells that were mutually regulated at 0.4, 0.6 and 1.7 mg/ml of the shoot extracts. The total numbers of genes regulated at 0.4, 0.6 and 1.7 mg/ml of the extracts of A. occidentale were 246, 696 and 4503 respectively. An increase in concentration by 1.5-fold from 0.4 to 0.6 mg/ml was able to increase the number of regulated genes by threefold (65%). Increasing the concentration from 0.4 to 1.7 mg/ml increases the number of regulated genes by 18-fold (95%). A total of 94 genes were mutually regulated in response to the 3 concentrations, 5 were up-regulated and 89 were down-regulated. Ninety-eight genes were mutually regulated in response to the 0.4 and 0.6 mg/ml extracts. On the other hand, 178 were mutually regulated in response to the 0.4 and 1.7 mg/ml extracts. A larger number of genes of 571 were mutually regulated when cells were treated with 0.6 and 1.7 mg/ml extracts Mutually regulated genes in response to the three concentrations included CDKN3, LOC100289612, DHFR, VRK1, CDC6, AURKB, CYP2S1 and GABRE (Table 2). Genes like CYP24A1, CDH2, E2F5, BRCA1, BRCA2, AURKA, CDC2 (CDK1), CDK2, CDK4, CHECK1, CCNA2, ACAT, IGFBP1, DUSP5 and INSR were significantly regulated at 0.6 and 1.7 mg/ml but not at 0.4 mg/ml. In addition, the expressions of genes such as the LGR5, IGFBP3, RB1, IDE, LDLR, MTTP, APOB, SCP2, MTIX, SOD and SOD3 were exclusively regulated at the 1.7 mg/ml dose. Amongst the highly significantly suppressed genes were CYP24A1, LGR5, CDH2 and DHFR by 27.8-, 16.4-, 15.5-, 10.0-fold, respectively. On the other hand, amongst the highly induced genes were the DUSP5, IGFBP 3, IGFBP1, LDLR and INSR by 9.1-, 8.0-, 4.2-, 3.6- and 2.6-fold, respectively (Table 2).
Table 2

Selected significantly expressed genes in HepG2 cells in response to treatment with 0.4, 0.6 and 1.7 mg/ml of the extracts of A. occidentale shoots

Gene IDGene nameGene productFold change (0.4 mg/ml)Fold change (0.6 mg/ml)Fold change (1.7 mg/ml)
NM_005192 CDKN3 Cyclin-dependent kinase inhibitor 3−2.7−2.6−10.5
AY605064 LOC100289612 Arsenic transactivated protein 1−3.0−3.6−10.2
AK293146 DHFR Dihydrofolate reductase−2.4−2.4−10.0
NM_003384 VRK1 Vaccinia related kinase 1−2.3−2.6−6.7
NM_001254 CDC6 Cell division cycle 6 homolog (S. cerevisiae)−2.4−2.7−4.3
NM_030622 CYP2S1 Cytochrome P450, family 2, subfamily S, polypeptide 1+1.8+2.3+3.5
NM_004961 GABRE Gamma-aminobutyric acid (GABA) A receptor, epsilon+1.6+2.1+2.7
NM_004217 AURKB Aurora kinase B−1.6−1.6−2.2
NM_000782 CYP24A1 Cytochrome P450, family 24, subfamily A, polypeptide 1NR−2.9−27.8
NM_001792 CDH2 Cadherin 2, type 1, N-cadherin (neuronal)NR−1.8−15.5
NM_001951 E2F5 E2F transcription factor 5, p130-bindingNR−1.9−5.5
NR_027676 BRCA1 Breast cancer 1, early onsetNR−2.4−5.1
NM_000236 LIPC Lipase, hepaticNR−3.2−4.7
NM_198433 AURKA Aurora kinase ANR−1.5−4.4
NM_001786 CDC2 Cell division cycle 2, G1 to S and G2 to MNR−2.5−4.1
NM_001798 CDK2 Cyclin-dependent kinase 2NR−2.0−3.2
NM_001237 CCNA2 Cyclin A2NR−1.7−3.1
NM_000059 BRCA2 Breast cancer 2, early onsetNR−2.0−2.7
NM_000019 ACAT1 Acetyl-coenzyme A acetyltransferase 1NR−1.9−2.6
NM_000075 CDK4 Cyclin-dependent kinase 4NR−1.8−2.6
NM_001274 CHEK1 CHK1 checkpoint homolog (S. pombe)NR−1.8−2.3
NM_000208 INSR Insulin receptorNR+2.3+2.6
NM_000596 IGFBP1 Insulin-like growth factor binding protein 1NR+3.7+4.2
NM_004419 DUSP5 Dual specificity phosphatase 5NR+3.3+9.1
NM_003667 LGR5 Leucine-rich repeat-containing G protein-coupled receptor 5NRNR−16.4
NM_000321 RB1 Retinoblastoma 1NRNR−7.6
NM_031966 CCNB1 Cyclin B1NRNR−5.7
NM_000253 MTTP Microsomal triglyceride transfer proteinNRNR−3.7
NM_002979 SCP2 Sterol carrier protein 2NRNR−3.5
NM_004969 IDE Insulin-degrading enzymeNRNR−2.1
NM_000384 APOB Apolipoprotein BNRNR−2.0
NM_001013398 IGFBP3 Insulin-like growth factor binding protein 3NRNR+8.0
NM_000527 LDLR Low-density lipoprotein receptorNRNR+3.6
NM_005952 MTIX Metallothionein 1XNRNR+2.8
NM_003102 SOD3 Superoxide dismutase 3, extracellularNRNR+2.1

Details of the GenBank accession number, name of the gene and its respective gene product, fold change difference between treated and non-treated cells and p values are included. NR Not regulated

Selected significantly expressed genes in HepG2 cells in response to treatment with 0.4, 0.6 and 1.7 mg/ml of the extracts of A. occidentale shoots Details of the GenBank accession number, name of the gene and its respective gene product, fold change difference between treated and non-treated cells and p values are included. NR Not regulated Other genes that were being significantly regulated in response to the 1.7 mg/ml shoot extracts were those associated with cell cycle check points either directly or indirectly. These included the CDK5, CDK6, CCNB1 and 2, CCNE1 and 2, CCNH, CDKN1A (p21/Cip1), CDKN1C (p57/Kip2), CDKN2B (p15), CDKN2D (p19), CDKN3, RBL1, RBL2, NSUN6, NOP2, DAPK1, PAK2, HDAC2 and G2E3. Genes coding for other ubiquitin ligase isoforms, UBE2C and UBE3B, were also aberrantly expressed. In addition, genes associated with the Wnt/β-catenin signalling pathway including the Wnt6, FZDs 1, 4, 6, 7, 8, 9 and 10, CDH1, CTNNA2, DKK1, APC, NUCKS1, CSNK1G2, CSNK1G3 and TCF were all aberrantly expressed. In addition, genes associated with cancers, BRIP1, BAP, BRCC3, RAS, SOS1, STAT2, were all down-regulated (data not shown).

Gene ontology (GO): biological interpretation

Gene ontology analysis of the products of the significantly regulated genes in response to the 3 concentrations of the A. occidentale shoot extracts is shown in Figs. 6, 7 and 8. The data are presented according to the following categories; biological process (Fig. 6), molecular function (Fig. 7) and cell component (Fig. 8). Selected significantly down-regulated and up-regulated genes in each of the category are shown in Table 3.
Fig. 6

Gene ontology analysis under the “Biological process” category, of significantly regulated genes (P < 0.01, fold change of at least ±1.5) in HepG2 cells in response to 0.4 mg/ml (a), 0.6 mg/ml (b) and 1.7 mg/ml (c) of the extracts of A. occidentale shoots

Fig. 7

Gene ontology analysis under the “Molecular function” category, of significantly regulated genes (P < 0.01, fold change of at least ±1.5) in HepG2 cells in response to 0.4 mg/ml (a), 0.6 mg/ml (b) and 1.7 mg/ml (c) of the extracts of A. occidentale shoots

Fig. 8

Gene ontology analysis under the “Cellular component” category, of significantly regulated genes (P < 0.01, fold change of at least ±1.5) in HepG2 cells in response to 0.4 mg/ml (a), 0.6 mg/ml (b) and 1.7 mg/ml (c) of the extracts of A. occidentale shoots

Table 3

Gene ontology analysis of selected significantly regulated genes

(A) Gene ontology (Biological process)Selected down-regulated genesSelected up-regulated genes
Cellular processCYP24A1, DHFR, CDH1, CDH2, CDC2, CDK2, CDK4, CDK5, CDK6, CDKN3, CCNA2, CCNB1, CCNB2, CCNE1, CCNE2, CHEK1, RB1, AURKA, AURKB, BRCA1, BRCA2, IDE, LIPC, MTTP, SCP2, APOB, ACAT1DUSP5, INSR, IRS2, SOD2, SOD3, LDLR
Biological regulationCDH1, CDC2, CDK2, CDK4, CDK5, CDK6, CDKN3, CHEK1, CCNA2, CCNB1, CCNB2, CCNE1, CCNE2, E2F4, AURKA, RB1, CKS1B, PAK2, BRCA1, BRCA2, CSNK1G3, FZD4, FZD6, LIPC, APOB, APOBEC3F, APOH, MTTP, IDECDH4, CDKN2B, CDKN1A, APC2, IRS2, WNT6, FZD1, FZD7, FZD8, FZD9, FZD10, IGFBP1, IGFBP2, IGFBP3, IGFBP6, INSR, LDLR, SOD2
Metabolic processCDH1, CCNH, CHEK1, CDK5, E2F4, CYP24A1, RB1, DHFR, BRCA1, LIPC, MAOB, MTTP, SCP2, ACAT1, APOBAPC2, SOD2, SOD3, INSR, LDLR
Response to stimuliBRCA1, BRCA2, CHEK1, CDK5IRS2, CDKN2D, SOD2, SOD3, CDKN2B, CDKN1A, MT1X
Establishment of localizationLIPC, MTTP, SCP2, APOBLDLR
Developmental processCDH2, RB1, CCNB2, BRCA1, SCP2, FZD6, CDK6, BRCA2, CCNF, DKK1, CDK5 E2F4, IDE, APOB, CDH1, FZD4FZD7, CDK5R1, FZD9, IRS2, IGF2, CDKN2D, FZD10, CDKN1C, SOD2, FZD8, WNT6, FZD1, INSR
Multi-organism processRB1INSR, LDLR
Biological adhesionCDH2, FZD6, CDK5, CDH1CDH4
Reproductive processSCP2, BRCA2, CHEK1, APOB
Multicellular organismal processAPOH, ACAT1, CDK5, E2F4FZD9, LDLR
Rythmic processCDK4
GrowthCCNB2, BRCA2
PigmentationSOD2

Genes were categorized according to their involvement in biological process (A), molecular function (B) and as cell component (C)

Gene ontology analysis under the “Biological process” category, of significantly regulated genes (P < 0.01, fold change of at least ±1.5) in HepG2 cells in response to 0.4 mg/ml (a), 0.6 mg/ml (b) and 1.7 mg/ml (c) of the extracts of A. occidentale shoots Gene ontology analysis under the “Molecular function” category, of significantly regulated genes (P < 0.01, fold change of at least ±1.5) in HepG2 cells in response to 0.4 mg/ml (a), 0.6 mg/ml (b) and 1.7 mg/ml (c) of the extracts of A. occidentale shoots Gene ontology analysis under the “Cellular component” category, of significantly regulated genes (P < 0.01, fold change of at least ±1.5) in HepG2 cells in response to 0.4 mg/ml (a), 0.6 mg/ml (b) and 1.7 mg/ml (c) of the extracts of A. occidentale shoots Gene ontology analysis of selected significantly regulated genes Genes were categorized according to their involvement in biological process (A), molecular function (B) and as cell component (C) Figures 6, 7 and 8 show that most of the genes (and the subsequent gene products) are involved in cellular processes, biological regulations and metabolic processes in response to the three concentrations of the extracts. A total of 18 genes that are involved in localization, growth, locomotion and pigmentation were regulated in response to the 0.6 mg/ml but not the 0.4 mg/ml extracts. As the concentration was increased from 0.6 to 1.7 mg/ml, the number of genes rose from 18 to 88 in the same 3 subcategories. In addition, 3 genes that are involved in reproduction were regulated only in the presence of 1.7 mg/ml of the extracts. Genes like CYP24A1 and DHFR are involved in cellular as well as metabolic processes (Table 3A). In addition, under the “Molecular function” category, the majority of genes that were regulated in response to the 3 concentrations were involved in binding, followed by catalytic activity and transcriptional regulation activity (Fig. 7). Table 3B lists selected genes such as INSR and LDLR that are involved in binding, MAOB in catalytic activity and RB1 in transcription regulator activity. The majority of the gene products were found as cell part, in extracellular region/part and in synapses (Fig. 8), and the selected genes are listed in Table 3C.

Validation of the microarray data using qRT–PCR

The microarray data were validated by quantitating selected significantly regulated genes, PLAUR, PLCXD1, SQSTM1, CYP24A1, DHFR, TYMS and LIPC using real-time RT–PCR (qRT–PCR). All data were normalized to the reference gene, GAPDH. As shown in Fig. 9, the expressions of the PLAUR, PLCXD1 and SQSTM1 genes were all up-regulated while those of CYP24A1, DHFR, TYMS and LIPC were down-regulated. The expression patterns obtained through qRT–PCR analysis were consistent with those of the microarray results.
Fig. 9

Validation of the microarray data using semi-quantitative RT–PCR (qRT–PCR). A few genes that were significantly regulated in HepG2 cells in response to treatment with extracts of the A. occidentale shoots were selected namely PLAUR, PLCXD1, SQSTM1, CYP24A1, DHFR, TYMS and LIPC using real-time RT–PCR. All data were normalized to the reference gene, GAPDH. The expressions of the PLAUR, PLCXD1 and SQSTM1 genes were all up-regulated while those of CYP24A1, DHFR, TYMS and LIPC were down-regulated. The expression patterns obtained through real-time RT–PCR were consistent with the microarray results

Validation of the microarray data using semi-quantitative RT–PCR (qRT–PCR). A few genes that were significantly regulated in HepG2 cells in response to treatment with extracts of the A. occidentale shoots were selected namely PLAUR, PLCXD1, SQSTM1, CYP24A1, DHFR, TYMS and LIPC using real-time RT–PCR. All data were normalized to the reference gene, GAPDH. The expressions of the PLAUR, PLCXD1 and SQSTM1 genes were all up-regulated while those of CYP24A1, DHFR, TYMS and LIPC were down-regulated. The expression patterns obtained through real-time RT–PCR were consistent with the microarray results

Discussion and conclusion

In Malaysia, the young leaves or shoots of the A.occidentale are widely consumed as salads and the locals believed its benefits include diabetes control or prevention. The methanol extracts of the shoots were found to have potent antioxidant activities [35]. Bioactive compounds found in the A. occidentale shoot extracts that could be linked to the antioxidant activities and other medicinal properties included myricetin and quercetin [19, 27], amentoflavone [19] and agathisflavone [20]. Dietary antioxidants could be absorbed through the intestine, albeit in small quantities. Once in the circulation, they are quickly metabolized [14, 44] but the antioxidant properties were retained [25]. Our group had reported that low concentration of crude extract of antioxidant-rich T. indica (0.3 mg/ml) was able to significantly regulate a sizable number of genes in HepG2 cells [36]. In this study, based on the MTT assays, cells showed more than 90% viability at 0.4 and 0.6 mg/ml. The IC50 concentration was found to be 1.7 mg/ml. This study was aimed to (1) investigate the effects of low and high concentration of the A. occidentale shoot extracts on the expression of genes in liver HepC2 cells and (2) identify genes that could be associated with the medicinal properties of the shoot extracts. HPLC analyses showed the presence of quercetin in the extracts of the A. occidentale shoots that confirmed earlier findings by other researchers [19, 27]. In addition, we also detected the presence of kaempferol which has not been reported previously. Kaempferol possessed significant antioxidant activities [34] and has cancer chemopreventive properties towards several tumour cell lines including lung and leukaemic cell lines [8, 31]. In this study, cDNA microarray analysis showed that the extracts of the A. occidentale shoots at a low concentration of 0.4 mg/ml was able to significantly up-regulated (P < 0.01) a total of 248 genes by at least 1.5-fold. Amongst the down-regulated genes were those encoding arsenic transactivated protein (LOC100289612), vaccinia-related kinase 1 (VRK1), dihydrofolate reductase (DHFR), cell division cycle 6 homolog (S.cerevisiae) ( CDC6), cyclin-dependent kinase inhibitor 3 (CDKN3) and aurora kinase B (AURKB). Increasing the concentrations from 0.4 to 0.6 mg/ml led to an increase in the number of regulated genes from 248 to 696. Amongst the 696 genes were CYP24A1, CDH2, E2F5, BRCA1, BRCA2, AURKA, CDC2 (CDK1), CDK2, CDK4, CHECK1, CCNA2, ACAT, IGFBP1, DUSP5 and INSR. These genes were also expressed in response to the IC50 concentration, but as expected, the fold change was much larger compared to that of the 0.6 mg/ml. At an IC50 concentration of 1.7 mg/ml, a total of 4286 genes were significantly regulated. In addition, the expressions of genes such as the LGR5, IGFBP3, RB1, IDE, LDLR, MTTP, APOB, SCP2, MTIX, SOD and SOD3 were exclusively regulated at the 1.7 mg/ml dose. Interestingly, for all three concentrations, the down-regulated genes were three times as many as those that were up-regulated (full data are not shown) as indicated in the hierarchical analysis. Mutually regulated genes in response to the three concentrations included CDKN3, LOC100289612, DHFR, VRK1, CDC6, AURKB, CYP2S1 and GABRE (Table 2). Amongst the highly significantly suppressed genes were CYP24A1, LGR5, CDH2 and DHFR by 27.8-, 16.4-, 15.5-, 10.0-fold, respectively. On the other hand, amongst the highly induced genes were the DUSP5, IGFBP 3, IGFBP1, LDLR and INSR by 9.1-, 8.0-, 4.2-, 3.6- and 2.6-fold, respectively. CYP24A1 gene codes for the hepatic enzyme, CYP24A1 or 24-hydroxylase which is the rate limiting enzyme in the catabolism of the active form of vitamin D, 1α,25-(OH)2D3 or calcitriol [18, 23]. 1α, 25-(OH)2 D3, synthesized in the kidney by the CYP27B1, promotes dietary absorption of calcium and phosphate as well as maintain the levels of the two minerals. There are increasing evidences that individuals with low serum vitamin D have a higher risk of developing various types of cancers [18, 23] and myocardial diseases [33]. In addition, 1α, 25-(OH)2 D3 is also important in regulating cell cycle check points as well as controlling multiple signalling pathways including those of the MAPK/ERK, PI3 K/AKT, Wnt and TGF-β [5]. The CYP24A1 gene has been reported to act as an oncogene and its overexpression was detected in cancers of the colon, ovary and lung [2, 18, 23]. In vivo studies have indicated that exposing cancer cells to a high concentration of the active metabolites of vitamin D stopped the cells from progressing. This occurred via a mechanism affecting cell cycle and increasing apoptosis, ultimately slowing or stopping growth of the tumour [45]. The shoot extracts of the A. Occidentale were able to highly suppress the CYP24A1 gene; hence, it has the potential to be used synergistically with vitamin D to maintain the bioavailability and bioactivity of the latter. Apart from the CYP24A1 gene, LGR5 and CDH2 were also highly suppressed, by 16- and 15-fold respectively at the IC50 concentration of the shoot extracts. The leucine-rich repeat-containing G-protein-coupled receptor 5 (LGR5) belongs to the G-protein-coupled receptor (GPCR) superfamily [15]. LGR5 had been reported to be a marker of adult stem cells where the LGR5 gene transcription is under the control of the canonical or beta-catenin Wnt signalling pathway [11]. This pathway, which is involved in embryogenesis and normal physiological processes, is critical in the regulation of adult stem cells [11, 37]. Dysregulation of this pathway is linked to cancers [37]. An overexpression of LGR5 was observed in many types of cancers including those of the colon [26, 46], oesophagus [4], ovary [26] and the hepatocytes [47]. In this study, genes associated with the Wnt/β-catenin signalling pathway were also regulated at the IC50 concentration, albeit modestly. These included the Wnt6, FZDs 1, 4, 6, 7, 8, 9 and 10, CDH1, CDH2, CTNNA2, DKK1, APC, NUCKS1, CSNK1G2, CSNK1G3 and TCF (data not shown). One of the most interesting observations of this study was the fact that the shoot extracts were able to directly regulate a spectrum of genes involved in the G1 as well as G2 cell cycle check points. These included the CDK1 (CDC2), CDK2, CDK4, CDK5, CDK6, CCNA2, CCNB1 and 2, CCNE1 and 2, CCNH, CDKN1A (p21/Cip1), CDKN1C (p57/Kip2), CDKN2B (p15), CDKN2D (p19), CDKN3, RB1, RBL1, RBL2, NSUN6, NOP2, AURKA, AURKB, DAPK1, PAK2, E2F5, HDAC2, VRK1, CREB and G2E3. Genes coding for other ubiquitin ligase isoforms, UBE2C and UBE3B, was also aberrantly expressed. VRK1 is involved in the regulation of DNA replication through the phosphorylation of CREB leading to the regulation of CCND1 gene expression [17]. Aurora kinases comprise three members, Aurora A, Aurora B and Aurora C. Aurora-A is transcriptionally regulated by E2F3 during a cell cycle. E2F3 induces Aurora-A expression by binding directly to Aurora-A promoter and subsequently stimulates the promoter activity [12]. Both could thus be an important target for cancer intervention [12]. In addition, aurora-B has been shown to be overexpressed in many cancers including breast cancers [10]. The methanol extracts of the A. occidentale shoots at the IC50 concentration, suppressed the Aurora A and Aurora B, but not Aurora C, by fourfold and twofold respectively. An RNA methyltransferase, NSUN2 had been shown to be a novel substrate for Aurora B, which contained a NOL/NOP/sun domain [38]. In this study, the extracts were able to suppress both Aurora A and Aurora B as well as NOP2 and NSUN6, suggesting its potential as an anti-cancer agent. Insulin-like growth factor binding protein-3 (IGFBP3) inhibits the growth of non-small cell lung cancer (NSCLC) cells. IGFBP3 overexpression inhibits the phosphorylation of Akt and glycogen synthase kinase-3 beta and the activity of MAPK, all three are activated by IGF-mediated signalling pathways that have mitogenic and anti-apoptotic properties and have been implicated in the development of lung cancer [24]. Nuclear IGFBP3 induces apoptosis and is targeted to ubiquitin/proteosome-dependent proteolysis. IGFBP3 degradation is dependent on active ubiquitin-E1 ligase [41]. The shoot extracts also up-regulated LDLR gene which correlated with findings by Salleh et al. [39] who reported that the cashew shoots were able to increase LDLR activity in cultured HepG2 cells. Other genes associated with lipid metabolism including LIPC, ACAT1, MTTP, APOB and SCP2 were down-regulated. LDL-R is responsible for the internalization of cholesterol-rich lipoprotein, LDL, from the blood circulation through the recognition of its ApoB by the receptor [6]. SCP2 gene expression was reported to be enhanced by oxidized LDL [13] which could be ingested by macrophages leading to the formation of foam cells, a critical step in atherosclerosis. ACAT is responsible to convert free cholesterol to cholesteryl ester in tissues. ACAT1 is the main isoenzyme in the neuronal brain [7], and its presence is associated with certain forms of Alzheimer disease. MTTP encodes microsomal triacylglycerol transfer protein (MTP) which is required for the assembly of nascent chylomicrons and VLDL while hepatic lipase encoded by LIPC does not only hydrolyses triacylglycerols and phospholipids in circulating plasma lipoproteins, it also regulates lipoprotein uptake by cells [40]. Except for the ACAT1, the expression of the LDLR, MTTP, SCP2 and APOB genes was only observed in response to the IC50 concentration, not those of 0.4 and 0.6 mg/ml suggesting a concentration-dependent expression of the genes. The anti-diabetic properties of the shoot extracts could be linked to the up-regulation of the genes coding for the insulin receptor and the down-regulation of the insulin-degrading enzyme (IDE). The hypolipidaemic, anti-diabetic and anti-cancer properties could be attributed to the presence of quercetin and kaempferol in the shoot extracts of the A. occidentale. Quercetin and kaempferol are normally present in nature as glycosides. Free and glycoside forms of the two flavonoids are absorbed in the intestine (9, 14, 48) and are found conjugated with glucuronides or sulphates in the blood circulation. The concentrations of the extracts selected in the study were based on MTT assays whereby cell viability was maintained above 90% at the extract concentrations of 0.3 and 0.4 mg/ml. The concentrations used were probably not a true reflection of the flavonoids levels in the plasma as it was reported that the levels of free and conjugated flavonoids such as kaempferol in blood was in the range of 1.7–6.1 μg/ml after oral ingestion of 25–50 mg/kg body weight [48]. However, when using an in vitro model like HepG2 cells, sometimes it is necessary to use higher concentrations of extracts to see significant changes in gene expression [36]. Nevertheless, this in vitro study is still useful to provide preliminary information on the possible molecular mechanisms in relation to the medicinal properties of the shoot extracts of A. occidentale. Further confirmation using an in vivo model would need to be carried out to corroborate the in vitro findings.

Conclusion

In conclusion, low concentrations of the shoot extracts of A. occidentale were able to significantly regulate a sizable number of genes in HepG2 cells. However, the type of the expressed genes was highly dependent on the concentration of the extracts used. Amongst the genes that were significantly regulated were those involved in regulating cell cycle check points, apoptosis and cell proliferation, lipoprotein metabolism and insulin signalling suggesting the potential of the plant to act as anti-cancer, hypolipidaemic and anti-diabetic agents.
  42 in total

1.  Antimicrobial activity of Anacardium occidentale bark.

Authors:  D A Akinpelu
Journal:  Fitoterapia       Date:  2001-03       Impact factor: 2.882

2.  Absorption, excretion, and distribution of dietary antioxidant betalains in LDLs: potential health effects of betalains in humans.

Authors:  Luisa Tesoriere; Mario Allegra; Daniela Butera; Maria A Livrea
Journal:  Am J Clin Nutr       Date:  2004-10       Impact factor: 7.045

3.  Identification of Aurora-A as a direct target of E2F3 during G2/M cell cycle progression.

Authors:  Lili He; Hua Yang; Yihong Ma; W Jack Pledger; W Douglas Cress; Jin Q Cheng
Journal:  J Biol Chem       Date:  2008-09-07       Impact factor: 5.157

4.  Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays.

Authors:  T Mosmann
Journal:  J Immunol Methods       Date:  1983-12-16       Impact factor: 2.303

5.  Anacardic acid (6-nonadecyl salicylic acid), an inhibitor of histone acetyltransferase, suppresses expression of nuclear factor-kappaB-regulated gene products involved in cell survival, proliferation, invasion, and inflammation through inhibition of the inhibitory subunit of nuclear factor-kappaBalpha kinase, leading to potentiation of apoptosis.

Authors:  Bokyung Sung; Manoj K Pandey; Kwang Seok Ahn; Tingfang Yi; Madan M Chaturvedi; Mingyao Liu; Bharat B Aggarwal
Journal:  Blood       Date:  2008-03-18       Impact factor: 22.113

6.  Characterization of two LGR genes homologous to gonadotropin and thyrotropin receptors with extracellular leucine-rich repeats and a G protein-coupled, seven-transmembrane region.

Authors:  S Y Hsu; S G Liang; A J Hsueh
Journal:  Mol Endocrinol       Date:  1998-12

7.  Absorption and excretion of conjugated flavonols, including quercetin-4'-O-beta-glucoside and isorhamnetin-4'-O-beta-glucoside by human volunteers after the consumption of onions.

Authors:  A A Aziz; C A Edwards; M E Lean; A Crozier
Journal:  Free Radic Res       Date:  1998-09

8.  Tyrosinase inhibitors from Anacardium occidentale fruits.

Authors:  I Kubo; I Kinst-Hori; Y Yokokawa
Journal:  J Nat Prod       Date:  1994-04       Impact factor: 4.050

Review 9.  Vitamin D analogs: therapeutic applications and mechanisms for selectivity.

Authors:  Alex J Brown; Eduardo Slatopolsky
Journal:  Mol Aspects Med       Date:  2008-05-01

Review 10.  Neuronal cholesterol esterification by ACAT1 in Alzheimer's disease.

Authors:  Ta-Yuan Chang; Catherine C Y Chang; Elena Bryleva; Maximillian A Rogers; Stephanie R Murphy
Journal:  IUBMB Life       Date:  2010-04       Impact factor: 3.885

View more
  2 in total

1.  Investigation into the effects of antioxidant-rich extract of Tamarindus indica leaf on antioxidant enzyme activities, oxidative stress and gene expression profiles in HepG2 cells.

Authors:  Nurhanani Razali; Azlina Abdul Aziz; Chor Yin Lim; Sarni Mat Junit
Journal:  PeerJ       Date:  2015-10-01       Impact factor: 2.984

2.  Antioxidant-rich leaf extract of Barringtonia racemosa significantly alters the in vitro expression of genes encoding enzymes that are involved in methylglyoxal degradation III.

Authors:  Kin Weng Kong; Azlina Abdul Aziz; Nurhanani Razali; Norhaniza Aminuddin; Sarni Mat Junit
Journal:  PeerJ       Date:  2016-08-25       Impact factor: 2.984

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.